including, but not limited to:

Size: px
Start display at page:

Download "including, but not limited to:"

Transcription

1 *This Section is part of the original Request for Proposal # P The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not limited to: * Sections are part of the original Request for Proposal # P Microscopes, Imaging Systems and Accessories Confocal Microscopes Densitometers Dissecting Microscopes EM Microscopes Fluorescence Microscopes Fluorescence Or Infrared Imagers Inverted microcopes In Vivo Fluorescence And Luminescence Detection Systems Laser Capture Microdissection (LCM) Instruments Live Animal Imaging Systems Live Cell Imaging Systems MRI And CAT Scans For Animal Analysis Phosphorimagers X Ray Systems for Animal Analysis All other related systems and accessories 3.2 Protein Analysis Instruments Amino Acid Analyzers Crystallography And NMR Instruments Fluorometers Gas Chromatographs HPLC Instruments Luminometers Mass Spectrometers Proteomic Analysis Instrumentation Robotic Handlers Systems For Protein Structure Analysis 3.3 Flow Cytometers, Cell Sorters, Cell Counters, and Cell Analyzers 3.4 Centrifuges and Rotors 3.5 Refrigeration General Purpose Freezers Low Temperature Freezers Flammable Material Freezers Environmental Chambers Other available refrigiration appliances under this category 1

2 3.6 Biosafety Cabinets, Exhaust Hoods, and Laminar Flow Hoods 3.7 Incubators and Environmental Chambers CO2 Incubators For Mammalian Cell Growth Incubators for Bacterial, Yeast, Insect Cell Growth Incubator Shakers for Microbiology 3.8 Histology Equipment Cryotomes Cryostats Microtomes Staining Systems Robotic Handlers 3.9 DNA and RNA Analysis Instruments PCR Thermal Cyclers Quantitative ( Real Time ) PCR Instruments Liquid Handling Robotic Instruments Plate Readers, Spectrophotometers Microarray Systems And Scanners Electrophoresis Instruments And Related Supplies DNA Synthesizers DNA Sequencers, Scintillation Counters Oligonucleotide Synthesizers Fluorometers Luminometers 3.10 Equipment for Animal Research Anesthesia Systems Animal Restraint Systems Aquariums Bedding Dispensers Biosafety Cabinets Cage Washers Feeding Equipment Cages for Large Animals Transfer Stations Warming Blankets 2

3 3.11 Miscellaneous Supplies and Equipment Autoclaves Drying Ovens Fluidic Devises Glass Washers Heating blocks Immunoassay Systems Plate Readers Power Supplies Sterilizers Water baths 3.12 Eligible Biomedical Research Reagents, Including, but not limited to: Molecular Biology Reagents Agarose Antibodies Chemicals DNA Amplification Kits Electrophoresis Reagents Enzymes In Vitro Transcription And Translation Kits Nucleic Acids Oligonucleotides Peptides Plasmids Protein Purification Kits RNA/DNA Purification Kits SiRNA, shrna Solutions Transfection Reagents Tissue Culture Reagents Cell Line Media Media Additives Serum Microarray Reagents Alcohol Antibodies cdna Synthesis kits Chemicals Chromatography supplies and reagents Cover Slips 3

4 DNA Amplification kits DNA labeling kits DNA purification/cleanup kits Electrophoresis supplies and reagents Enzymes Fluorescent Dyes GeneChips Glass Slides and Substrates Heating blocks Hybridization chambers Hybridization ovens In Vitro Transcription kits Liquid handling robots Microarray data analysis software Microarray databases Microarray scanners Microarraying robots Microarrays Nucleic Acids Oligonucleotides PCR supplies and reagents Primers Protein labeling kits Protein purification kits and reagents Reagents RNA labeling kits RNA purification/cleanup kits Solutions Thermal cyclers Water baths Proteomics Reagents Histology and Histochemistry Reagents Animal Model Research Reagents Animals (Including, Mice, Rats, Chickens, Frogs, Worms, Flies, Fish) Animal Food Animal Drugs And Antibiotics Anesthesia Macromolecular Crystallography Reagents Microbiology Reagents Growth Medias Additives Bacterial, Yeast And Viral Strains 4

5 Media Cytogenetics Reagents: Arrays Probes FISH Reagents Immunoassay Reagents 3.13 Eligible Scientific Supplies Molecular Biology Supplies Chemicals Filter Paper Glass Ware Pipettes Plastic ware Pre Made Gels Safety Supplies, including but not limited to Gloves, Goggles, Glass Disposal Boxes, Spill Kits, and Diaper Covers for Benches Tissue Culture Supplies Cell Scrapers Cloning Supplies Cryo Preservation Boxes and Tubes Cryovials Filters Glass Ware Plastic ware Microarray Supplies Proteomics Supplies Histology and Histochemistry Supplies Animal Model Research Supplies Animal Bedding Feeding Supplies Macromolecular Crystallography Supplies Microbiology Supplies Glass Ware Media Plastic Ware Cytogenetics Supplies 5

6 Lab Books Electrophysiology Supplies Electronic Supplies: Wires, Capacitors Etc Microscopy Supplies Bulbs Chambers for live cell imaging Glass Slides and Cover slips Lamps Lenses * Sections added in Supplemental RFP in If during the Contract Term, the contractor develops or offers a new product that falls within a category of product that the contractor is authorized under this contract to provide and sell to UMDNJ, the contractor must first obtain the approval of the Purchasing Services Department to sell the product under the Contract P before offering the product for sale to UMDNJ users DNA Sequencing Service Consensus Assembly of Sequencing Data Custom DNA Sequencing Difficult Template Sequencing Double Strand Sequence Confirmation Pre defines DNA Sequencing Pre mixed DNA Sequencing Primer Extension Sequencing Primer Waling Single Strand Primer Walking Double Strand Purification of PCR Fragments RNAi Template Sequencing Same Day DNA Sequencing Service Single Strand Sequence Confirmation Molecular Biology Service DNA Amplification Mini, midi, maxi, mega and giga Preps Preps endo free DNA Transformation Agarose Gel Analysis Restriction enzyme digestion and agarose gel analysis Any other related Services that apply in this Section 6

EQUIPMENTS & MATERIALS COMMONLY USED IN A LABORATORY

EQUIPMENTS & MATERIALS COMMONLY USED IN A LABORATORY EQUIPMENTS & MATERIALS COMMONLY USED IN A LABORATORY a) Autoclave: An autoclave is a device used to sterilize equipment and supplies by subjecting them to high pressure saturated steam at 121 C for around

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Taura Syndrome Virus (TSV) RT-PCR Kit

Taura Syndrome Virus (TSV) RT-PCR Kit Revision No.: ZJ0001 Issue Date: Aug 28th, 2007 Taura Syndrome Virus (TSV) RT-PCR Kit Cat. No.: AR-0200-03 For use with Conventional PCR Instrument or Real time PCR Instrument User Manual For in vitro

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices.

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices. DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support

More information

Average Yields* Yeast DNA Yeast RNA Time to Complete 10 Purifications * Yield will vary depending on the type of sample processed

Average Yields* Yeast DNA Yeast RNA Time to Complete 10 Purifications * Yield will vary depending on the type of sample processed 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Fungi/Yeast RNA/DNA Purification Kit Product # 35800 Product Insert

More information

PreAnalytiX Supplementary Protocol

PreAnalytiX Supplementary Protocol PreAnalytiX Supplementary Protocol Purification of total RNA from microdissected PAXgene Tissue fixed, paraffin-embedded (PFPE) and PAXgene Tissue fixed, cryo-embedded (PFCE) tissues This protocol is for

More information

PrimeScript 1st strand cdna Synthesis Kit

PrimeScript 1st strand cdna Synthesis Kit Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...

More information

EXTRACTME Kits, Product Brochure

EXTRACTME Kits, Product Brochure EXTRACTME Kits, Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Plant/Fungi Total RNA Purification Kit Product # 25800, 31350, 25850

Plant/Fungi Total RNA Purification Kit Product # 25800, 31350, 25850 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Plant/Fungi Total RNA Purification Kit Product # 25800, 31350,

More information

TOSCANA VIRUS oligomix Alert kit reagent for cdna "nested" amplification

TOSCANA VIRUS oligomix Alert kit reagent for cdna nested amplification TABLE OF CONTENTS INTENDED USE page 1 KIT DESCRIPTION page 1 KIT CHARACTERISTICS page 2 OTHER PRODUCTS REQUIRED page 2 MATERIALS PROVIDED IN THE KIT page 2 MATERIALS REQUIRED BUT NOT PROVIDED IN THE KIT

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

BIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology

BIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology BIOTECHNOLOGY Subject Code: BT Course Structure Sections/Units Section A Section B Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6 Unit 7 Section C Section D Section E Topics Engineering Mathematics General

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system!

ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! ExiProgen - Automated Protein Synthesis/Purification System ExiProgen

More information

GenUP Virus DNA/RNA Kit

GenUP Virus DNA/RNA Kit Product Insert GenUP Virus DNA/RNA Kit LOT: See product label EXPIRY DATE: See product label ORDERING INFORMATION PRODUCT GenUP Virus DNA/RNA Kit CAT. NO. BR0701101 BR0701102 BR0701103 SIZE 10 preps 50

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Human Cell-Free Protein Expression Maxi System

Human Cell-Free Protein Expression Maxi System Cat. # 3285 For Research Use Human Cell-Free Protein Expression Maxi System Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage...

More information

Site-directed mutagenesis of proteins

Site-directed mutagenesis of proteins IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction

More information

3'-Full RACE Core Set

3'-Full RACE Core Set Table of Contents Description... 2 Principle... 4 Preparation of RNA Sample... 5 Note... 5 Protocol 1. General Protocol... 6 2. Application example... 8 Also available from Takara PCR related products

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Plasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only

Plasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only Plasmid Midiprep Plus Purification Kit Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only 1 Description: The Plasmid Midiprep Plus Purification Kit provides simple

More information

T7-Based RNA Amplification Protocol (in progress)

T7-Based RNA Amplification Protocol (in progress) T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of

More information

MICROARRAY HYBRIDISATION PROTOCOL 10/05 (for both PCR and Oligo arrays on UltraGAPS slides)

MICROARRAY HYBRIDISATION PROTOCOL 10/05 (for both PCR and Oligo arrays on UltraGAPS slides) MICROARRAY HYBRIDISATION PROTOCOL 10/05 (for both PCR and Oligo arrays on UltraGAPS slides) Vassilis Mersinias, Giselda Bucca and Graham Hotchkiss Quick Protocol (see notes at end for detailed instructions)

More information

Polymerase Chain Reaction Quality Control and Quality Assurance

Polymerase Chain Reaction Quality Control and Quality Assurance Polymerase Chain Reaction Quality Control and Quality Assurance Saran Grewal San Diego County Vector Control Program Vector Disease and Diagnostic Laboratory How Positive is Positive? TOPICS THE LABORATORY

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Transfusion-transmitted Virus(TTV) Real Time PCR Kit

Transfusion-transmitted Virus(TTV) Real Time PCR Kit Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Transfusion-transmitted Virus(TTV) Real Time PCR Kit Cat. No.: HD-0013-02 For use with ABI Prism 7000/7300/7500/7900; Smart CyclerII; icycler iq 4/iQ 5;

More information

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

AmpliSens Enterovirus-EPh PCR kit

AmpliSens Enterovirus-EPh PCR kit For Professional Use Only AmpliSens Enterovirus-EPh PCR kit Instruction Manual AmpliSens Ecoli s.r.o., Studenohorska 12 841 03 Bratislava 47 Slovak Republic Tel.: +421 2 6478 9336 Fax: +421 2 6478 9040

More information

TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0

TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Cat. # 9766 For Research Use TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage and shipping... 3 IV. Preparation

More information

For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.

For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida. For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Department of Microbiology, Lab 016 instructions

Department of Microbiology, Lab 016 instructions Protocol for standard FISH and DOPE-FISH for prokaryotes (slightly modified from Amann, 1995, note, for other modifications or other microorganisms like eukaryotes, consult special literature or check

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous

More information

Bacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only

Bacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,

More information

GNOME DNA Kit. One Call One Source A World of Biotechnology Reagents.

GNOME DNA Kit. One Call One Source A World of Biotechnology Reagents. Instruction Manual GNOME DNA Kit Rapid 3-Step Procedure for Isolating Genomic DNA from Prokaryotes, Eukaryotes, or Tissues. Ideally Suited for Multiple RFLP Assays, PCR, and Cloning (Without Phenol/Chloroform).

More information

by nexttec TM 1 -Step

by nexttec TM 1 -Step Protocol DNA Isolation from Tissue & Cells by nexttec TM 1 -Step - nexttec cleancolumns - Cat. No. 10N.010 Cat. No. 10N.050 Cat. No. 10N.250 Version 1.0 For research only Principle nexttec 1 -Step is the

More information

RNA Clean-Up and Concentration Kit Product # 23600, 43200

RNA Clean-Up and Concentration Kit Product # 23600, 43200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com RNA Clean-Up and Concentration Kit Product # 23600, 43200 Product

More information

Arcturus HistoGene Frozen Section Staining Kit. User Guide

Arcturus HistoGene Frozen Section Staining Kit. User Guide Arcturus HistoGene Frozen Section Staining Kit User Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without

More information

Fungal rdna (D1/D2) PCR Kit Fast

Fungal rdna (D1/D2) PCR Kit Fast Cat. # RR184A For Research Use Fungal rdna (D1/D2) PCR Kit Fast Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage... 4 V.

More information

Biology 252 Nucleic Acid Methods

Biology 252 Nucleic Acid Methods Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.

More information

Entry Level Assessment Blueprint Biotechnology

Entry Level Assessment Blueprint Biotechnology Entry Level Assessment Blueprint Biotechnology Test Code: 4075 / Version: 01 Specific Competencies and Skills Tested in this Assessment: Work Habits Demonstrate professional work habits Demonstrate the

More information

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents...

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents... Table of content I. Description...2 II. Principle... 2 III. Kit Contents...4 IV. Storage...5 V. Features...5 VI. Note...5 VII. Protocol...6 VIII. Experiment Example...11 IX. Appendix...12 X. Guideline

More information

HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit

HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit Instruction manual Cat. No: 6001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Roche, Applied Bio systems [ABI], Rotor-gene, Cepheid, Bioer,

More information

SYBR Premix DimerEraser (Perfect Real Time)

SYBR Premix DimerEraser (Perfect Real Time) Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.

More information

HiPer Real-Time PCR Teaching Kit

HiPer Real-Time PCR Teaching Kit HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from

More information

HIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC

HIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC HIGH SCHOOL STUDENT SCIENCE WEEK St. Paul s Hospital Vancouver, BC Sponsors 2 AGENDA Location: UBC James Hogg Research Centre (JHRC), St. Paul s Hospital, Room 166 Burrard Building, 1081 Burrard Street,

More information

AFFYMETRIX GENECHIP HYBRIDIZATION ANALYSIS (Updated: April 19, 2007) Experimental Organs:

AFFYMETRIX GENECHIP HYBRIDIZATION ANALYSIS (Updated: April 19, 2007) Experimental Organs: Date: AFFYMETRIX GENECHIP HYBRIDIZATION ANALYSIS (Updated: April 19, 2007) Experimental Organs: Note: This protocol is slightly modified from the general protocol for the biotin-labeled cdna generated

More information

ExiProgen Protein Synthesis RNA/DNA Prep System

ExiProgen Protein Synthesis RNA/DNA Prep System Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! - Automated Protein Synthesis/Purification System Bioneer's is the world's

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

Kit Specifications 45 g. 45 g of RNA 8 L

Kit Specifications 45 g. 45 g of RNA 8 L RNA Clean-Up and Concentration Micro-Elute Kit Product # 61000 Product Insert Norgen s RNA Clean-Up and Concentration Micro-Elution Kit provides a rapid method for the purification, cleanup and concentration

More information

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Total RNA Purification Micro Kit Product # 35300

Total RNA Purification Micro Kit Product # 35300 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Total RNA Purification Micro Kit Product # 35300 Product Insert

More information

TBE Buffer, 10X. Product Data Sheet Catalog No. Quantity ml liter. Please recycle Version:

TBE Buffer, 10X. Product Data Sheet Catalog No. Quantity ml liter. Please recycle Version: TBE Buffer, 10X (Tris-borate-EDTA) Product Data Sheet Catalog No. Quantity 15002-500 15002-1000 1 liter Please recycle Version: 01042012 1 Description TBE Buffer is used for polyacrylamide and agarose

More information

DNA purification and analysis

DNA purification and analysis DNA purification and analysis Maximize sample yield, purity, and integrity Optimized for maximum yield and purity From plasmid to genomic DNA and from DNA clean-up to automation, Invitrogen products bring

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

QuickExtract FFPE RNA Extraction Kit

QuickExtract FFPE RNA Extraction Kit QuickExtract FFPE RNA Extraction Kit Cat. Nos. QFR82805 and QFR82050 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Presto Mini gdna Bacteria Kit

Presto Mini gdna Bacteria Kit Instruction Manual Ver. 02.10.17 For Research Use Only Presto Mini gdna Bacteria Kit Advantages GBB004 (4 Preparation Sample Kit) GBB100/101 (100 Preparation Kit) GBB300/301 (300 Preparation Kit) Sample:

More information

Cytoplasmic & Nuclear RNA Purification Kit Product # 21000, 37400

Cytoplasmic & Nuclear RNA Purification Kit Product # 21000, 37400 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cytoplasmic & Nuclear RNA Purification Kit Product # 21000, 37400

More information

ULTRAPrep PLASMID DNA KIT

ULTRAPrep PLASMID DNA KIT ULTRAPrep RNA Tissue Total RNA isolation from cultured human and animal cells ULTRAPrep RNA Cell Culture Total RNA isolation from cultured human and animal cells 2 2 6-024-01-0 6-024-02-0 6-021-01-0 6-021-02-0

More information

Urine DNA Isolation Maxi Kit (Slurry Format) Product # 50100

Urine DNA Isolation Maxi Kit (Slurry Format) Product # 50100 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Urine DNA Isolation Maxi Kit (Slurry Format) Product # 50100 Product

More information

Bacterial 16S rdna PCR Kit Fast (800)

Bacterial 16S rdna PCR Kit Fast (800) Cat. # RR182A For Research Use Bacterial 16S rdna PCR Kit Fast (800) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage...

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Instruction Manual for DNA-Microarrays

Instruction Manual for DNA-Microarrays Instruction Manual for DNA-Microarrays 3-D Amino Surface Last update: 2004-12 page 1 Table of contents I. Introduction...3 II. Product description...4 A. Greiner Bio-One HTA Slides...4 B: SCIENION Buffer

More information

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer. Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Biosafety Level 2 (BSL-2) Laboratory Guidelines

Biosafety Level 2 (BSL-2) Laboratory Guidelines Biosafety Level 2 (BSL-2) Laboratory Guidelines Table of Contents 1. Introduction... 2 2. Required Document for BUA Application Process... 2 3. Training... 2 4. Signage... 2 5. Transporting Biohazardous

More information

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss

More information

Table 1.1. Reagents Preparation Reagent Temp Out of Module* Treatment Store before using in Master Mix

Table 1.1. Reagents Preparation Reagent Temp Out of Module* Treatment Store before using in Master Mix Quick Reference Card Axiom Manual Target Prep Protocol Stage 1: DNA Amplification Intro to Manual Target Preparation Running the Axiom Assay requires the following sets of steps: 1. Genomic DNA Prep, described

More information

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70 GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously

More information

Vector Linearization. igem TU/e 2015 Biomedical Engineering

Vector Linearization. igem TU/e 2015 Biomedical Engineering igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector

More information

CalPhos Mammalian Transfection Kit User Manual

CalPhos Mammalian Transfection Kit User Manual CalPhos Mammalian Transfection Kit User Manual Cat. No. 631312 PT3025-1 (PR3Z643) Published 22 December 2003 Table of Contents I. Introduction 3 II. List of Components 4 III. Additional Materials Required

More information

Ampli1 WGA Kit. Whole Genome Amplification for Single Cells. USER MANUAL y Version 01 Content version: July I WG R01 50 reactions

Ampli1 WGA Kit. Whole Genome Amplification for Single Cells. USER MANUAL y Version 01 Content version: July I WG R01 50 reactions For research use only. Not for use in diagnostic procedures. For in vitro use only. Ampli1 WGA Kit Whole Genome Amplification for Single Cells USER MANUAL y Version 01 Content version: July 2011 I WG 000

More information

Growth and Maintenance of the 293A Cell Line

Growth and Maintenance of the 293A Cell Line Growth and Maintenance of the 293A Cell Line USER GUIDE Catalog Number R705-07 Publication Number MAN0000303 Revision A.0 For Research Use Only. Not for use in diagnostic procedures. The information in

More information

Note: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology

Note: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology Note: for laboratory research use only RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Cat. #: RP1202 (50preps) Signalway Biotechnology I. Kit Content, Storage Condition and Stability Content

More information

SYBR Advantage qpcr Premix. User Manual

SYBR Advantage qpcr Premix. User Manual User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company

More information

AMPURE PCR PURIFICATION PAGE 1 OF 7

AMPURE PCR PURIFICATION PAGE 1 OF 7 PCR PURIFICATION PAGE 1 OF 7 Please refer to http://www.agencourt.com/technical/reagent_information/ for updated protocols. AMPure is a registered trademark of Agencourt Bioscience and is for laboratory

More information

1. A brief overview of sequencing biochemistry

1. A brief overview of sequencing biochemistry Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry

More information

MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack

MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack Bioneer s magnetic nanobead-based solution for DNA/RNA extraction and purification 20150910 Ver.1(EN) MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack Fast, easy separation - Just

More information

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Spotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003

Spotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003 Spotted DNA Array Design Todd Lowe Bio 210 Jan 13 & 15, 2003 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations Spotted

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial

More information

Microarray protocol Emmanuela Marchi PhD Dept. Pharmacology UFIR - Comparative nutritional systems biology Focus Team Post-doc emanuela.marchi@unifi.it 16 April 2009 When citing this SOP you should acknowledge

More information

TECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C

TECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQX Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification Kit

More information

PharmacoScan Assay 96-Array Format Manual Protocol Pub. No Rev. 1

PharmacoScan Assay 96-Array Format Manual Protocol Pub. No Rev. 1 QUICK REFERENCE PharmacoScan Assay 96-Array Format Manual Protocol Pub. No. 703461 Rev. 1 Introduction and Stage 1A: Multiplex PCR and 1B: DNA Amplification Introduction to PharmacoScan Assay 96-Array

More information

LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA

LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA I. Objectives The purpose of today s lab is to learn how to set up and run an agarose gel, separate DNA fragments on the gel, and

More information

RNAprotect Bacteria Reagent Handbook

RNAprotect Bacteria Reagent Handbook January 2015 RNAprotect Bacteria Reagent Handbook RNAprotect Bacteria Reagent For in vivo stabilization of total RNA in bacteria RNeasy Protect Bacteria Mini Kit RNeasy Protect Bacteria Midi Kit For in

More information