Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
|
|
- Lucinda Pearson
- 6 years ago
- Views:
Transcription
1 Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result Table... 4 Troubleshootings... 4 Precautions... 4 Exp. 1.2 Preparation of Bacterial Lysates... 5 Introduction... 5 Principle... 6 Procedure... 7 Observation... 9 Result Table... 9 Troubleshootings... 9 Precautions... 9 Exp. 1.3 Isolation of Plasmids Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshootings Precautions Exp. 1.4 Isolation of Total RNA from Bacteria Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshootings Precautions Exp. 1.5 Amplification of 16S rrna Gene vii
2 viii Contents Introduction Principle Reagents Required and Their Role Procedure Observation Troubleshootings Precautions Exp. 1.6 To Perform Agarose Gel Electrophoresis Introduction Principle Reagents Required and Their Role Procedure Observation Troubleshootings Precautions Cloning and Transformation Exp. 2.1 Preparation of Competent Cells and Heat-Shock Transformation Introduction Principle Reagents Required and Their Role Procedure Observation Troubleshooting Precautions Exp. 2.2 Electroporation Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Exp. 2.3 Restriction Digestion and Ligation Introduction Principle Reagents Required and Their Role Procedure Observation Troubleshooting Precaution Exp. 2.4 Selection of a Suitable Vector System for Cloning Different Types of Cloning Vectors Criteria for Choosing a Suitable Cloning Vector Conclusion Exp. 2.5 Confirmation of Transformation by Blue-White Selection... 62
3 Contents ix Introduction Principle Reagents Required and Their Role IPTG Antibiotics pbluescript Transformation Reaction Product Procedure Observation Troubleshooting Precautions Exp. 2.6 Confirmation of Cloning by PCR Introduction Principle Reagents Required and Their Role Procedure Observation Troubleshooting Precautions Advanced Molecular Microbiology Techniques Exp Synthesis of cdna Introduction Principle Reagents Required and Their Role Procedure Observation Trouble-Shootings Precautions Exp Gene Expression Analysis by qrt-pcr Introduction Principle Reagents Required and Their Role Procedure Observation Trouble-Shootings Precautions Exp Gene Expression Analysis Using Reporter Gene Assay Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Precaution Trouble-Shootings... 89
4 x Contents Exp Semi-quantitative Gene Expression Analysis Introduction Principle Reagents Required and Their Role Procedure Observation Observation Table Trouble-Shootings Precautions Exp Northern Blotting Introduction Principle Reagents Required and Their Role Procedure Observation Trouble-Shootings Precautions Exp Isolation of Metagenomic DNA Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Trouble-Shootings Precautions Exp Plasmid Curing from Bacterial Cell Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Trouble-Shootings Precautions Exp Conjugation in Bacteria Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Trouble-Shootings Precaution Exp Transduction in Bacteria Introduction Principle Reagents Required and Their Role
5 Contents xi Procedure Observation Result Table Trouble-Shootings Precaution Molecular Microbial Diversity Exp. 4.1 Plasmid Profile Analysis Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Exp. 4.2 Amplified Ribosomal DNA Restriction Analysis to Study Bacterial Relatedness Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Exp. 4.3 Denaturing Gradient Gel Electrophoresis (DGGE) Analysis to Study Metagenomic Bacterial Diversity Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Exp. 4.4 Pulsed Field Gel Electrophoresis (PFGE) Analysis Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Exp. 4.5 Multiplex PCR for Rapid Characterization of Bacteria Introduction Principle
6 xii Contents Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Exp. 4.6 ERIC and REP-PCR Fingerprinting Techniques Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Computer-Aided Study of Molecular Microbiology Exp. 5.1 Analysis of Gene Sequences Introduction Example of Tools for Sequence Analysis Principle Procedure Exp. 5.2 Submission of Sequences to GenBank Introduction Principle Procedure Exp. 5.3 Phylogenetic Trees Introduction Reading Trees Phylogenetic Tree Software Principle Procedure Exp. 5.4 Primer Design Introduction Primer Designing Using Software Guidelines for Primer Design Procedure for Using NETPRIMER Software for Primer Designing Application of Molecular Microbiology Exp. 6.1 Biofilm Formation in Glass Tubes Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting
7 Contents xiii Precaution Exp. 6.2 Screening of Biofilm Formation in Micro-Titre Plates Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precaution Exp. 6.3 Confocal Laser Scanning Microscopy for Biofilm Analysis Introduction Principle Reagents Required and Their Role Biofilm-Forming Bacteria Protocol Observation Observation Table Precautions Troubleshooting Exp. 6.4 Fluorescence Microscopy of Bacterial Biofilm and Image Analysis Introduction Principle Reagents Required and Their Role Protocol Observation Table Precautions Exp. 6.5 Screening for Biosurfactants Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Exp. 6.6 Spectrophotometric Analysis of Bioremediation of Polycyclic Aromatic Hydrocarbons by Bacteria Introduction Principle Reagents Required and Their Role Procedure Observation Observation Table Precautions Exp. 6.7 H 2 S Assay to Screen Metal-Accumulating Bacteria
8 xiv Contents Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions References Further Readings
9
Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationMicrobial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture Taxonomy (three
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationFunctional vs Organismal views of Ecology. One organism: Population genetics Many organisms: Ecology No organisms: Ecosystems
Functional vs Organismal views of Ecology One organism: Population genetics Many organisms: Ecology No organisms: Ecosystems The trade-off between precision and relevance Another trade-off exists: resolution
More informationDirecte d Mutagenesis
Directe d Mutagenesis A Practical Approac h M. J. McPHERSON 1. Mutagenesis facilitated by the removal or introduction of unique restriction sites 1 P. Carte r 1. Introduction to site-directed mutagenesis
More informationTable of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationPrincipals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
More informationTable of contents. I. Flowchart of blunt end cloning of PCR products...2. II. Description...3. III. Kit Components...3
Table of contents I. Flowchart of blunt end cloning of PCR products...2 II. Description...3 III. Kit Components...3 IV. Reagents and Instruments Required...3 V. Storage...3 VI. About puc118 Hinc II/BAP...4
More informationProviding clear solutions to microbiological challenges TM. cgmp/iso CLIA. Polyphasic Microbial Identification & DNA Fingerprinting
Providing clear solutions to microbiological challenges TM Cert. No. 2254.01 Polyphasic Microbial Identification & DNA Fingerprinting Microbial Contamination Tracking & Trending cgmp/iso-17025-2005 CLIA
More informationBIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology
BIOTECHNOLOGY Subject Code: BT Course Structure Sections/Units Section A Section B Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6 Unit 7 Section C Section D Section E Topics Engineering Mathematics General
More informationBacteria in Semen. Sponsored by Bedford Research Foundation
Bacteria in Semen Background: The concept of detecting and identifying bacteria by ribosomal RNA gene sequences is about 15 years old. Although limited, the application of this approach to clinical specimens
More information2x PCR LongNova-RED PCR Master Mix
2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions
More informationNAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 4 FRIDAY October 15,
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationMightyAmp DNA Polymerase Ver.3
Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...
More informationChapter 8 Recombinant DNA Technology. 10/1/ MDufilho
Chapter 8 Recombinant DNA Technology 10/1/2017 1 MDufilho The Role of Recombinant DNA Technology in Biotechnology Biotechnology? Recombinant deoxyribonucleic acid (DNA) technology Intentionally modifying
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationBiotechnology and Energy Conservation. Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman
Biotechnology and Energy Conservation Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman 12 th Lecture Genetic Engineering The Aim: Students can
More informationPlasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only
Plasmid Midiprep Plus Purification Kit Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only 1 Description: The Plasmid Midiprep Plus Purification Kit provides simple
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationCHAPTER 08: RECOMBINANT DNA TECHNOLOGY Pearson Education, Inc.
CHAPTER 08: RECOMBINANT DNA TECHNOLOGY The Role of Recombinant DNA Technology in Biotechnology Biotechnology the use of microorganisms to make practical products Recombinant DNA technology Intentionally
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationHuman Cell-Free Protein Expression Maxi System
Cat. # 3285 For Research Use Human Cell-Free Protein Expression Maxi System Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage...
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationTaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0
Cat. # 9766 For Research Use TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage and shipping... 3 IV. Preparation
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationKOD -Plus- Mutagenesis Kit
Instruction manual KOD -Plus- Mutagenesis Kit 0811 F0936K KOD -Plus- Mutagenesis Kit SMK-101 20 reactions Store at -20 C Contents [1] Introduction [2] Flow chart [3] Components [4] Notes [5] Protocol 1.
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationThe Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo
The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant By Jenalyn Quevedo Biology 115L June 6, 2005 1 Abstract The blue-light photoreceptor cryptochrome (cry1)
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationSYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
More informationTaura Syndrome Virus (TSV) RT-PCR Kit
Revision No.: ZJ0001 Issue Date: Aug 28th, 2007 Taura Syndrome Virus (TSV) RT-PCR Kit Cat. No.: AR-0200-03 For use with Conventional PCR Instrument or Real time PCR Instrument User Manual For in vitro
More informationBiology 252 Nucleic Acid Methods
Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.
More informationAP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants
What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics
More information2 Gene Technologies in Our Lives
CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?
More informationSYBR Advantage qpcr Premix. User Manual
User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More information3'-Full RACE Core Set
Table of Contents Description... 2 Principle... 4 Preparation of RNA Sample... 5 Note... 5 Protocol 1. General Protocol... 6 2. Application example... 8 Also available from Takara PCR related products
More informationGateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationPrimeScript 1st strand cdna Synthesis Kit
Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...
More informationTotal Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices.
DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationBioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna
BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationBCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA.
Lab#2 BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA. Outlines: 1-Insertion of foreign gene to the plasmid. 2-Competent cell. 3-Transformation of bacterial cell.
More informationNOTES - CH 15 (and 14.3): DNA Technology ( Biotech )
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?
More informationBrilliant II SYBR Green QPCR Master Mix
Brilliant II SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600828 (single kit) #600831 (10-pack kit) Revision B.01 For In Vitro Use Only 600828-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Color Probe qpcr Master Mix #K0354 For 5000 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More informationEnterococcus faecium. genesig Standard Kit. groes heat shock protein. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Enterococcus faecium groes heat shock protein genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Enterococcus faecium E. faecium is a Gram-positive,
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationMOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien
Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationPrecisionX Multiplex grna Cloning Kit. Cat. # CAS9-GRNA-KIT. User Manual
PrecisionX Multiplex grna Cloning Kit Store at -20 C upon receipt A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in the Licensing
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationLaboratory #7 PCR PCR
1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis
More informationDiagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support
Diagnosis Sanger Interpreting and Troubleshooting Chromatograms GENEWIZ Technical Support DNAseq@genewiz.com Troubleshooting This troubleshooting guide is based on common issues seen from samples within
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual KOD -Plus- 1207 F0934K KOD -Plus- Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2.
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationqpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
More informationMolecular methods in medical microbiology: Current and future trends
Bangladesh Journal of Medical Science Vol.10 No.3 Jul 11 Editorial Introduction Molecular methods in medical microbiology: Current and future trends Microbial diseases are the principal causes of morbidity
More informationDescription...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...
QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual KOD -Plus- Neo 1109 F1066K KOD -Plus- Neo Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationTable of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents...
Table of content I. Description...2 II. Principle... 2 III. Kit Contents...4 IV. Storage...5 V. Features...5 VI. Note...5 VII. Protocol...6 VIII. Experiment Example...11 IX. Appendix...12 X. Guideline
More informationVector Linearization. igem TU/e 2015 Biomedical Engineering
igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector
More informationGNOME DNA Kit. One Call One Source A World of Biotechnology Reagents.
Instruction Manual GNOME DNA Kit Rapid 3-Step Procedure for Isolating Genomic DNA from Prokaryotes, Eukaryotes, or Tissues. Ideally Suited for Multiple RFLP Assays, PCR, and Cloning (Without Phenol/Chloroform).
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationAntisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression
Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia
More informationThermo Scientific DyNAmo Probe qpcr Kit
PRODUCT INFORMATION Thermo Scientific DyNAmo Probe qpcr Kit #F-450L Lot Store F at -20 C Expiry Date _ www.thermoscientific.com/onebio Rev. 2 f 2 COMPONENTS OF THE KIT Contents COMPONENTS OF THE KIT...
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationHope College MST Methods Summary
Hope College MST Methods Summary Sample collection: Stream samples were obtained in the field by hand using sterile (autoclaved) 1-liter polypropylene storage bottles. Collected samples were placed on
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationSYBR Premix DimerEraser (Perfect Real Time)
Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.
More informationLoop-mediated Isothermal Amplification (LAMP) as a diagnostic tool in detection of infectious diseases
Loop-mediated Isothermal Amplification (LAMP) as a diagnostic tool in detection of infectious diseases Dorota DRAPAŁA, Milena KORDALEWSKA Keywords: LAMP; DNA amplification; isothermal reaction Abstract:
More informationFosmidMAX DNA Purification Kit
Cat. No. FMAX046 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 204 10/2012 1 EPILIT204 Rev. A
More informationDyNAmo Flash SYBR Green qpcr Kit
DyNAmo Flash SYBR Green qpcr Kit Instruction manual F-415S F-415L 40 reactions (50 µl each) or 100 reactions (20 µl each) 200 reactions (50 µl each) or 500 reactions (20 µl each) Description... 2 Kit Components...
More informationSEQUENCING DNA. Jos. J. Schall Biology Department University of Vermont
SEQUENCING DNA Jos. J. Schall Biology Department University of Vermont SEQUENCING DNA Start with PCR product (your end result of a PCR). Remember, your template DNA in the PCR was extracted DNA that included
More informationDharmacon TM solutions for studying gene function
GE Healthcare Capabilities Overview Dharmacon TM solutions for studying gene function RNAi Gene Expression Gene Editing RNA Interference Our RNAi products encompass the most complete portfolio of innovative
More information