including, but not limited to:
|
|
- Bruce O’Connor’
- 6 years ago
- Views:
Transcription
1 *This Section is part of the original Request for Proposal # P The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not limited to: * Sections are part of the original Request for Proposal # P Microscopes, Imaging Systems and Accessories Confocal Microscopes Densitometers Dissecting Microscopes EM Microscopes Fluorescence Microscopes Fluorescence Or Infrared Imagers Inverted microcopes In Vivo Fluorescence And Luminescence Detection Systems Laser Capture Microdissection (LCM) Instruments Live Animal Imaging Systems Live Cell Imaging Systems MRI And CAT Scans For Animal Analysis Phosphorimagers X Ray Systems for Animal Analysis All other related systems and accessories 3.2 Protein Analysis Instruments Amino Acid Analyzers Crystallography And NMR Instruments Fluorometers Gas Chromatographs HPLC Instruments Luminometers Mass Spectrometers Proteomic Analysis Instrumentation Robotic Handlers Systems For Protein Structure Analysis 3.3 Flow Cytometers, Cell Sorters, Cell Counters, and Cell Analyzers 3.4 Centrifuges and Rotors 3.5 Refrigeration General Purpose Freezers Low Temperature Freezers Flammable Material Freezers Environmental Chambers Other available refrigiration appliances under this category 1
2 3.6 Biosafety Cabinets, Exhaust Hoods, and Laminar Flow Hoods 3.7 Incubators and Environmental Chambers CO2 Incubators For Mammalian Cell Growth Incubators for Bacterial, Yeast, Insect Cell Growth Incubator Shakers for Microbiology 3.8 Histology Equipment Cryotomes Cryostats Microtomes Staining Systems Robotic Handlers 3.9 DNA and RNA Analysis Instruments PCR Thermal Cyclers Quantitative ( Real Time ) PCR Instruments Liquid Handling Robotic Instruments Plate Readers, Spectrophotometers Microarray Systems And Scanners Electrophoresis Instruments And Related Supplies DNA Synthesizers DNA Sequencers, Scintillation Counters Oligonucleotide Synthesizers Fluorometers Luminometers 3.10 Equipment for Animal Research Anesthesia Systems Animal Restraint Systems Aquariums Bedding Dispensers Biosafety Cabinets Cage Washers Feeding Equipment Cages for Large Animals Transfer Stations Warming Blankets 2
3 3.11 Miscellaneous Supplies and Equipment Autoclaves Drying Ovens Fluidic Devises Glass Washers Heating blocks Immunoassay Systems Plate Readers Power Supplies Sterilizers Water baths 3.12 Eligible Biomedical Research Reagents, Including, but not limited to: Molecular Biology Reagents Agarose Antibodies Chemicals DNA Amplification Kits Electrophoresis Reagents Enzymes In Vitro Transcription And Translation Kits Nucleic Acids Oligonucleotides Peptides Plasmids Protein Purification Kits RNA/DNA Purification Kits SiRNA, shrna Solutions Transfection Reagents Tissue Culture Reagents Cell Line Media Media Additives Serum Microarray Reagents Alcohol Antibodies cdna Synthesis kits Chemicals Chromatography supplies and reagents Cover Slips 3
4 DNA Amplification kits DNA labeling kits DNA purification/cleanup kits Electrophoresis supplies and reagents Enzymes Fluorescent Dyes GeneChips Glass Slides and Substrates Heating blocks Hybridization chambers Hybridization ovens In Vitro Transcription kits Liquid handling robots Microarray data analysis software Microarray databases Microarray scanners Microarraying robots Microarrays Nucleic Acids Oligonucleotides PCR supplies and reagents Primers Protein labeling kits Protein purification kits and reagents Reagents RNA labeling kits RNA purification/cleanup kits Solutions Thermal cyclers Water baths Proteomics Reagents Histology and Histochemistry Reagents Animal Model Research Reagents Animals (Including, Mice, Rats, Chickens, Frogs, Worms, Flies, Fish) Animal Food Animal Drugs And Antibiotics Anesthesia Macromolecular Crystallography Reagents Microbiology Reagents Growth Medias Additives Bacterial, Yeast And Viral Strains 4
5 Media Cytogenetics Reagents: Arrays Probes FISH Reagents Immunoassay Reagents 3.13 Eligible Scientific Supplies Molecular Biology Supplies Chemicals Filter Paper Glass Ware Pipettes Plastic ware Pre Made Gels Safety Supplies, including but not limited to Gloves, Goggles, Glass Disposal Boxes, Spill Kits, and Diaper Covers for Benches Tissue Culture Supplies Cell Scrapers Cloning Supplies Cryo Preservation Boxes and Tubes Cryovials Filters Glass Ware Plastic ware Microarray Supplies Proteomics Supplies Histology and Histochemistry Supplies Animal Model Research Supplies Animal Bedding Feeding Supplies Macromolecular Crystallography Supplies Microbiology Supplies Glass Ware Media Plastic Ware Cytogenetics Supplies 5
6 Lab Books Electrophysiology Supplies Electronic Supplies: Wires, Capacitors Etc Microscopy Supplies Bulbs Chambers for live cell imaging Glass Slides and Cover slips Lamps Lenses * Sections added in Supplemental RFP in If during the Contract Term, the contractor develops or offers a new product that falls within a category of product that the contractor is authorized under this contract to provide and sell to UMDNJ, the contractor must first obtain the approval of the Purchasing Services Department to sell the product under the Contract P before offering the product for sale to UMDNJ users DNA Sequencing Service Consensus Assembly of Sequencing Data Custom DNA Sequencing Difficult Template Sequencing Double Strand Sequence Confirmation Pre defines DNA Sequencing Pre mixed DNA Sequencing Primer Extension Sequencing Primer Waling Single Strand Primer Walking Double Strand Purification of PCR Fragments RNAi Template Sequencing Same Day DNA Sequencing Service Single Strand Sequence Confirmation Molecular Biology Service DNA Amplification Mini, midi, maxi, mega and giga Preps Preps endo free DNA Transformation Agarose Gel Analysis Restriction enzyme digestion and agarose gel analysis Any other related Services that apply in this Section 6
EQUIPMENTS & MATERIALS COMMONLY USED IN A LABORATORY
EQUIPMENTS & MATERIALS COMMONLY USED IN A LABORATORY a) Autoclave: An autoclave is a device used to sterilize equipment and supplies by subjecting them to high pressure saturated steam at 121 C for around
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationTaura Syndrome Virus (TSV) RT-PCR Kit
Revision No.: ZJ0001 Issue Date: Aug 28th, 2007 Taura Syndrome Virus (TSV) RT-PCR Kit Cat. No.: AR-0200-03 For use with Conventional PCR Instrument or Real time PCR Instrument User Manual For in vitro
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationTotal Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices.
DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support
More informationAverage Yields* Yeast DNA Yeast RNA Time to Complete 10 Purifications * Yield will vary depending on the type of sample processed
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Fungi/Yeast RNA/DNA Purification Kit Product # 35800 Product Insert
More informationPreAnalytiX Supplementary Protocol
PreAnalytiX Supplementary Protocol Purification of total RNA from microdissected PAXgene Tissue fixed, paraffin-embedded (PFPE) and PAXgene Tissue fixed, cryo-embedded (PFCE) tissues This protocol is for
More informationPrimeScript 1st strand cdna Synthesis Kit
Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...
More informationEXTRACTME Kits, Product Brochure
EXTRACTME Kits, Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationPlant/Fungi Total RNA Purification Kit Product # 25800, 31350, 25850
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Plant/Fungi Total RNA Purification Kit Product # 25800, 31350,
More informationTOSCANA VIRUS oligomix Alert kit reagent for cdna "nested" amplification
TABLE OF CONTENTS INTENDED USE page 1 KIT DESCRIPTION page 1 KIT CHARACTERISTICS page 2 OTHER PRODUCTS REQUIRED page 2 MATERIALS PROVIDED IN THE KIT page 2 MATERIALS REQUIRED BUT NOT PROVIDED IN THE KIT
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationBIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology
BIOTECHNOLOGY Subject Code: BT Course Structure Sections/Units Section A Section B Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6 Unit 7 Section C Section D Section E Topics Engineering Mathematics General
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system!
ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! ExiProgen - Automated Protein Synthesis/Purification System ExiProgen
More informationGenUP Virus DNA/RNA Kit
Product Insert GenUP Virus DNA/RNA Kit LOT: See product label EXPIRY DATE: See product label ORDERING INFORMATION PRODUCT GenUP Virus DNA/RNA Kit CAT. NO. BR0701101 BR0701102 BR0701103 SIZE 10 preps 50
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationHuman Cell-Free Protein Expression Maxi System
Cat. # 3285 For Research Use Human Cell-Free Protein Expression Maxi System Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage...
More informationSite-directed mutagenesis of proteins
IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction
More information3'-Full RACE Core Set
Table of Contents Description... 2 Principle... 4 Preparation of RNA Sample... 5 Note... 5 Protocol 1. General Protocol... 6 2. Application example... 8 Also available from Takara PCR related products
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationPlasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only
Plasmid Midiprep Plus Purification Kit Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only 1 Description: The Plasmid Midiprep Plus Purification Kit provides simple
More informationT7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
More informationMICROARRAY HYBRIDISATION PROTOCOL 10/05 (for both PCR and Oligo arrays on UltraGAPS slides)
MICROARRAY HYBRIDISATION PROTOCOL 10/05 (for both PCR and Oligo arrays on UltraGAPS slides) Vassilis Mersinias, Giselda Bucca and Graham Hotchkiss Quick Protocol (see notes at end for detailed instructions)
More informationPolymerase Chain Reaction Quality Control and Quality Assurance
Polymerase Chain Reaction Quality Control and Quality Assurance Saran Grewal San Diego County Vector Control Program Vector Disease and Diagnostic Laboratory How Positive is Positive? TOPICS THE LABORATORY
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationTransfusion-transmitted Virus(TTV) Real Time PCR Kit
Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Transfusion-transmitted Virus(TTV) Real Time PCR Kit Cat. No.: HD-0013-02 For use with ABI Prism 7000/7300/7500/7900; Smart CyclerII; icycler iq 4/iQ 5;
More informationTable of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationAmpliSens Enterovirus-EPh PCR kit
For Professional Use Only AmpliSens Enterovirus-EPh PCR kit Instruction Manual AmpliSens Ecoli s.r.o., Studenohorska 12 841 03 Bratislava 47 Slovak Republic Tel.: +421 2 6478 9336 Fax: +421 2 6478 9040
More informationTaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0
Cat. # 9766 For Research Use TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage and shipping... 3 IV. Preparation
More informationFor in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.
For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationDepartment of Microbiology, Lab 016 instructions
Protocol for standard FISH and DOPE-FISH for prokaryotes (slightly modified from Amann, 1995, note, for other modifications or other microorganisms like eukaryotes, consult special literature or check
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationMOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien
Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous
More informationBacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,
More informationGNOME DNA Kit. One Call One Source A World of Biotechnology Reagents.
Instruction Manual GNOME DNA Kit Rapid 3-Step Procedure for Isolating Genomic DNA from Prokaryotes, Eukaryotes, or Tissues. Ideally Suited for Multiple RFLP Assays, PCR, and Cloning (Without Phenol/Chloroform).
More informationby nexttec TM 1 -Step
Protocol DNA Isolation from Tissue & Cells by nexttec TM 1 -Step - nexttec cleancolumns - Cat. No. 10N.010 Cat. No. 10N.050 Cat. No. 10N.250 Version 1.0 For research only Principle nexttec 1 -Step is the
More informationRNA Clean-Up and Concentration Kit Product # 23600, 43200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com RNA Clean-Up and Concentration Kit Product # 23600, 43200 Product
More informationArcturus HistoGene Frozen Section Staining Kit. User Guide
Arcturus HistoGene Frozen Section Staining Kit User Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without
More informationFungal rdna (D1/D2) PCR Kit Fast
Cat. # RR184A For Research Use Fungal rdna (D1/D2) PCR Kit Fast Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage... 4 V.
More informationBiology 252 Nucleic Acid Methods
Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.
More informationEntry Level Assessment Blueprint Biotechnology
Entry Level Assessment Blueprint Biotechnology Test Code: 4075 / Version: 01 Specific Competencies and Skills Tested in this Assessment: Work Habits Demonstrate professional work habits Demonstrate the
More informationTable of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents...
Table of content I. Description...2 II. Principle... 2 III. Kit Contents...4 IV. Storage...5 V. Features...5 VI. Note...5 VII. Protocol...6 VIII. Experiment Example...11 IX. Appendix...12 X. Guideline
More informationHELINI White spot Syndrome virus [WSSV] Real-time PCR Kit
HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit Instruction manual Cat. No: 6001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Roche, Applied Bio systems [ABI], Rotor-gene, Cepheid, Bioer,
More informationSYBR Premix DimerEraser (Perfect Real Time)
Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationHIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC
HIGH SCHOOL STUDENT SCIENCE WEEK St. Paul s Hospital Vancouver, BC Sponsors 2 AGENDA Location: UBC James Hogg Research Centre (JHRC), St. Paul s Hospital, Room 166 Burrard Building, 1081 Burrard Street,
More informationAFFYMETRIX GENECHIP HYBRIDIZATION ANALYSIS (Updated: April 19, 2007) Experimental Organs:
Date: AFFYMETRIX GENECHIP HYBRIDIZATION ANALYSIS (Updated: April 19, 2007) Experimental Organs: Note: This protocol is slightly modified from the general protocol for the biotin-labeled cdna generated
More informationExiProgen Protein Synthesis RNA/DNA Prep System
Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! - Automated Protein Synthesis/Purification System Bioneer's is the world's
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationKit Specifications 45 g. 45 g of RNA 8 L
RNA Clean-Up and Concentration Micro-Elute Kit Product # 61000 Product Insert Norgen s RNA Clean-Up and Concentration Micro-Elution Kit provides a rapid method for the purification, cleanup and concentration
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationTotal RNA Purification Micro Kit Product # 35300
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Total RNA Purification Micro Kit Product # 35300 Product Insert
More informationTBE Buffer, 10X. Product Data Sheet Catalog No. Quantity ml liter. Please recycle Version:
TBE Buffer, 10X (Tris-borate-EDTA) Product Data Sheet Catalog No. Quantity 15002-500 15002-1000 1 liter Please recycle Version: 01042012 1 Description TBE Buffer is used for polyacrylamide and agarose
More informationDNA purification and analysis
DNA purification and analysis Maximize sample yield, purity, and integrity Optimized for maximum yield and purity From plasmid to genomic DNA and from DNA clean-up to automation, Invitrogen products bring
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationQuickExtract FFPE RNA Extraction Kit
QuickExtract FFPE RNA Extraction Kit Cat. Nos. QFR82805 and QFR82050 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationPresto Mini gdna Bacteria Kit
Instruction Manual Ver. 02.10.17 For Research Use Only Presto Mini gdna Bacteria Kit Advantages GBB004 (4 Preparation Sample Kit) GBB100/101 (100 Preparation Kit) GBB300/301 (300 Preparation Kit) Sample:
More informationCytoplasmic & Nuclear RNA Purification Kit Product # 21000, 37400
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cytoplasmic & Nuclear RNA Purification Kit Product # 21000, 37400
More informationULTRAPrep PLASMID DNA KIT
ULTRAPrep RNA Tissue Total RNA isolation from cultured human and animal cells ULTRAPrep RNA Cell Culture Total RNA isolation from cultured human and animal cells 2 2 6-024-01-0 6-024-02-0 6-021-01-0 6-021-02-0
More informationUrine DNA Isolation Maxi Kit (Slurry Format) Product # 50100
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Urine DNA Isolation Maxi Kit (Slurry Format) Product # 50100 Product
More informationBacterial 16S rdna PCR Kit Fast (800)
Cat. # RR182A For Research Use Bacterial 16S rdna PCR Kit Fast (800) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage...
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationInstruction Manual for DNA-Microarrays
Instruction Manual for DNA-Microarrays 3-D Amino Surface Last update: 2004-12 page 1 Table of contents I. Introduction...3 II. Product description...4 A. Greiner Bio-One HTA Slides...4 B: SCIENION Buffer
More informationProteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationBiosafety Level 2 (BSL-2) Laboratory Guidelines
Biosafety Level 2 (BSL-2) Laboratory Guidelines Table of Contents 1. Introduction... 2 2. Required Document for BUA Application Process... 2 3. Training... 2 4. Signage... 2 5. Transporting Biohazardous
More informationRNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation
RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss
More informationTable 1.1. Reagents Preparation Reagent Temp Out of Module* Treatment Store before using in Master Mix
Quick Reference Card Axiom Manual Target Prep Protocol Stage 1: DNA Amplification Intro to Manual Target Preparation Running the Axiom Assay requires the following sets of steps: 1. Genomic DNA Prep, described
More informationTECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70
GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously
More informationVector Linearization. igem TU/e 2015 Biomedical Engineering
igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector
More informationCalPhos Mammalian Transfection Kit User Manual
CalPhos Mammalian Transfection Kit User Manual Cat. No. 631312 PT3025-1 (PR3Z643) Published 22 December 2003 Table of Contents I. Introduction 3 II. List of Components 4 III. Additional Materials Required
More informationAmpli1 WGA Kit. Whole Genome Amplification for Single Cells. USER MANUAL y Version 01 Content version: July I WG R01 50 reactions
For research use only. Not for use in diagnostic procedures. For in vitro use only. Ampli1 WGA Kit Whole Genome Amplification for Single Cells USER MANUAL y Version 01 Content version: July 2011 I WG 000
More informationGrowth and Maintenance of the 293A Cell Line
Growth and Maintenance of the 293A Cell Line USER GUIDE Catalog Number R705-07 Publication Number MAN0000303 Revision A.0 For Research Use Only. Not for use in diagnostic procedures. The information in
More informationNote: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology
Note: for laboratory research use only RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Cat. #: RP1202 (50preps) Signalway Biotechnology I. Kit Content, Storage Condition and Stability Content
More informationSYBR Advantage qpcr Premix. User Manual
User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company
More informationAMPURE PCR PURIFICATION PAGE 1 OF 7
PCR PURIFICATION PAGE 1 OF 7 Please refer to http://www.agencourt.com/technical/reagent_information/ for updated protocols. AMPure is a registered trademark of Agencourt Bioscience and is for laboratory
More information1. A brief overview of sequencing biochemistry
Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry
More informationMagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack
Bioneer s magnetic nanobead-based solution for DNA/RNA extraction and purification 20150910 Ver.1(EN) MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack Fast, easy separation - Just
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationSpotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003
Spotted DNA Array Design Todd Lowe Bio 210 Jan 13 & 15, 2003 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations Spotted
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationTECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits
In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial
More informationMicroarray protocol Emmanuela Marchi PhD Dept. Pharmacology UFIR - Comparative nutritional systems biology Focus Team Post-doc emanuela.marchi@unifi.it 16 April 2009 When citing this SOP you should acknowledge
More informationTECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C
SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQX Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification Kit
More informationPharmacoScan Assay 96-Array Format Manual Protocol Pub. No Rev. 1
QUICK REFERENCE PharmacoScan Assay 96-Array Format Manual Protocol Pub. No. 703461 Rev. 1 Introduction and Stage 1A: Multiplex PCR and 1B: DNA Amplification Introduction to PharmacoScan Assay 96-Array
More informationLAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA
LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA I. Objectives The purpose of today s lab is to learn how to set up and run an agarose gel, separate DNA fragments on the gel, and
More informationRNAprotect Bacteria Reagent Handbook
January 2015 RNAprotect Bacteria Reagent Handbook RNAprotect Bacteria Reagent For in vivo stabilization of total RNA in bacteria RNeasy Protect Bacteria Mini Kit RNeasy Protect Bacteria Midi Kit For in
More information