Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection
|
|
- Primrose Montgomery
- 6 years ago
- Views:
Transcription
1 Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection Md. Shamim Akhter et al. Online Supplementary Materials Supplementary methods Preparation of hammer blots (HBs) and RNA extraction Healthy and virus-inoculated plant leaves were harvested to prepare HBs, from which nucleic acids were extracted. The proposed procedure is as follows (see also supplementary Figure S1). 1. Petiole and midrib were excised, and the leaf tissue was taped on either side for single-sided blotting. Vinyl chloride tape made for electric insulation (Vinyl tape 74, 3M) worked well in our hands. 2. The taped leaf tissue was sandwiched between two layers of filter paper (Whatman 3MM) and placed into a plastic folder. Alternatively, the assembled leaf tissue and filter papers were wrapped with a wrapping film. 3. The leaf tissue was smashed using a hammer to release leaf sap, which could then be adsorbed to the filter paper. 4. The taped leaf tissue and the unblotted layer of filter paper were removed. The blotted filter paper was cut into pieces 4 cm 2, which were rolled into cylinders using toothpicks and transferred into a microfuge tube. 5. a. The rolled blots in the microfuge tubes were immersed in 0.7 ml of solution D (4 M guanidinium thiocyanate, 25 mm sodium citrate ph 7.0, 0.5% [w/v] N-lauroylsarcosine, 0.1 M 2-mercaptoethanol [Chomczynski and Sacchi 1987]) and kept at room temperature for 15 min with intermittent agitation to extract the nucleic acids. The solution was then transferred to a new microfuge tube, and an equal volume of chloroform added. Nucleic acids were precipitated with isopropyl alcohol, rinsed with 70% ethanol, and dissolved in TE buffer (10 mm Tris-HCl ph 8.0, 1 mm EDTA; Nippon Gene). During protocol optimization, we also tested the following two extraction methods: 5b. Rolled blots in microfuge tubes were immersed in 1 ml Sepasol-RNA I Super G (Nacalai Tesque) and kept at room temperature for 15 min with intermittent agitation.
2 The solution was then transferred to a new microfuge tube and an equal volume of chloroform added. After phase separation, the upper aqueous phase was extracted again with chloroform isoamyl alcohol (24:1), and the nucleic acid was processed as in part 5a. 5c. The rolled blots in microfuge tubes were immersed in 0.7 ml of proteinase K extraction solution (50 mm Tris-HCl ph 8.0, 5 mm EDTA, 0.15 M NaCl, 1% SDS, 1 mg/ml proteinase K). The solution was then transferred to a new microfuge tube, extracted with chloroform, and nucleic acid processed as in 5a. Construction of Apple latent spherical virus (ALSV) vector harboring Beet pseudoyellows virus (BPYV) p6 gene and infection of strawberry plants BPYV p6 gene encoded by ORF2 of BPYV RNA1 is specific to BPYV strawberry strain and was synthesized by Takara Bio (Ohtsu, Japan) according to the reported sequence (Tzanetakis and Martin 2004). The synthesized gene was introduced into pbical2 (Kawai et al. 2014). The recombinant ALSV-p6 was used to transform Agrobacterium tumefaciens GV3101. Transformants harboring RNA1 and RNA2 were grown at 28 C for 48 h on L-broth agar plates containing 50 µg/ml kanamycin, 20 µg/ml rifampicin, and 20 µg/ml gentamicin. These transformants were scraped off the agar plate and suspended in 1 ml infiltration buffer (10 mm K-MES, ph 5.5 containing 10 mm MgCl 2 ) containing 30 µg/ml acetosyringone. An equal volume of bacteria harboring RNA1 and RNA2 was mixed and used to inoculate the surface of strawberry leaves dusted with carborundum. RT-PCR amplification of cellular and viral RNAs The cdna was synthesized from the RNA using M-MuLV reverse transcriptase (New England BioLabs) using random hexamer primers. EF1α mrnas of Nicotiana sylvestris and strawberry (Fragaria ananassa cv. Hohkoh-wase), and PMMoV and recombinant ALSV genomic RNAs were detected by RT-PCR using primers described in the main text. EF1α mrnas of N. benthamiana and cucumber (Cucumis sativus L. cv. Hushinari) were detected by RT-PCR using primer sets NbEF1a-F and NbEF1a-R, and CucEF1a-36F andcucef1a-255r, respectively. Blend Taq DNA polymerase (Toyobo, Osaka, Japan) was used for all RT-PCRs. All primer sequences and PCR conditions are shown in supplementary Table S1.
3 Supplementary Table S1. PCR primers used in this study Primer name Sequence (5 3 ) PCR conditions ALSV-1355F GAAAATGCGAGGCACTCCTT 94 C, 2 min; 30 cycles of 94 C for ALSV-1643R CAAGAGTTCTCCCCCATAAG 20 s, 60 C for 20 s, and 72 C for 1 min; and 72 C for 3 min CucEF1a-36F GACATTGCCCTGTGGAAGTT CucEF1a-255R FaEF1a-F FaEF1a-R Nt-EF1A-F Nt-EF1A-R NbEF1a-F NbEF1a-R GCTTGACACCAAGGGTGAAA TGGATTTGAGGGTGACAACATGA GTATACATCCTGAAGTGGTAGACGGAGG AGACCACCAAGTACTACTGCACTG GGAAGAAACCTCCTTCACGA CTCCAAGGCTAGGTATGATG CTTCGTGGTTGCATCTCAAC 94 C, 2 min; 30 cycles of 94 C for 30 s, 56 C for 30 s, and 72 C for 1 min; and 72 C for 3 min PMF1 GTTATCGTACTCGCCACGGACG 94 C, 1 min; 25 cycles of 94 C for PMR1 GTTAGAATTGGGCAGAACTCGG 30 s, 60 C for 30 s, and 72 C for 1 min; and 72 C for 3 min
4 Supplementary Figure S1 a b c d e f g h i Fig. S1. Visual protocol for hammer-blot-mediated nucleic acid extraction. The petiole and midrib were removed, and the pieces of leaf blade were placed on filter paper (a), taped (b), covered with another sheet of filter paper to make a sandwich and inserted into a plastic folder (c). Leaf tissue was disrupted by a hammer to allow the crude sap to be adsorbed by the filter paper (d), plant debris was removed with tape (e and f), and the blot was cut into about 4-cm 2 pieces (g). The pieces of blot were rolled into cylinders using toothpicks (h) and inserted into a 1.5 ml microfuge tube (i). Thereafter, the extraction solution was added to immerse the blots and extract the nucleic acids.
5 Supplementary Figure S2 M bp 2000 bp 1000 bp 3 25s 18s 500 bp 100 bp Fig. S2. Agarose gel electrophoresis of nucleic acids extracted with proteinase K extraction solution. Total nucleic acids were extracted from hammer blots (HBs) of N. sylvestris leaf tissue using a proteinase K extraction solution described in Supplementary methods: Preparation of HBs and RNA extraction, part 5b. 25S and 18S indicate the position of ribosomal RNA. M, molecular mass standard Gene Ladder Wide 1 (Nippon Gene, Tokyo, Japan); some band sizes are on the left.
6 Supplementary Figure S3 a N. benthamiana (EF1 α) 1000 bp M bp 100 bp b Cucumber (EF1 α) Cotyledons Mature leaves M bp 500 bp 100 bp Fig. S3. RT-PCR detection of EF1α mrnas of N. benthamiana (a) and cucumber (b). Total nucleic acids were extracted using the hammer blot (HB) method and subjected to RT-PCR detection of EF1α mrna. In N. benthamiana, nucleic acids were extracted from eight independent HBs. In cucumber, HBs were prepared with three cotyledons and three mature true leaves (Mature leaves). A partial cdna sequence of EF1α was amplified from each of the nucleic acid preparations. Arrowhead indicates the position of the amplified fragments: 371 bp from N. benthamiana (a) and 219 bp from cucumber (b). M, molecular mass standard Gene Ladder 100 (Nippon Gene, Tokyo, Japan); some band sizes are on the left.
Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches
Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches Ali Mahmoudpour Department of Plant Pathology, University of California, Davis, CA, 95616, USA Current Address:
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationII First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationSensitivity vs Specificity
Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationNote: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology
Note: for laboratory research use only RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Cat. #: RP1202 (50preps) Signalway Biotechnology I. Kit Content, Storage Condition and Stability Content
More informationAMV First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered
More informationProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.
DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationGateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
More informationLow cost and non-toxic genomic DNA extraction for use in molecular marker studies.
Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Version 1.4, February 28 th, 2013. Prepared by Bernhard Hofinger, Owen Huynh and Brad Till. 1. OBJECTIVE To develop and
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
More informationReverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months
www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT
More informationEZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK
EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications
More informationExtraction of Nucleic Acids
Maj Gen (R) Suhaib Ahmed, HI (M) DNA Extraction The first step in DNA analysis is to get a good quality sample; a process commonly known as extraction. Since DNA is a very long molecule it can easily get
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationLecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationEZ-DNA. Instructions for Use. Genomic DNA Isolation Reagent. Product Description. Kit Reagent. Reagent Required But Not Supplied.
EZ-DNA Genomic DNA Isolation Reagent Cat. No.: 20-600-50 Store at: Room Temperature Instructions for Use Protocol for Genomic DNA Isolation Tissue Specific Recommendations for the Use of EZ-DNA Assessing
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationGeneaid DNA Isolation Kit (Yeast)
Geneaid DNA Isolation Kit (Yeast) GEY100, GEY300 Advantages Sample: up to 2 10 8 yeast and other fungus species Yield: high yield, high quality DNA (A260/A280 = 1.8-2.0) Format: scalable DNA precipitation
More informationPositively Charged Membrane
BIOBOND NYLON MEMBRANES ProductInformation Technical Bulletin No. MB-570 June 1999 Size Quantity Positively Charged Membrane Neutral Membrane 30 cm x 3.5 m 1 roll N4781 N1031 30 cm x 12 m 1 roll N4906
More informationPROTOCOL 1: EXTRACTION OF DNA FROM BACTERIA
PROTOCOL 1: EXTRACTION OF DNA FROM BACTERIA The basic standard procedures for isolation of bacterial DNA are based on lysozyme digestion of the cell wall, detergent lysis, disruption of protein-nucleic
More informationDIAGNOSTICS MOLECULAR BIOLOGY
1 DIAGNOSTICS MOLECULAR BIOLOGY MLSC 4050 Professor Labiner Module 1 Lecture 4: Nucleic Acid Extraction Nucleic Acid Extraction: Objectives 2 Students will be able to: 1. List the types of specimens that
More informationTaura Syndrome Virus (TSV) RT-PCR Kit
Revision No.: ZJ0001 Issue Date: Aug 28th, 2007 Taura Syndrome Virus (TSV) RT-PCR Kit Cat. No.: AR-0200-03 For use with Conventional PCR Instrument or Real time PCR Instrument User Manual For in vitro
More informationTaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0
Cat. # 9766 For Research Use TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage and shipping... 3 IV. Preparation
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationChIP-chip protocol adapted for the mod-encode project
ChIP-chip protocol adapted for the mod-encode project Version 1.2 : August 2007 Nicolas Nègre, Xiaochun Ni, Sergey Lavrov, Giacomo Cavalli and Kevin P. White University of Chicago, Department of Human
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More informationPinpoint Slide DNA Isolation System Catalog No. D3001
INSTRUCTIONS Pinpoint Slide DNA Isolation System Catalog No. D3001 Highlights Easily isolates genomic DNA in any targeted microscopic tissue area on a slide. The simple procedure combines Pinpoint tissue
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationRP RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O
www.smobio.com Product Information Reverse Transcription Kit II RP1400 100 RXN RTase/RI Enzyme Mix 5X RT Buffer (DTT/dNTPs) Oligo (dt)/random Primer Mix DEPC-Treated H2O ExcelRT series 100 μl 500 μl 100
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationMightyAmp DNA Polymerase Ver.3
Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...
More informationThe Production of a Recombinant Biotechnology Product. Chapter 8
The Production of a Recombinant Biotechnology Product Chapter 8 Objectives Give a basic overview of genetic engineering. Describe the processes involved in isolating a piece DNA of interest Mass producing
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationTECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70
GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously
More informationBIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205
BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationE.Z.N.A. Tissue RNA Kit. R preps R preps
E.Z.N.A. Tissue RNA Kit R6688-00 5 preps R6688-01 50 preps May 2015 E.Z.N.A. Tissue RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Important Notes...4 Homogenization
More informationMolecular Techniques Third-year Biology
PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed
More informationProtoscript II RT-PCR Kit. I n s t r u c t i o n M a n u a l NEW ENGLAND. BioLabs. Version 1.2 3/07. Catalog #E6400S Store at 20 C. Inc.
Protoscript II RT-PCR Kit I n s t r u c t i o n M a n u a l Catalog #E6400S Store at 20 C NEW ENGLAND BioLabs Inc. Version 1.2 3/07 Table of Contents: Supplied Components.................................................................................
More informationsmall RNA Cloning Kit
Cat. # RR065 For Research Use small RNA Cloning Kit Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage... 6 V. Precautions
More informationCloning Small RNAs for Sequencing with 454 Technology
Cloning Small RNAs for Sequencing with 454 Technology Protocol provided by Dr. Greg Hannon, Cold Spring Harbor Laboratory 1. RNA preparation 1. Total RNA is isolated from tissue or cells with TRIZOL followed
More informationThe following general information is from: "Biochemical Techniques Theory and Practice" by J.F. Robyt and B.J. White, Waveland Press Inc., 1987.
Biochemistry Laboratory DNA I (REVISED 4/02 KRD) Purpose: Isolation of DNA from Gambusia liver. The following general information is from: "Biochemical Techniques Theory and Practice" by J.F. Robyt and
More informationGenUP Virus DNA/RNA Kit
Product Insert GenUP Virus DNA/RNA Kit LOT: See product label EXPIRY DATE: See product label ORDERING INFORMATION PRODUCT GenUP Virus DNA/RNA Kit CAT. NO. BR0701101 BR0701102 BR0701103 SIZE 10 preps 50
More informationHiPer Gel Extraction Teaching Kit (Column Based)
HiPer Gel Extraction Teaching Kit (Column Based) Product Code: HTBM010 Number of experiments that can be performed: 10 Duration of Experiment Agarose Gel Electrophoresis: 1 hour Protocol: 1 hour Agarose
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More informationPrimeScript RT reagent Kit (Perfect Real Time)
Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...
More informationSection IX: Special Applications in Agarose Gels
Section IX: In This Section Amplification of Plasmid cdna Libraries with SeaPrep Agarose 150 Preparing Agarose for use in Cell Culture Applications 152 References 154 149 Section IX: Amplification of Plasmid
More informationmirna Cloning Kit High Efficient
DynaExpress mirna Cloning Kit High Efficient DynaExpress Product Name : mirna Cloning Kit High Efficient Code No. : DS330 Table of Contents Background - - - - - - - - - - - - - - - - - - - - - - - - -
More informationPowerMax Soil DNA Isolation Kit
PowerMax Soil DNA Isolation Kit Catalog No. Quantity 12988-10 10 Preps Instruction Manual Inhibitor Removal Technology (IRT) is a registered trademark of MO BIO Laboratories, Inc. and is covered by the
More informationUrine DNA Isolation 96-Well Kit (Slurry Format) Product # 27100
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Urine DNA Isolation 96-Well Kit (Slurry Format) Product # 27100
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationDNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010.
Technical Bulletin DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. PRINTED IN USA. Revised 12/12 DNA 5 End-Labeling System All technical literature is available on the Internet at: www.promega.com/protocols/
More informationPCR Laboratory Exercise
PCR Laboratory Exercise Advance Protocol (updated 1/2018) Introduction Detection of TPA-25 Alu by PCR A Human DNA Fingerprinting Lab Protocol 1994 Cold Spring Harbor Laboratory DNA Learning Center In this
More informationTaKaRa PCR Amplification Kit
Cat. # R011 For Research Use TaKaRa PCR Amplification Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 4 IV. Materials Required but not Provided... 4 V. Principle...
More informationEXPERIMENT GENOMIC DNA ANALYSIS
EXPERIMENT GENOMIC DNA ANALYSIS Population diversity Studies We have 5 species of planarians (3 purchased from Carolina Biologicals, 2 obtained from the Levin lab) andmight have additional species found
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationFosmidMAX DNA Purification Kit
Cat. No. FMAX046 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 204 10/2012 1 EPILIT204 Rev. A
More informationDNA Extraction DNA Extraction (small scale) using CTAB method
DNA Extraction DNA Extraction (small scale) using CTAB method This method is relatively simple, and has been used successfully with a wide range of monocot and dicot species. The method may be used with
More informationPrimeScript 1st strand cdna Synthesis Kit
Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...
More informationGuide-it Indel Identification Kit User Manual
Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationMasterPure Plant RNA Purification Kit
MasterPure Plant RNA Purification Kit Cat. Nos. MPR09010 and MPR09100 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com
More informationPowerMag Air & Water DNA/RNA Isolation Kit
Saving You Time For Life PowerMag Air & Water DNA/RNA Isolation Kit (Optimized for epmotion ) Catalog No. 27800-4-EP Quantity: 4 x 96 Preps Total Purifications: 384 Instruction Manual Version 09102014
More informationFirst Strand cdna Synthesis Kit (#K1611 for 10 reactions)
3 First Strand cdna Synthesis Kit (#K1611 for 10 reactions) Kit is designed for preparation of full-length fi rst strand cdna from RNA templates. The fi rst strand cdna synthesis kit relies on a cloned
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationE.Z.N.A. Total RNA Kit II. R preps R preps R preps
E.Z.N.A. Total RNA Kit II R6934-00 5 preps R6934-01 50 preps R6934-02 200 preps September 2015 E.Z.N.A. Total RNA Kit II Table of Contents Introduction...2 Illustrated Protocol...3 Kit Contents/Storage
More informationAlkaline Lysis Large Scale Plasmid Preparation
Alkaline Lysis Large Scale Plasmid Preparation 1. Set up 10 ml overnight culture. 2. Add overnight to 500 mls of sterile LB with appropriate selective agent (e.g amp, tet...) 3. Incubate at 37 C with shaking
More informationMOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien
Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous
More informationPRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda
More informationTECHNICAL SHEET No. 21. Virus Detection: Potato virus Y (PVY)
TECHNICAL SHEET No. 21 Virus Detection: Potato virus Y (PVY) Method: Immunocapture RT-PCR, RFLP Immunocapture RT-PCR General Virus detected: PVY from potato General method: IC-RT-PCR, RFLP-IC-RT-PCR Developed
More informationDNA Extraction from Bacterial Communities Freeze-Grind Method
DNA Extraction from Bacterial Communities Freeze-Grind Method There are now three protocols available for DNA extraction from soils and sediments: Freeze-Grind, MoBio PowerSoil kit, and Modified MoBio
More informationTransport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene
Aalborg Universitet Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene Publication date: 2009 Document Version Publisher's PDF, also
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationTable of contents. I. Flowchart of blunt end cloning of PCR products...2. II. Description...3. III. Kit Components...3
Table of contents I. Flowchart of blunt end cloning of PCR products...2 II. Description...3 III. Kit Components...3 IV. Reagents and Instruments Required...3 V. Storage...3 VI. About puc118 Hinc II/BAP...4
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More informationPresto Mini gdna Bacteria Kit
Instruction Manual Ver. 02.10.17 For Research Use Only Presto Mini gdna Bacteria Kit Advantages GBB004 (4 Preparation Sample Kit) GBB100/101 (100 Preparation Kit) GBB300/301 (300 Preparation Kit) Sample:
More informationAdnaTest ProstateCancerDetect
AdnaTest ProstateCancerDetect RT-PCR Kit for detection of prostate cancer associated gene expression in enriched tumor cells For diagnostic use Manual T-1-521 Contents Order Information... 3 Purpose...
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationUnzipping Genes. MB566 RDP Trio TM Reagent. Product Code MB ml (100 ml RDP Trio TM Reagent) MB566-5 X 100 ml (5X100 ml RDP Trio TM Reagent)
Unzipping Genes MB566 RDP Trio TM Reagent P r o d u c t I n f o r m a t i o n Product Code MB566-100 ml (100 ml RDP Trio TM Reagent) MB566-5 X 100 ml (5X100 ml RDP Trio TM Reagent) Storage Conditions Store
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off
More informationRNA Purification Kits
GMbiolab Co., Ltd. RNA Purification Kits column format and easy to use High yield and high purity Product Info Speedy operation procedure Product Cat. No. Sample RNA Recovery Format Time Total RNA Purification
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the
More informationMOK. Media Optimization Kit
MOK Media Optimization Kit The Media Optimization Kit determines the best medium formulation for maximizing accumulation of recombinant proteins expressed in E. coli, utilizing a series of Athena s superior
More informationTIANamp Yeast DNA Kit
TIANamp Yeast DNA Kit For isolation of genomic DNA from yeast cells www.tiangen.com/en DP121221 TIANamp Yeast DNA Kit Kit Contents (Spin Column) Cat. no. DP307 Contents Buffer GA Buffer GB Buffer GD Buffer
More informationPurification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008
Purification and Characterization of a DNA Plasmid Part A CHEM 4581: Biochemistry Laboratory I Version: January 18, 2008 INTRODUCTION DNA Plasmids. A plasmid is a small double-stranded, circular DNA molecule
More informationNEBNext Magnesium RNA Fragmentation Module
SAMPLE PREPARATION NEBNext Magnesium RNA Fragmentation Module Instruction Manual NEB #E6150S 200 reactions NEBNext Magnesium RNA Fragmentation Module Table of Contents: Description....2 Applications....2
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationDepartment of Biochemistry and Molecular Biophysics, Columbia University, New York, USA
RNA Chromatin Immunoprecipitation (RNA-ChIP) in Caenorhabditis elegans Germano Cecere * and Alla Grishok Department of Biochemistry and Molecular Biophysics, Columbia University, New York, USA * For correspondence:
More information