Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection

Size: px
Start display at page:

Download "Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection"

Transcription

1 Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection Md. Shamim Akhter et al. Online Supplementary Materials Supplementary methods Preparation of hammer blots (HBs) and RNA extraction Healthy and virus-inoculated plant leaves were harvested to prepare HBs, from which nucleic acids were extracted. The proposed procedure is as follows (see also supplementary Figure S1). 1. Petiole and midrib were excised, and the leaf tissue was taped on either side for single-sided blotting. Vinyl chloride tape made for electric insulation (Vinyl tape 74, 3M) worked well in our hands. 2. The taped leaf tissue was sandwiched between two layers of filter paper (Whatman 3MM) and placed into a plastic folder. Alternatively, the assembled leaf tissue and filter papers were wrapped with a wrapping film. 3. The leaf tissue was smashed using a hammer to release leaf sap, which could then be adsorbed to the filter paper. 4. The taped leaf tissue and the unblotted layer of filter paper were removed. The blotted filter paper was cut into pieces 4 cm 2, which were rolled into cylinders using toothpicks and transferred into a microfuge tube. 5. a. The rolled blots in the microfuge tubes were immersed in 0.7 ml of solution D (4 M guanidinium thiocyanate, 25 mm sodium citrate ph 7.0, 0.5% [w/v] N-lauroylsarcosine, 0.1 M 2-mercaptoethanol [Chomczynski and Sacchi 1987]) and kept at room temperature for 15 min with intermittent agitation to extract the nucleic acids. The solution was then transferred to a new microfuge tube, and an equal volume of chloroform added. Nucleic acids were precipitated with isopropyl alcohol, rinsed with 70% ethanol, and dissolved in TE buffer (10 mm Tris-HCl ph 8.0, 1 mm EDTA; Nippon Gene). During protocol optimization, we also tested the following two extraction methods: 5b. Rolled blots in microfuge tubes were immersed in 1 ml Sepasol-RNA I Super G (Nacalai Tesque) and kept at room temperature for 15 min with intermittent agitation.

2 The solution was then transferred to a new microfuge tube and an equal volume of chloroform added. After phase separation, the upper aqueous phase was extracted again with chloroform isoamyl alcohol (24:1), and the nucleic acid was processed as in part 5a. 5c. The rolled blots in microfuge tubes were immersed in 0.7 ml of proteinase K extraction solution (50 mm Tris-HCl ph 8.0, 5 mm EDTA, 0.15 M NaCl, 1% SDS, 1 mg/ml proteinase K). The solution was then transferred to a new microfuge tube, extracted with chloroform, and nucleic acid processed as in 5a. Construction of Apple latent spherical virus (ALSV) vector harboring Beet pseudoyellows virus (BPYV) p6 gene and infection of strawberry plants BPYV p6 gene encoded by ORF2 of BPYV RNA1 is specific to BPYV strawberry strain and was synthesized by Takara Bio (Ohtsu, Japan) according to the reported sequence (Tzanetakis and Martin 2004). The synthesized gene was introduced into pbical2 (Kawai et al. 2014). The recombinant ALSV-p6 was used to transform Agrobacterium tumefaciens GV3101. Transformants harboring RNA1 and RNA2 were grown at 28 C for 48 h on L-broth agar plates containing 50 µg/ml kanamycin, 20 µg/ml rifampicin, and 20 µg/ml gentamicin. These transformants were scraped off the agar plate and suspended in 1 ml infiltration buffer (10 mm K-MES, ph 5.5 containing 10 mm MgCl 2 ) containing 30 µg/ml acetosyringone. An equal volume of bacteria harboring RNA1 and RNA2 was mixed and used to inoculate the surface of strawberry leaves dusted with carborundum. RT-PCR amplification of cellular and viral RNAs The cdna was synthesized from the RNA using M-MuLV reverse transcriptase (New England BioLabs) using random hexamer primers. EF1α mrnas of Nicotiana sylvestris and strawberry (Fragaria ananassa cv. Hohkoh-wase), and PMMoV and recombinant ALSV genomic RNAs were detected by RT-PCR using primers described in the main text. EF1α mrnas of N. benthamiana and cucumber (Cucumis sativus L. cv. Hushinari) were detected by RT-PCR using primer sets NbEF1a-F and NbEF1a-R, and CucEF1a-36F andcucef1a-255r, respectively. Blend Taq DNA polymerase (Toyobo, Osaka, Japan) was used for all RT-PCRs. All primer sequences and PCR conditions are shown in supplementary Table S1.

3 Supplementary Table S1. PCR primers used in this study Primer name Sequence (5 3 ) PCR conditions ALSV-1355F GAAAATGCGAGGCACTCCTT 94 C, 2 min; 30 cycles of 94 C for ALSV-1643R CAAGAGTTCTCCCCCATAAG 20 s, 60 C for 20 s, and 72 C for 1 min; and 72 C for 3 min CucEF1a-36F GACATTGCCCTGTGGAAGTT CucEF1a-255R FaEF1a-F FaEF1a-R Nt-EF1A-F Nt-EF1A-R NbEF1a-F NbEF1a-R GCTTGACACCAAGGGTGAAA TGGATTTGAGGGTGACAACATGA GTATACATCCTGAAGTGGTAGACGGAGG AGACCACCAAGTACTACTGCACTG GGAAGAAACCTCCTTCACGA CTCCAAGGCTAGGTATGATG CTTCGTGGTTGCATCTCAAC 94 C, 2 min; 30 cycles of 94 C for 30 s, 56 C for 30 s, and 72 C for 1 min; and 72 C for 3 min PMF1 GTTATCGTACTCGCCACGGACG 94 C, 1 min; 25 cycles of 94 C for PMR1 GTTAGAATTGGGCAGAACTCGG 30 s, 60 C for 30 s, and 72 C for 1 min; and 72 C for 3 min

4 Supplementary Figure S1 a b c d e f g h i Fig. S1. Visual protocol for hammer-blot-mediated nucleic acid extraction. The petiole and midrib were removed, and the pieces of leaf blade were placed on filter paper (a), taped (b), covered with another sheet of filter paper to make a sandwich and inserted into a plastic folder (c). Leaf tissue was disrupted by a hammer to allow the crude sap to be adsorbed by the filter paper (d), plant debris was removed with tape (e and f), and the blot was cut into about 4-cm 2 pieces (g). The pieces of blot were rolled into cylinders using toothpicks (h) and inserted into a 1.5 ml microfuge tube (i). Thereafter, the extraction solution was added to immerse the blots and extract the nucleic acids.

5 Supplementary Figure S2 M bp 2000 bp 1000 bp 3 25s 18s 500 bp 100 bp Fig. S2. Agarose gel electrophoresis of nucleic acids extracted with proteinase K extraction solution. Total nucleic acids were extracted from hammer blots (HBs) of N. sylvestris leaf tissue using a proteinase K extraction solution described in Supplementary methods: Preparation of HBs and RNA extraction, part 5b. 25S and 18S indicate the position of ribosomal RNA. M, molecular mass standard Gene Ladder Wide 1 (Nippon Gene, Tokyo, Japan); some band sizes are on the left.

6 Supplementary Figure S3 a N. benthamiana (EF1 α) 1000 bp M bp 100 bp b Cucumber (EF1 α) Cotyledons Mature leaves M bp 500 bp 100 bp Fig. S3. RT-PCR detection of EF1α mrnas of N. benthamiana (a) and cucumber (b). Total nucleic acids were extracted using the hammer blot (HB) method and subjected to RT-PCR detection of EF1α mrna. In N. benthamiana, nucleic acids were extracted from eight independent HBs. In cucumber, HBs were prepared with three cotyledons and three mature true leaves (Mature leaves). A partial cdna sequence of EF1α was amplified from each of the nucleic acid preparations. Arrowhead indicates the position of the amplified fragments: 371 bp from N. benthamiana (a) and 219 bp from cucumber (b). M, molecular mass standard Gene Ladder 100 (Nippon Gene, Tokyo, Japan); some band sizes are on the left.

Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches

Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches Ali Mahmoudpour Department of Plant Pathology, University of California, Davis, CA, 95616, USA Current Address:

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Product Name : Simple mirna Detection Kit

Product Name : Simple mirna Detection Kit Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components

More information

II First Strand cdna Synthesis Kit

II First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

Sensitivity vs Specificity

Sensitivity vs Specificity Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Note: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology

Note: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology Note: for laboratory research use only RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Cat. #: RP1202 (50preps) Signalway Biotechnology I. Kit Content, Storage Condition and Stability Content

More information

AMV First Strand cdna Synthesis Kit

AMV First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered

More information

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2. DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is

More information

Low cost and non-toxic genomic DNA extraction for use in molecular marker studies.

Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Version 1.4, February 28 th, 2013. Prepared by Bernhard Hofinger, Owen Huynh and Brad Till. 1. OBJECTIVE To develop and

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

ReverTra Ace qpcr RT Master Mix

ReverTra Ace qpcr RT Master Mix Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template

More information

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT

More information

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications

More information

Extraction of Nucleic Acids

Extraction of Nucleic Acids Maj Gen (R) Suhaib Ahmed, HI (M) DNA Extraction The first step in DNA analysis is to get a good quality sample; a process commonly known as extraction. Since DNA is a very long molecule it can easily get

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

EZ-DNA. Instructions for Use. Genomic DNA Isolation Reagent. Product Description. Kit Reagent. Reagent Required But Not Supplied.

EZ-DNA. Instructions for Use. Genomic DNA Isolation Reagent. Product Description. Kit Reagent. Reagent Required But Not Supplied. EZ-DNA Genomic DNA Isolation Reagent Cat. No.: 20-600-50 Store at: Room Temperature Instructions for Use Protocol for Genomic DNA Isolation Tissue Specific Recommendations for the Use of EZ-DNA Assessing

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

Geneaid DNA Isolation Kit (Yeast)

Geneaid DNA Isolation Kit (Yeast) Geneaid DNA Isolation Kit (Yeast) GEY100, GEY300 Advantages Sample: up to 2 10 8 yeast and other fungus species Yield: high yield, high quality DNA (A260/A280 = 1.8-2.0) Format: scalable DNA precipitation

More information

Positively Charged Membrane

Positively Charged Membrane BIOBOND NYLON MEMBRANES ProductInformation Technical Bulletin No. MB-570 June 1999 Size Quantity Positively Charged Membrane Neutral Membrane 30 cm x 3.5 m 1 roll N4781 N1031 30 cm x 12 m 1 roll N4906

More information

PROTOCOL 1: EXTRACTION OF DNA FROM BACTERIA

PROTOCOL 1: EXTRACTION OF DNA FROM BACTERIA PROTOCOL 1: EXTRACTION OF DNA FROM BACTERIA The basic standard procedures for isolation of bacterial DNA are based on lysozyme digestion of the cell wall, detergent lysis, disruption of protein-nucleic

More information

DIAGNOSTICS MOLECULAR BIOLOGY

DIAGNOSTICS MOLECULAR BIOLOGY 1 DIAGNOSTICS MOLECULAR BIOLOGY MLSC 4050 Professor Labiner Module 1 Lecture 4: Nucleic Acid Extraction Nucleic Acid Extraction: Objectives 2 Students will be able to: 1. List the types of specimens that

More information

Taura Syndrome Virus (TSV) RT-PCR Kit

Taura Syndrome Virus (TSV) RT-PCR Kit Revision No.: ZJ0001 Issue Date: Aug 28th, 2007 Taura Syndrome Virus (TSV) RT-PCR Kit Cat. No.: AR-0200-03 For use with Conventional PCR Instrument or Real time PCR Instrument User Manual For in vitro

More information

TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0

TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Cat. # 9766 For Research Use TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage and shipping... 3 IV. Preparation

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

ChIP-chip protocol adapted for the mod-encode project

ChIP-chip protocol adapted for the mod-encode project ChIP-chip protocol adapted for the mod-encode project Version 1.2 : August 2007 Nicolas Nègre, Xiaochun Ni, Sergey Lavrov, Giacomo Cavalli and Kevin P. White University of Chicago, Department of Human

More information

FMF NIRCA PROTOCOL STEP 1.

FMF NIRCA PROTOCOL STEP 1. FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are

More information

Pinpoint Slide DNA Isolation System Catalog No. D3001

Pinpoint Slide DNA Isolation System Catalog No. D3001 INSTRUCTIONS Pinpoint Slide DNA Isolation System Catalog No. D3001 Highlights Easily isolates genomic DNA in any targeted microscopic tissue area on a slide. The simple procedure combines Pinpoint tissue

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O

RP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O www.smobio.com Product Information Reverse Transcription Kit II RP1400 100 RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O ExcelRT series 100 μl 500 μl 100

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

MightyAmp DNA Polymerase Ver.3

MightyAmp DNA Polymerase Ver.3 Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...

More information

The Production of a Recombinant Biotechnology Product. Chapter 8

The Production of a Recombinant Biotechnology Product. Chapter 8 The Production of a Recombinant Biotechnology Product Chapter 8 Objectives Give a basic overview of genetic engineering. Describe the processes involved in isolating a piece DNA of interest Mass producing

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70 GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously

More information

BIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205

BIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

E.Z.N.A. Tissue RNA Kit. R preps R preps

E.Z.N.A. Tissue RNA Kit. R preps R preps E.Z.N.A. Tissue RNA Kit R6688-00 5 preps R6688-01 50 preps May 2015 E.Z.N.A. Tissue RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Important Notes...4 Homogenization

More information

Molecular Techniques Third-year Biology

Molecular Techniques Third-year Biology PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed

More information

Protoscript II RT-PCR Kit. I n s t r u c t i o n M a n u a l NEW ENGLAND. BioLabs. Version 1.2 3/07. Catalog #E6400S Store at 20 C. Inc.

Protoscript II RT-PCR Kit. I n s t r u c t i o n M a n u a l NEW ENGLAND. BioLabs. Version 1.2 3/07. Catalog #E6400S Store at 20 C. Inc. Protoscript II RT-PCR Kit I n s t r u c t i o n M a n u a l Catalog #E6400S Store at 20 C NEW ENGLAND BioLabs Inc. Version 1.2 3/07 Table of Contents: Supplied Components.................................................................................

More information

small RNA Cloning Kit

small RNA Cloning Kit Cat. # RR065 For Research Use small RNA Cloning Kit Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage... 6 V. Precautions

More information

Cloning Small RNAs for Sequencing with 454 Technology

Cloning Small RNAs for Sequencing with 454 Technology Cloning Small RNAs for Sequencing with 454 Technology Protocol provided by Dr. Greg Hannon, Cold Spring Harbor Laboratory 1. RNA preparation 1. Total RNA is isolated from tissue or cells with TRIZOL followed

More information

The following general information is from: "Biochemical Techniques Theory and Practice" by J.F. Robyt and B.J. White, Waveland Press Inc., 1987.

The following general information is from: Biochemical Techniques Theory and Practice by J.F. Robyt and B.J. White, Waveland Press Inc., 1987. Biochemistry Laboratory DNA I (REVISED 4/02 KRD) Purpose: Isolation of DNA from Gambusia liver. The following general information is from: "Biochemical Techniques Theory and Practice" by J.F. Robyt and

More information

GenUP Virus DNA/RNA Kit

GenUP Virus DNA/RNA Kit Product Insert GenUP Virus DNA/RNA Kit LOT: See product label EXPIRY DATE: See product label ORDERING INFORMATION PRODUCT GenUP Virus DNA/RNA Kit CAT. NO. BR0701101 BR0701102 BR0701103 SIZE 10 preps 50

More information

HiPer Gel Extraction Teaching Kit (Column Based)

HiPer Gel Extraction Teaching Kit (Column Based) HiPer Gel Extraction Teaching Kit (Column Based) Product Code: HTBM010 Number of experiments that can be performed: 10 Duration of Experiment Agarose Gel Electrophoresis: 1 hour Protocol: 1 hour Agarose

More information

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used

More information

PrimeScript RT reagent Kit (Perfect Real Time)

PrimeScript RT reagent Kit (Perfect Real Time) Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...

More information

Section IX: Special Applications in Agarose Gels

Section IX: Special Applications in Agarose Gels Section IX: In This Section Amplification of Plasmid cdna Libraries with SeaPrep Agarose 150 Preparing Agarose for use in Cell Culture Applications 152 References 154 149 Section IX: Amplification of Plasmid

More information

mirna Cloning Kit High Efficient

mirna Cloning Kit High Efficient DynaExpress mirna Cloning Kit High Efficient DynaExpress Product Name : mirna Cloning Kit High Efficient Code No. : DS330 Table of Contents Background - - - - - - - - - - - - - - - - - - - - - - - - -

More information

PowerMax Soil DNA Isolation Kit

PowerMax Soil DNA Isolation Kit PowerMax Soil DNA Isolation Kit Catalog No. Quantity 12988-10 10 Preps Instruction Manual Inhibitor Removal Technology (IRT) is a registered trademark of MO BIO Laboratories, Inc. and is covered by the

More information

Urine DNA Isolation 96-Well Kit (Slurry Format) Product # 27100

Urine DNA Isolation 96-Well Kit (Slurry Format) Product # 27100 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Urine DNA Isolation 96-Well Kit (Slurry Format) Product # 27100

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010.

DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. Technical Bulletin DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. PRINTED IN USA. Revised 12/12 DNA 5 End-Labeling System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

PCR Laboratory Exercise

PCR Laboratory Exercise PCR Laboratory Exercise Advance Protocol (updated 1/2018) Introduction Detection of TPA-25 Alu by PCR A Human DNA Fingerprinting Lab Protocol 1994 Cold Spring Harbor Laboratory DNA Learning Center In this

More information

TaKaRa PCR Amplification Kit

TaKaRa PCR Amplification Kit Cat. # R011 For Research Use TaKaRa PCR Amplification Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 4 IV. Materials Required but not Provided... 4 V. Principle...

More information

EXPERIMENT GENOMIC DNA ANALYSIS

EXPERIMENT GENOMIC DNA ANALYSIS EXPERIMENT GENOMIC DNA ANALYSIS Population diversity Studies We have 5 species of planarians (3 purchased from Carolina Biologicals, 2 obtained from the Levin lab) andmight have additional species found

More information

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:

More information

FosmidMAX DNA Purification Kit

FosmidMAX DNA Purification Kit Cat. No. FMAX046 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 204 10/2012 1 EPILIT204 Rev. A

More information

DNA Extraction DNA Extraction (small scale) using CTAB method

DNA Extraction DNA Extraction (small scale) using CTAB method DNA Extraction DNA Extraction (small scale) using CTAB method This method is relatively simple, and has been used successfully with a wide range of monocot and dicot species. The method may be used with

More information

PrimeScript 1st strand cdna Synthesis Kit

PrimeScript 1st strand cdna Synthesis Kit Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

MasterPure Plant RNA Purification Kit

MasterPure Plant RNA Purification Kit MasterPure Plant RNA Purification Kit Cat. Nos. MPR09010 and MPR09100 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com

More information

PowerMag Air & Water DNA/RNA Isolation Kit

PowerMag Air & Water DNA/RNA Isolation Kit Saving You Time For Life PowerMag Air & Water DNA/RNA Isolation Kit (Optimized for epmotion ) Catalog No. 27800-4-EP Quantity: 4 x 96 Preps Total Purifications: 384 Instruction Manual Version 09102014

More information

First Strand cdna Synthesis Kit (#K1611 for 10 reactions)

First Strand cdna Synthesis Kit (#K1611 for 10 reactions) 3 First Strand cdna Synthesis Kit (#K1611 for 10 reactions) Kit is designed for preparation of full-length fi rst strand cdna from RNA templates. The fi rst strand cdna synthesis kit relies on a cloned

More information

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus

More information

E.Z.N.A. Total RNA Kit II. R preps R preps R preps

E.Z.N.A. Total RNA Kit II. R preps R preps R preps E.Z.N.A. Total RNA Kit II R6934-00 5 preps R6934-01 50 preps R6934-02 200 preps September 2015 E.Z.N.A. Total RNA Kit II Table of Contents Introduction...2 Illustrated Protocol...3 Kit Contents/Storage

More information

Alkaline Lysis Large Scale Plasmid Preparation

Alkaline Lysis Large Scale Plasmid Preparation Alkaline Lysis Large Scale Plasmid Preparation 1. Set up 10 ml overnight culture. 2. Add overnight to 500 mls of sterile LB with appropriate selective agent (e.g amp, tet...) 3. Incubate at 37 C with shaking

More information

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous

More information

PRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda

More information

TECHNICAL SHEET No. 21. Virus Detection: Potato virus Y (PVY)

TECHNICAL SHEET No. 21. Virus Detection: Potato virus Y (PVY) TECHNICAL SHEET No. 21 Virus Detection: Potato virus Y (PVY) Method: Immunocapture RT-PCR, RFLP Immunocapture RT-PCR General Virus detected: PVY from potato General method: IC-RT-PCR, RFLP-IC-RT-PCR Developed

More information

DNA Extraction from Bacterial Communities Freeze-Grind Method

DNA Extraction from Bacterial Communities Freeze-Grind Method DNA Extraction from Bacterial Communities Freeze-Grind Method There are now three protocols available for DNA extraction from soils and sediments: Freeze-Grind, MoBio PowerSoil kit, and Modified MoBio

More information

Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene

Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene Aalborg Universitet Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene Publication date: 2009 Document Version Publisher's PDF, also

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Table of contents. I. Flowchart of blunt end cloning of PCR products...2. II. Description...3. III. Kit Components...3

Table of contents. I. Flowchart of blunt end cloning of PCR products...2. II. Description...3. III. Kit Components...3 Table of contents I. Flowchart of blunt end cloning of PCR products...2 II. Description...3 III. Kit Components...3 IV. Reagents and Instruments Required...3 V. Storage...3 VI. About puc118 Hinc II/BAP...4

More information

The preparation of native chromatin from cultured human cells.

The preparation of native chromatin from cultured human cells. Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the

More information

Presto Mini gdna Bacteria Kit

Presto Mini gdna Bacteria Kit Instruction Manual Ver. 02.10.17 For Research Use Only Presto Mini gdna Bacteria Kit Advantages GBB004 (4 Preparation Sample Kit) GBB100/101 (100 Preparation Kit) GBB300/301 (300 Preparation Kit) Sample:

More information

AdnaTest ProstateCancerDetect

AdnaTest ProstateCancerDetect AdnaTest ProstateCancerDetect RT-PCR Kit for detection of prostate cancer associated gene expression in enriched tumor cells For diagnostic use Manual T-1-521 Contents Order Information... 3 Purpose...

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Unzipping Genes. MB566 RDP Trio TM Reagent. Product Code MB ml (100 ml RDP Trio TM Reagent) MB566-5 X 100 ml (5X100 ml RDP Trio TM Reagent)

Unzipping Genes. MB566 RDP Trio TM Reagent. Product Code MB ml (100 ml RDP Trio TM Reagent) MB566-5 X 100 ml (5X100 ml RDP Trio TM Reagent) Unzipping Genes MB566 RDP Trio TM Reagent P r o d u c t I n f o r m a t i o n Product Code MB566-100 ml (100 ml RDP Trio TM Reagent) MB566-5 X 100 ml (5X100 ml RDP Trio TM Reagent) Storage Conditions Store

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off

More information

RNA Purification Kits

RNA Purification Kits GMbiolab Co., Ltd. RNA Purification Kits column format and easy to use High yield and high purity Product Info Speedy operation procedure Product Cat. No. Sample RNA Recovery Format Time Total RNA Purification

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the

More information

MOK. Media Optimization Kit

MOK. Media Optimization Kit MOK Media Optimization Kit The Media Optimization Kit determines the best medium formulation for maximizing accumulation of recombinant proteins expressed in E. coli, utilizing a series of Athena s superior

More information

TIANamp Yeast DNA Kit

TIANamp Yeast DNA Kit TIANamp Yeast DNA Kit For isolation of genomic DNA from yeast cells www.tiangen.com/en DP121221 TIANamp Yeast DNA Kit Kit Contents (Spin Column) Cat. no. DP307 Contents Buffer GA Buffer GB Buffer GD Buffer

More information

Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008

Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008 Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008 INTRODUCTION DNA Plasmids. A plasmid is a small double-stranded, circular DNA molecule

More information

NEBNext Magnesium RNA Fragmentation Module

NEBNext Magnesium RNA Fragmentation Module SAMPLE PREPARATION NEBNext Magnesium RNA Fragmentation Module Instruction Manual NEB #E6150S 200 reactions NEBNext Magnesium RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007) QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.

More information

Department of Biochemistry and Molecular Biophysics, Columbia University, New York, USA

Department of Biochemistry and Molecular Biophysics, Columbia University, New York, USA RNA Chromatin Immunoprecipitation (RNA-ChIP) in Caenorhabditis elegans Germano Cecere * and Alla Grishok Department of Biochemistry and Molecular Biophysics, Columbia University, New York, USA * For correspondence:

More information