Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle..."

Transcription

1 Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result Table... 4 Troubleshootings... 4 Precautions... 4 Exp. 1.2 Preparation of Bacterial Lysates... 5 Introduction... 5 Principle... 6 Procedure... 7 Observation... 9 Result Table... 9 Troubleshootings... 9 Precautions... 9 Exp. 1.3 Isolation of Plasmids Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshootings Precautions Exp. 1.4 Isolation of Total RNA from Bacteria Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshootings Precautions Exp. 1.5 Amplification of 16S rrna Gene vii

2 viii Contents Introduction Principle Reagents Required and Their Role Procedure Observation Troubleshootings Precautions Exp. 1.6 To Perform Agarose Gel Electrophoresis Introduction Principle Reagents Required and Their Role Procedure Observation Troubleshootings Precautions Cloning and Transformation Exp. 2.1 Preparation of Competent Cells and Heat-Shock Transformation Introduction Principle Reagents Required and Their Role Procedure Observation Troubleshooting Precautions Exp. 2.2 Electroporation Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Exp. 2.3 Restriction Digestion and Ligation Introduction Principle Reagents Required and Their Role Procedure Observation Troubleshooting Precaution Exp. 2.4 Selection of a Suitable Vector System for Cloning Different Types of Cloning Vectors Criteria for Choosing a Suitable Cloning Vector Conclusion Exp. 2.5 Confirmation of Transformation by Blue-White Selection... 62

3 Contents ix Introduction Principle Reagents Required and Their Role IPTG Antibiotics pbluescript Transformation Reaction Product Procedure Observation Troubleshooting Precautions Exp. 2.6 Confirmation of Cloning by PCR Introduction Principle Reagents Required and Their Role Procedure Observation Troubleshooting Precautions Advanced Molecular Microbiology Techniques Exp Synthesis of cdna Introduction Principle Reagents Required and Their Role Procedure Observation Trouble-Shootings Precautions Exp Gene Expression Analysis by qrt-pcr Introduction Principle Reagents Required and Their Role Procedure Observation Trouble-Shootings Precautions Exp Gene Expression Analysis Using Reporter Gene Assay Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Precaution Trouble-Shootings... 89

4 x Contents Exp Semi-quantitative Gene Expression Analysis Introduction Principle Reagents Required and Their Role Procedure Observation Observation Table Trouble-Shootings Precautions Exp Northern Blotting Introduction Principle Reagents Required and Their Role Procedure Observation Trouble-Shootings Precautions Exp Isolation of Metagenomic DNA Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Trouble-Shootings Precautions Exp Plasmid Curing from Bacterial Cell Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Trouble-Shootings Precautions Exp Conjugation in Bacteria Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Trouble-Shootings Precaution Exp Transduction in Bacteria Introduction Principle Reagents Required and Their Role

5 Contents xi Procedure Observation Result Table Trouble-Shootings Precaution Molecular Microbial Diversity Exp. 4.1 Plasmid Profile Analysis Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Exp. 4.2 Amplified Ribosomal DNA Restriction Analysis to Study Bacterial Relatedness Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Exp. 4.3 Denaturing Gradient Gel Electrophoresis (DGGE) Analysis to Study Metagenomic Bacterial Diversity Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Exp. 4.4 Pulsed Field Gel Electrophoresis (PFGE) Analysis Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Exp. 4.5 Multiplex PCR for Rapid Characterization of Bacteria Introduction Principle

6 xii Contents Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Exp. 4.6 ERIC and REP-PCR Fingerprinting Techniques Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions Computer-Aided Study of Molecular Microbiology Exp. 5.1 Analysis of Gene Sequences Introduction Example of Tools for Sequence Analysis Principle Procedure Exp. 5.2 Submission of Sequences to GenBank Introduction Principle Procedure Exp. 5.3 Phylogenetic Trees Introduction Reading Trees Phylogenetic Tree Software Principle Procedure Exp. 5.4 Primer Design Introduction Primer Designing Using Software Guidelines for Primer Design Procedure for Using NETPRIMER Software for Primer Designing Application of Molecular Microbiology Exp. 6.1 Biofilm Formation in Glass Tubes Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting

7 Contents xiii Precaution Exp. 6.2 Screening of Biofilm Formation in Micro-Titre Plates Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precaution Exp. 6.3 Confocal Laser Scanning Microscopy for Biofilm Analysis Introduction Principle Reagents Required and Their Role Biofilm-Forming Bacteria Protocol Observation Observation Table Precautions Troubleshooting Exp. 6.4 Fluorescence Microscopy of Bacterial Biofilm and Image Analysis Introduction Principle Reagents Required and Their Role Protocol Observation Table Precautions Exp. 6.5 Screening for Biosurfactants Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Exp. 6.6 Spectrophotometric Analysis of Bioremediation of Polycyclic Aromatic Hydrocarbons by Bacteria Introduction Principle Reagents Required and Their Role Procedure Observation Observation Table Precautions Exp. 6.7 H 2 S Assay to Screen Metal-Accumulating Bacteria

8 xiv Contents Introduction Principle Reagents Required and Their Role Procedure Observation Result Table Troubleshooting Precautions References Further Readings

9

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B

Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture Taxonomy (three

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230 mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR

More information

Functional vs Organismal views of Ecology. One organism: Population genetics Many organisms: Ecology No organisms: Ecosystems

Functional vs Organismal views of Ecology. One organism: Population genetics Many organisms: Ecology No organisms: Ecosystems Functional vs Organismal views of Ecology One organism: Population genetics Many organisms: Ecology No organisms: Ecosystems The trade-off between precision and relevance Another trade-off exists: resolution

More information

Directe d Mutagenesis

Directe d Mutagenesis Directe d Mutagenesis A Practical Approac h M. J. McPHERSON 1. Mutagenesis facilitated by the removal or introduction of unique restriction sites 1 P. Carte r 1. Introduction to site-directed mutagenesis

More information

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection

More information

Table of contents. I. Flowchart of blunt end cloning of PCR products...2. II. Description...3. III. Kit Components...3

Table of contents. I. Flowchart of blunt end cloning of PCR products...2. II. Description...3. III. Kit Components...3 Table of contents I. Flowchart of blunt end cloning of PCR products...2 II. Description...3 III. Kit Components...3 IV. Reagents and Instruments Required...3 V. Storage...3 VI. About puc118 Hinc II/BAP...4

More information

Providing clear solutions to microbiological challenges TM. cgmp/iso CLIA. Polyphasic Microbial Identification & DNA Fingerprinting

Providing clear solutions to microbiological challenges TM. cgmp/iso CLIA. Polyphasic Microbial Identification & DNA Fingerprinting Providing clear solutions to microbiological challenges TM Cert. No. 2254.01 Polyphasic Microbial Identification & DNA Fingerprinting Microbial Contamination Tracking & Trending cgmp/iso-17025-2005 CLIA

More information

BIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology

BIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology BIOTECHNOLOGY Subject Code: BT Course Structure Sections/Units Section A Section B Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6 Unit 7 Section C Section D Section E Topics Engineering Mathematics General

More information

Bacteria in Semen. Sponsored by Bedford Research Foundation

Bacteria in Semen. Sponsored by Bedford Research Foundation Bacteria in Semen Background: The concept of detecting and identifying bacteria by ribosomal RNA gene sequences is about 15 years old. Although limited, the application of this approach to clinical specimens

More information

2x PCR LongNova-RED PCR Master Mix

2x PCR LongNova-RED PCR Master Mix 2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions

More information

NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside

NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 4 FRIDAY October 15,

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

MightyAmp DNA Polymerase Ver.3

MightyAmp DNA Polymerase Ver.3 Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...

More information

Chapter 8 Recombinant DNA Technology. 10/1/ MDufilho

Chapter 8 Recombinant DNA Technology. 10/1/ MDufilho Chapter 8 Recombinant DNA Technology 10/1/2017 1 MDufilho The Role of Recombinant DNA Technology in Biotechnology Biotechnology? Recombinant deoxyribonucleic acid (DNA) technology Intentionally modifying

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Biotechnology and Energy Conservation. Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman

Biotechnology and Energy Conservation. Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman Biotechnology and Energy Conservation Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman 12 th Lecture Genetic Engineering The Aim: Students can

More information

Plasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only

Plasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only Plasmid Midiprep Plus Purification Kit Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only 1 Description: The Plasmid Midiprep Plus Purification Kit provides simple

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

CHAPTER 08: RECOMBINANT DNA TECHNOLOGY Pearson Education, Inc.

CHAPTER 08: RECOMBINANT DNA TECHNOLOGY Pearson Education, Inc. CHAPTER 08: RECOMBINANT DNA TECHNOLOGY The Role of Recombinant DNA Technology in Biotechnology Biotechnology the use of microorganisms to make practical products Recombinant DNA technology Intentionally

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Human Cell-Free Protein Expression Maxi System

Human Cell-Free Protein Expression Maxi System Cat. # 3285 For Research Use Human Cell-Free Protein Expression Maxi System Product Manual Table of Contents I. Description... 3 II. Components... 4 III. Materials Required but not Provided... 5 IV. Storage...

More information

PureSpin DNA Clean Up Kit

PureSpin DNA Clean Up Kit PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage

More information

TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0

TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Cat. # 9766 For Research Use TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage and shipping... 3 IV. Preparation

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

KOD -Plus- Mutagenesis Kit

KOD -Plus- Mutagenesis Kit Instruction manual KOD -Plus- Mutagenesis Kit 0811 F0936K KOD -Plus- Mutagenesis Kit SMK-101 20 reactions Store at -20 C Contents [1] Introduction [2] Flow chart [3] Components [4] Notes [5] Protocol 1.

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo

The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant By Jenalyn Quevedo Biology 115L June 6, 2005 1 Abstract The blue-light photoreceptor cryptochrome (cry1)

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

SYBR Green Realtime PCR Master Mix

SYBR Green Realtime PCR Master Mix Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection

More information

Taura Syndrome Virus (TSV) RT-PCR Kit

Taura Syndrome Virus (TSV) RT-PCR Kit Revision No.: ZJ0001 Issue Date: Aug 28th, 2007 Taura Syndrome Virus (TSV) RT-PCR Kit Cat. No.: AR-0200-03 For use with Conventional PCR Instrument or Real time PCR Instrument User Manual For in vitro

More information

Biology 252 Nucleic Acid Methods

Biology 252 Nucleic Acid Methods Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.

More information

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics

More information

2 Gene Technologies in Our Lives

2 Gene Technologies in Our Lives CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?

More information

SYBR Advantage qpcr Premix. User Manual

SYBR Advantage qpcr Premix. User Manual User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

3'-Full RACE Core Set

3'-Full RACE Core Set Table of Contents Description... 2 Principle... 4 Preparation of RNA Sample... 5 Note... 5 Protocol 1. General Protocol... 6 2. Application example... 8 Also available from Takara PCR related products

More information

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

PrimeScript 1st strand cdna Synthesis Kit

PrimeScript 1st strand cdna Synthesis Kit Cat. # 6110A For Research Use PrimeScript 1st strand cdna Synthesis Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage...

More information

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices.

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices. DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007) QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.

More information

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA.

BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA. Lab#2 BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA. Outlines: 1-Insertion of foreign gene to the plasmid. 2-Competent cell. 3-Transformation of bacterial cell.

More information

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech )

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?

More information

Brilliant II SYBR Green QPCR Master Mix

Brilliant II SYBR Green QPCR Master Mix Brilliant II SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600828 (single kit) #600831 (10-pack kit) Revision B.01 For In Vitro Use Only 600828-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

PRODUCT INFORMATION Thermo Scientific Luminaris Color Probe qpcr Master Mix #K0354 For 5000 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases

More information

Enterococcus faecium. genesig Standard Kit. groes heat shock protein. 150 tests. Primerdesign Ltd. For general laboratory and research use only

Enterococcus faecium. genesig Standard Kit. groes heat shock protein. 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd Enterococcus faecium groes heat shock protein genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Enterococcus faecium E. faecium is a Gram-positive,

More information

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien

MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien Introduction MOLECULAR GENETICS: TRANSFORMATION AND CLONING adapted by Dr. D. L. Vogelien The field of molecular genetics has resulted in a number of practical applications that have been of tremendous

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

PrecisionX Multiplex grna Cloning Kit. Cat. # CAS9-GRNA-KIT. User Manual

PrecisionX Multiplex grna Cloning Kit. Cat. # CAS9-GRNA-KIT. User Manual PrecisionX Multiplex grna Cloning Kit Store at -20 C upon receipt A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in the Licensing

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

Laboratory #7 PCR PCR

Laboratory #7 PCR PCR 1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis

More information

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support Diagnosis Sanger Interpreting and Troubleshooting Chromatograms GENEWIZ Technical Support DNAseq@genewiz.com Troubleshooting This troubleshooting guide is based on common issues seen from samples within

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual KOD -Plus- 1207 F0934K KOD -Plus- Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2.

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)

More information

Molecular methods in medical microbiology: Current and future trends

Molecular methods in medical microbiology: Current and future trends Bangladesh Journal of Medical Science Vol.10 No.3 Jul 11 Editorial Introduction Molecular methods in medical microbiology: Current and future trends Microbial diseases are the principal causes of morbidity

More information

Description...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...

Description...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting... QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual KOD -Plus- Neo 1109 F1066K KOD -Plus- Neo Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents...

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents... Table of content I. Description...2 II. Principle... 2 III. Kit Contents...4 IV. Storage...5 V. Features...5 VI. Note...5 VII. Protocol...6 VIII. Experiment Example...11 IX. Appendix...12 X. Guideline

More information

Vector Linearization. igem TU/e 2015 Biomedical Engineering

Vector Linearization. igem TU/e 2015 Biomedical Engineering igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector

More information

GNOME DNA Kit. One Call One Source A World of Biotechnology Reagents.

GNOME DNA Kit. One Call One Source A World of Biotechnology Reagents. Instruction Manual GNOME DNA Kit Rapid 3-Step Procedure for Isolating Genomic DNA from Prokaryotes, Eukaryotes, or Tissues. Ideally Suited for Multiple RFLP Assays, PCR, and Cloning (Without Phenol/Chloroform).

More information

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping

More information

Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression

Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia

More information

Thermo Scientific DyNAmo Probe qpcr Kit

Thermo Scientific DyNAmo Probe qpcr Kit PRODUCT INFORMATION Thermo Scientific DyNAmo Probe qpcr Kit #F-450L Lot Store F at -20 C Expiry Date _ www.thermoscientific.com/onebio Rev. 2 f 2 COMPONENTS OF THE KIT Contents COMPONENTS OF THE KIT...

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Hope College MST Methods Summary

Hope College MST Methods Summary Hope College MST Methods Summary Sample collection: Stream samples were obtained in the field by hand using sterile (autoclaved) 1-liter polypropylene storage bottles. Collected samples were placed on

More information

Lecture 8: Sequencing and SNP. Sept 15, 2006

Lecture 8: Sequencing and SNP. Sept 15, 2006 Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics

More information

SYBR Premix DimerEraser (Perfect Real Time)

SYBR Premix DimerEraser (Perfect Real Time) Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.

More information

Loop-mediated Isothermal Amplification (LAMP) as a diagnostic tool in detection of infectious diseases

Loop-mediated Isothermal Amplification (LAMP) as a diagnostic tool in detection of infectious diseases Loop-mediated Isothermal Amplification (LAMP) as a diagnostic tool in detection of infectious diseases Dorota DRAPAŁA, Milena KORDALEWSKA Keywords: LAMP; DNA amplification; isothermal reaction Abstract:

More information

FosmidMAX DNA Purification Kit

FosmidMAX DNA Purification Kit Cat. No. FMAX046 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 204 10/2012 1 EPILIT204 Rev. A

More information

DyNAmo Flash SYBR Green qpcr Kit

DyNAmo Flash SYBR Green qpcr Kit DyNAmo Flash SYBR Green qpcr Kit Instruction manual F-415S F-415L 40 reactions (50 µl each) or 100 reactions (20 µl each) 200 reactions (50 µl each) or 500 reactions (20 µl each) Description... 2 Kit Components...

More information

SEQUENCING DNA. Jos. J. Schall Biology Department University of Vermont

SEQUENCING DNA. Jos. J. Schall Biology Department University of Vermont SEQUENCING DNA Jos. J. Schall Biology Department University of Vermont SEQUENCING DNA Start with PCR product (your end result of a PCR). Remember, your template DNA in the PCR was extracted DNA that included

More information

Dharmacon TM solutions for studying gene function

Dharmacon TM solutions for studying gene function GE Healthcare Capabilities Overview Dharmacon TM solutions for studying gene function RNAi Gene Expression Gene Editing RNA Interference Our RNAi products encompass the most complete portfolio of innovative

More information