LabChip 90 System with DataViewer Software
|
|
- Franklin Greene
- 6 years ago
- Views:
Transcription
1 Revolutionizing DNA and Protein Gel Electrophoresis LabChip 90 System with DataViewer Software The Proven Alternative to Slab Gels. The massive flow of information emerging from today s genomic and proteomic research has created an urgent need for more effective ways to generate and analyze data. DNA and protein analysis has traditionally been performed using slab gel electrophoresis. However, agarose slab gel and SDS-PAGE methodologies are time-consuming, labor-intensive and prone to variability. The LabChip 90 System offers researchers an automated alternative by streamlining the multiple, manual steps of slab gel electrophoresis, while also providing the throughput and data quality essential for life science laboratories today.
2 LabChip Technology Advantages of LabChip Technology Automated Sampling from 96- and 384-Well Plates Transfer plates from a thermal cycler directly into the LabChip 90 System, no sample prep or transfer needed Less Hands-on Time Reduces the manual labor associated with gels and frees up valuable resources Superior Data Quality More precise, accurate and reproducible data than gels Faster Time to Result Quantitative sizing and concentration data are automatically reported as each sample is analyzed Direct Generation of Digital Data Eliminates the need for photodocumentation Versatility DNA and protein analysis can be performed using the same system Marker Well Higher Sample Throughput Complete analysis for hundreds of samples in just a few hours; no further processing required LabChip Electrophoresis Vacuum Well Sipper DNA Chip. The blue wells are filled with a mixture of sieving polymer and fluorescent dye. The green well contains internal DNA markers. Sampling. Vacuum is applied. This pulls the sample onto the chip through the sipper, and also draws the internal DNA markers to mix with the sample. How Does it Work? LabChip electrophoresis is performed on a small, microfluidic chip. Prior to DNA or protein analysis, reagents are loaded into the individual wells of the chip. These wells are connected to small plates of quartz etched with tiny microchannels about the size of a human hair. When the chip is loaded into the LabChip 90 System, its wells interface with platinum electrodes that provide voltage and current control. The system robot moves the microtiter plate wells directly under the chip s capillary sipper, and approximately 150 nl of sample is aspirated onto the chip. Individual sample analytes are separated electrophoretically and the bands are detected via laserinduced fluorescence. Sizing and concentration for each band are determined using both a ladder and internal markers. Because the sipper is rinsed between samples, cross-contamination or carryover is eliminated. Markers flow toward the Vacuum Well Detection Point Separation Channel Injection Intersection Injection. Voltage drives the samplemarker mix across the injection intersection where a pinch current is applied to inject a small plug into the separation channel. Separation. Voltage is applied to perform electrophoresis in the separation channel. The individual DNA fragments are stained and then separated based on size. Separated Bands Let Us Make Your LabChip 90 Data Review and Reporting Easier DataViewer makes it so easy to compare data from multiple LabChip 90 sample plates. Compare wells within a plate, across multiple plates, even wells from 96 well plates against 384 well plates! Developed with ease of use in mind, DataViewer provides multiple analytical functions, selectable at the click of a tab. Data can be view as a Virtual Gel, Graph, or Data Summary Table. The DataViewer software is the key to building digital summaries of experimental results, which can be exported and captured in reports, or shared with colleagues.
3 DataViewer DNA and Protein Analysis Software DataViewer allows users to compare data from several different sample plates. Users can compare wells within a plate, across multiple plates, even wells from 96 well plates against 384 well plates! As with the current HT software, data can be displayed in Virtual Gel, Graph, or Data Summary Table formats. Users can either manually select the wells of interest (wells, rows, columns, plates) or use an automated selection function to select wells by data result (size, peak height, concentration, etc.) Data screening templates can be stored for use on subsequent analyses. Data 'collections' which are produced by a particular analysis can be saved and exported for future reference, or for sharing with colleagues. Import LabChip 90 Data Files With Ease Use Filter Functions to Analyze Data The DataViewer Filter Function allows for results to be automatically derived by any of seven variables. Filters can be combined by easily selected logic operations. Filters can be named and stored for reuse as templates. Each plate well with at least one data peak that corresponds to the filter set is highlighted for easy observation, and the data are displayed in the Gel, Graph, and Table tabs. Open multiple data files and compare results in either a traditional gel view, or use electropherograms. Your choice of data display is only a click away. DataViewer operates on standard CLA files generated by LabChip HT. Export Graphics or Tables Export functions are built in to make it easy to capture the digitized data in reports, or share with colleagues. Peak Tables export to a CSV format text file. Text files are a convenient means to pull data into a wide variety of lab applications. DataViewer is ideal for: Comparing multiple LabChip 90 data files Filtering LabChip 90 data by variable and value range Exporting formatted results tables to reports or LIMS
4 LabChip HT Software Quantitative Results in Seconds LabChip HT Software is a far more precise, accurate and reliable method of generating data than gel scanning and photodocumentation. The LabChip 90 System automatically calculates the size and concentration of each protein or DNA fragment and provides digital results. Data are generated in just seconds per sample and are reported real-time as each sample is processed. Results are displayed in a tabular format, an electropherogram view and in a gel-like image. The virtual gel image resembles traditional slab gel results and automatically aligns lanes to make visual comparison easier Multiple gel views allow you to see a row of samples or the entire 96- or 384-well plate Start a run anywhere on the plate or select specific subsections of the plate for analysis Flag up to ten expected proteins or DNA fragments per sample Data overlay capabilities make it easy to compare samples within a plate Gel images, electropherograms and results tables can be copied and pasted into reports and presentations Switch between DNA and protein analysis easily by selecting one of several preconfigured assays Automatically export tabulated results or raw data in text format Import sample information prior to starting analysis Plate bar codes can be scanned and stored with the data file
5 DNA Analysis RFLP DNA inserts were amplified, restriction digested and analyzed using the LabChip DNA assay and a 4% agarose slab gel. The high quality of data generated by the LabChip 90 System is well suited for automated DNA fingerprinting assays. Protein Analysis Crude Lysates For comparative purposes, crude lysate samples were analyzed using the LabChip protein assay and using an 8-16% SDS-PAGE gradient gel. As shown in the virtual gel image, the LabChip 90 System data are highly reproducible and the bands of interest are better resolved kda 48 kda Top - LabChip 90 System data. The green bands in the LabChip 90 System virtual gel image are upper and lower internal markers. Bottom - 4% agarose gel image. Samples, LabChip 90 System data and agarose gel image provided by BD Pharmingen/Dyax Corporation, San Diego, CA. Left LabChip 90 System virtual gel image. Expressed protein size reported at 47.7 kda. Right - SDS-PAGE gel image. Expressed protein at 48 kda. Samples, LabChip 90 System and SDS-PAGE data provided by Structural GenomiX, San Diego, CA. PCR Products PCR fragments were analyzed on the LabChip 90 System and on different concentrations of agarose gels. The LabChip 90 System easily resolved the 140 bp and 210 bp fragments as well as the 400 bp and 420 bp fragment pair. The slab gels were not able to achieve this resolution. Antibodies Alternating samples of reduced and non-reduced IgG antibody were analyzed. The data quality of the LabChip 90 System makes it ideal for QC monitoring of antibody production. + Left LabChip 90 System PCR fragment data. The virtual gel image also displays the DNA assay ladder that is sipped prior to each row of samples. Right 0.8% and 2% agarose gel images: lane 1 LabChip DNA assay ladder, lane 2 PCR fragments, lane 3 - PhiX174/ Hinf1. The red band on the virtual gel image is the internal marker and the dark blue band is an SDS peak. Sizing and concentration data for each protein can be viewed by rolling the cursor over the band of interest.
6 LabChip 90 System Assays Precision DNA and Protein Analysis Because sample loading, injection, and separation are precisely controlled on the chip, LabChip electrophoresis provides highly accurate analytical data. Lane-to-lane and plate-to-plate results therefore are extremely reproducible. LabChip assays cover a wide variety of comparable gel concentrations, so a much broader sample sizing range can be achieved using just one DNA or protein assay. Fragments close in size that are often presented as broad bands on slab gels are distinctly resolved using the LabChip assays. Low concentrations of DNA or protein in the presence of other, more concentrated species, are easily detected. Since only nanoliters of sample are used, the remaining sample can be used for other experiments. The LabChip 90 System can analyze up to two DNA samples or one protein sample in about a minute. LabChip kits come with one chip and all the reagents needed to perform analysis of either protein or DNA samples.
7 Specifications LabChip 90 System Plate Formats 96- and 384-well Dimensions 147 cm (58 in) H x 57 cm (22.5 in) W x 61 cm (24 in) D Excitation/Emission Wavelengths 635 and 700 nm Weight 136 kg (300 lbs) Power requirements V AC, 47/63 Hz Power consumption 360 VA (360 W) Operating humidity range 5 85% relative, noncondensing Operating temperature range C ( F) DataViewer Analysis Software System Requirements The minimum PC requirements are as follows: Pentium II processor 400 MHz or higher Windows NT Operating System, Service Service Pack 6 or Windows 2000 Service Pack Operating System 128 MB RAM 500 MB free hard disk space CD ROM drive SVGA display monitor, 1024 x 768, 256 colors IE 5.5 or later Network Interface Card Ordering Information LabChip 90 with LabChip HT and DataViewer Software DataViewer Analysis Software Bar Code Scanner Option HT DNA 12K LabChip Kit HT DNA 5K SE30 LabChip Kit HT DNA 5K SE55 LabChip Kit HT Protein 200 LabChip Kit
8 68 Elm Street Hopkinton, MA Tel: Caliper Life Sciences, Inc. All rights reserved. Caliper, the Caliper logo and DataViewer are tradenames and/or trademarks of Caliper Life Sciences, Inc. LC90-BR-01 Jul07
Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008
Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More informationComparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques
Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Application Note Author Deborah Vitale Agilent Technologies, Inc. Palo Alto, CA, USA Abstract This Application
More informationLabChip GXII: Antibody Analysis
WHITE PAPER LabChip GXII: Antibody Analysis Antibody Analysis using microfluidic technology in high throughput Quality by Design Experiments Abstract Current initiatives in Process Analytical Technology
More informationOne platform, endless possibilities
One platform, endless possibilities The Agilent 2100 Bioanalyzer is an indispensable tool for food chemists and biologists. Now you can have a multi-purpose platform that streamlines your workflows from
More informationHiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
More informationExperion Automated Electrophoresis System
Experion Automated Electrophoresis System Focus on the results, not the method. Experion Automated Electrophoresis System Experience Meets Innovation The Experion automated electrophoresis system is a
More informationCRISPR/Cas9 Gene Editing
CISP/Cas9 Gene Editing Identify Single-Cell Mutations and Determine Mutation Frequency Mutation analysis by capillary electrophoresis provides significant benefits over slab gel methods. The Fragment Analyzer
More informationNovoCyte Flow Cytometer
NovoCyte Flow Cytometer The Flow Cytometer for Everyone 2 Experience the NovoCyte Advantage Focus on advancing your research. Let the flow cytometer do the rest. NovoCyte Flow Cytometer High Performance
More informationPCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System
PCR SYSTEMS a new era in high-productivity qpcr Applied Biosystems ViiA 7 Real-Time PCR System a new era in high-productivity qpcr The ViiA 7 Real-Time PCR System delivers the proven reliability, sensitivity,
More informationGENECHECKER Ultra-Fast PCR System
"Gives You a PCR Result in 11 Minutes." GENECHECKER Ultra-Fast PCR System PCR Innovation Starts Here! Do it Anywhere. Make it Faster. See the Result. Patented Chip Based Design Provides Extremely Rapid
More informationAccessing the E-Gel 96 System via the Quad-Z 215 with Disposable Tips
Accessing the E-Gel 96 System via the Quad-Z 215 with Disposable Tips Application Note 211 Joan Stevens, PhD (Gilson, Inc.) Introduction The E-Gel 96 gels are pre-cast, robot-compatible agarose gels that
More informationHT RNA Pico Sensitivity LabChip Kit LabChip GX/GXII User Guide
Contents SPECIFICATIONS... 2 SAMPLE CONDITIONS... 2 KIT CONTENTS... 3 SAFETY WARNINGS AND PRECAUTIONS... 4 PREPARATION PROCEDURES... 5 ADDITIONAL ITEMS REQUIRED... 5 PREPARING LADDER ALIQUOTS... 5 PREPARING
More informationminipcr TM Genes in Space Food Safety Lab: Mars Colony at Risk!
minipcr TM Genes in Space Food Safety Lab: Mars Colony at Risk! An E. coli outbreak affects astronaut food aboard the International Space Station. DNA samples from two food racks are analyzed to determine
More informationHT RNA LabChip Kit, Version 2 LabChip GX/GXII User Guide
Contents Specifications 2 Sample Conditions 2 Kit Contents 2 Preparation Procedure 4 Additional Items Required 4 Preparing the Gel-Dye Solution 4 Preparing the RNA Samples and Ladder 4 Preparing the Buffer
More informationThermo Scientific SkanIt software for microplate readers. Simplified data acquisition and analysis
Thermo Scientific SkanIt software for microplate readers Simplified data acquisition and analysis The Thermo Scientific SkanIt software is a powerful multi-instrument microplate reader software that provides
More informationqpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
More informationSeCore SBT Sequence Based Typing
MOLECULAR TYPING Product Brochure SeCore SBT Sequence Based Typing Key Benefits SeCore HLA typing kits combine the accuracy of bidirectional sequencing and the power and flexibility of our improved sequence
More informationSeeplex LabChip Kit LabChip Dx User Guide
Contents SPECIFICATIONS.......2 SAMPLE CONDITIONS.........2 KIT CONTENTS.......2 SAFETY WARNINGS AND PRECAUTIONS... 4 ADDITIONAL ITEMS REQUIRED... 4 INSTRUMENTS... 4 CONSUMABLES... 4 REAGENTS... 4 PREPARATION
More informationExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system!
ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! ExiProgen - Automated Protein Synthesis/Purification System ExiProgen
More informationImplementation of Automated Sample Quality Control in Whole Exome Sequencing
Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor
More informationICP Expert software. Technical Overview. Introduction
ICP Expert software Technical Overview Introduction The Agilent 5110 ICP-OES provides fast sample analysis, using less gas, without compromising on performance for tough samples. It has been designed for
More informationelectrophoresis tech Performance Comparison of the Experion Automated Electrophoresis System and SDS-PAGE for Protein Analysis
electrophoresis tech note 5299 Performance Comparison of the Experion Automated Electrophoresis System and for Protein Analysis Karen Zhu, Marie Nguyen, William Strong, and Christina Whitman-Guliaev, Bio-Rad
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationUser Guide BLF-7510 BUF High-Pass TM DNA Size Selection. Sage Science Part Nos:
TM User Guide High-Pass TM DNA Size Selection Sage Science Part Nos: BLF-7510 BUF-7510 Sage Science, Inc. Suite 2400 500 Cummings Center Beverly, MA 01915 Using this Guide This guide is meant to provide
More informationIgG Purity/Heterogeneity and SDS-MW Assays with High- Speed Separation Method and High Throughput Tray Setup
IgG Purity/Heterogeneity and SDS-MW Assays with High- Speed Separation Method and High Throughput Tray Setup High Throughput Methods to Maximize the Use of the PA 800 Plus system Jose-Luis Gallegos-Perez
More informationAll-In-One Precast Agarose Gel Electrophoresis Kit (2x9-Well)
All-In-One Precast Agarose Gel Electrophoresis Kit (2x9-Well) Technical Manual No. 0282 Version 03242009 I Description... 1 II Key Features.. 1 III Safety Concerns... 2 IV Kit Contents.... 2 V Storage.....
More informationRestriction Enzymes and Lambda DNA
Restriction Enzymes and Lambda DNA Computer 6B Restriction enzymes have become an indispensable tool of molecular researchers over the past fifty years. This unique group of enzymes function as molecular
More informationLAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA
LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA I. Objectives The purpose of today s lab is to learn how to set up and run an agarose gel, separate DNA fragments on the gel, and
More informationExiProgen Protein Synthesis RNA/DNA Prep System
Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! - Automated Protein Synthesis/Purification System Bioneer's is the world's
More informationInnovations To Meet Your Needs
Innovations To Meet Your Needs Cooled CCD Camera 1340 x 1037 pixel resolution for greatest image quality 12-bit precision provides 3 orders of linear dynamic range Windows and Power Macintosh Software
More informationExperion RNA StdSens Analysis Kit Instruction Manual
Experion RNA StdSens Analysis Kit Instruction Manual For Technical Service Call Your Local Bio-Rad Office or in the U.S. Call 1-800 4BIORAD (1-800-424-6723) Table of Contents Section 1 Introduction...1
More informationAutomated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep
Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION &
More informationGeneTools the Essential Software For Accurate DNA/RNA Gel and Blot Analysis
Technical Note 27 GeneTools the Essential Software For Accurate DNA/RNA Gel and Blot Analysis Introduction Capturing an image of a DNA/RNA gel or blot with an image analysis system is only the start of
More informationPerformance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer
Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Technical Note 10 Measured conc. [ng/µl] 1 Y intercept = 0.09 r 2 = 0.993 0.1 0.1 1 10 Reference concentration
More informationMagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study
MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions
More informationApplications Note 161 March 2010
Applications Note 161 March 2010 High throughput DNA isolation using the MACHEREY-NAGEL NucleoSpin 96 Blood kit on the epmotion 5075 from Eppendorf Henning Risch 1, Thomas Zinn 1, Daniel Wehrhahn 2 1 MACHEREY-NAGEL
More informationSPRIworks Systems. Push button. Walk away. Fully automated library construction systems with built-in size selection and cleanup BR-15981B
SPRIworks Systems Fully automated library construction systems with built-in size selection and cleanup Push button. Walk away. BR-15981B SPRIworks Technology Fully automated fragment library construction
More informationLesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels
Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels What Are You Looking At? Before you analyze your PCR products, let s take a look at the target sequence being explored.
More informationCan I reduce manual data entry by using an automated information capture system?
Modules Produced by Canon Communications - October 02 TELEform ELITE TELEform Elite includes the following modules: Form Designer Reader/Scan Station Verifier TELEform ENTERPRISE TELEform Enterprise includes
More informationElectrophoresis 101 Student Worksheet
1 Electrophoresis 101 Student Worksheet Experiment Objective To develop an understanding of electrophoresis principles. To analyze results and to calculate the sizes of unknown charged molecules from given
More informationNRAS Codon 61 Mutation Analysis Reagents
NRAS Codon 61 Mutation Analysis Reagents User Manual V1.0 Cat No. GP19 32 reactions 1 CONTENTS Introduction 4 Overview of Mutector TM Assay 5 Materials Provided 6 Materials Required 7 Equipment Required
More informationInstrument specifications Technology Software Host interfaces Printer interfaces Data Station Physical dimensions Weight Certifications
The evolution of PCR Introducing the COBAS TaqMan 48 Analyzer At the forefront of PCR evolution Since Roche acquired the rights to PCR in 1991, its mission has been to fully realize the potential of this
More informationNucleic Acid Electrophoresis APPLICATION GUIDE
AGAROSE BUFFERS LADDERS EQUIPMENT Nucleic Acid Electrophoresis APPLICATION GUIDE Reagents: Agarose Thermo Scientific and Fisher Scientific products deliver an end-to-end solution that can meet your most
More informationFULLY AUTOMATED ENZYME IMMUNOASSAY ANALYZER AUTOMATED IMMUNOASSAY ANALYZER. Advanced Immunoassay Testing TOSOH BIOSCIENCE
FULLY AUTOMATED ENZYME IMMUNOASSAY ANALYZER AUTOMATED IMMUNOASSAY ANALYZER Advanced Immunoassay Testing TOSOH BIOSCIENCE Soar Through Your Immunoassay Testing Challenges Throughput of 200 results per hour
More informationTruSeq ChIP Sample Preparation
FOR RESEARCH USE ONLY Date: Illumina Kit Description: NOTE Unless familiar with the protocol in the latest version of the TruSeq ChIP Sample Preparation Guide (part # 15023092), new or less experienced
More informationDNA and RNA Clean-up Guide
DNA and RNA Clean-up Guide DNA and RNA clean-up products from MACHEREY-NAGEL MN guide to DNA and RNA clean-up products Don t limit your downstream applications NucleoSpin NucleoSEQ NucleoTrap NucleoFast
More informationEZ-Vision DNA Dye as Loading Buffer
EZ-Vision DNA Dye as Loading Buffer Code Description Size N472-SAMPLE EZ-VIsion One, DNA Dye as Loading Buffer, 6X 0.3 ml N650-SAMPLE EZ-Vision Two, DNA Dye as Loading Buffer, 6X 0.3 ml N313-SAMPLE EZ-Vision
More informationSNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM
SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400
More informationFeaturing Analyst software under Windows NT for enhanced performance and ease of use. API 150EX. LC/MS System
Featuring Analyst software under Windows NT for enhanced performance and ease of use. API 15EX LC/MS System compact, rugged, The API 15EX LC/MS System is the most rugged and reliable single quadrupole
More informationNRAS Mutation Analysis Reagents (Codons 12 and 13)
NRAS Mutation Analysis Reagents (Codons 12 and 13) User Manual V1.1 Cat No. GP18 32 reactions 1 CONTENTS Introduction 4 Overview of Mutector TM Assay 5 Materials Provided 6 Materials Required 7 Equipment
More informationAdvanced Immunoassay Testing
Symmetry in Diagnostics FULLY AUTOMATED ENZYME IMMUNOASSAY ANALYZER Advanced Immunoassay Testing TOSOH BIOSCIENCE www.tosohbioscience.us High Powered and Flexible Immunoassay Testing Throughput of 200
More informationEvaluating the Agilent 4200 TapeStation System for High Throughput Sequencing Quality Control
Evaluating the Agilent TapeStation System for High Throughput Sequencing Quality Control Application Note Nucleic Acid Analysis Authors Elisa Viering, Laura-Jane Behl, Stefan Pinkert, and Stephan Wolf
More informationRFLP ANALYSIS OF DNA LABORATORY
RFLP ANALYSIS OF DNA LABORATORY BIG PICTURE You will be working with an essential research method widely used in genetics, conservation biology, and forensics. The lab is divided into three sections. Part
More informationApplied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems
PRODUCT BROCHURE Real-Time PCR Systems Applied Biosystems 7500 Fast, 7500 and 7300 Real-Time PCR Systems Real Fast. Real Versatile. Real Value. Real choices from the leader in real-time PCR. The latest
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationPowerPlex 5-Dye Matrix Standards, 310
TECHNICAL BULLETIN PowerPlex 5-Dye Matrix Standards, 310 Instructions for Use of Product DG4600 Revised 3/16 TBD023 PowerPlex 5-Dye Matrix Standards, 310 All technical literature is available at: www.promega.com/protocols/
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationAgilent 2100 Bioanalyzer System
Agilent 2100 Bioanalyzer System Maintenance and Troubleshooting Guide Agilent Technologies Notices Agilent Technologies, Inc. 2011-2016, 2017 No part of this manual may be reproduced in any form or by
More informationAzure Biosystems Western Blotting Workflow
Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for
More informationPowerPlex Matrix Standards, 3100/3130
TECHNICAL BULLETIN PowerPlex Matrix Standards, 3100/3130 Instruc ons for use of Product DG4650 Note: The PowerPlex Matrix Standards, 3100/3130, can be used to perform spectral calibra on on the Applied
More informationSee what s really in your sample
See what s really in your sample Dye-free quantification of the biomolecules that you desire and the contaminants that you fear From the nucleic acid experts! Sample to Insight With QIAxpert Tell DNA from
More informationJune QIAxcel RNA Handbook. For automated quantitative and qualitative RNA analysis using the QIAxcel system. Sample & Assay Technologies
June 2015 QIAxcel RNA Handbook For automated quantitative and qualitative RNA analysis using the QIAxcel system Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider
More informationZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053
INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples
More informationRapid, High-Resolution Microfluidic Separations for Nucleic Acid Analysis
Rapid, High-Resolution Microfluidic Separations for Nucleic Acid Analysis Rapid, High-Resolution Microfluidic Separations for Nucleic Acid Analysis Broadcast Date: Wednesday, October 10, 2012 Time: 11
More informationHLA Typing Using Olerup SSP Kits and the QIAxcel Advanced System
HLA Typing Using Olerup SSP Kits and the QIAxcel Advanced System For analysis and typing of PCR products from different HLA loci using the QIAxcel Advanced and the Helmberg-SCORE software Introduction
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationIBM WebSphere Catalog Architect
Helping boost your e-commerce business IBM WebSphere Catalog Architect Highlights Simplifies creation and management of electronic catalogs Increases productivity during catalog design, construction and
More informationLambda (λ) DNA Restriction Digest and Electrophoresis Lab
Lambda (λ) DNA Restriction Digest and Electrophoresis Lab Procedure DAY ONE: restriction digestion Today we will be exposing the lambda DNA to restriction enzymes. For background knowledge, make sure you
More informationCompleting the performance picture.
Completing the performance picture. AU5800 Clinical Chemistry Systems Blood Banking Centrifugation Chemistry Flow Cytometry Hematology Hemostasis Immunoassay Information Systems Lab Automation Molecular
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationAMPURE PCR PURIFICATION PAGE 1 OF 7
PCR PURIFICATION PAGE 1 OF 7 Please refer to http://www.agencourt.com/technical/reagent_information/ for updated protocols. AMPure is a registered trademark of Agencourt Bioscience and is for laboratory
More informationAutomated genomic DNA purification of marine organisms on the epmotion 5075 VAC from Eppendorf
APPLICATION NOTE No. 281 I April 2013 Automated genomic DNA purification of marine organisms on the epmotion 5075 VAC from Eppendorf Cécile Ribout 1, Christophe Carpentieri 2 1 UMR IMBE, SCBM, Marseille,
More informationBIOLOGY 163 LABORATORY. RESTRICTION MAPPING OF PLASMID DNA (Revised Fall 2017)
BIOLOGY 163 LABORATORY RESTRICTION MAPPING OF PLASMID DNA (Revised Fall 2017) Physical mapping of genomes is an important part of modern molecular genetics. As it's name implies, physical mapping seeks
More informationAP Biology. Investigation 9: Biotechnology:Restriction Enzyme Analysis of DNA. Investigation 9: Restriction Enzyme Analysis
AP Biology Investigation 9: Biotechnology:Restriction Enzyme Analysis of DNA In this investigation, you will learn how to use restriction Learning Objectives enzymes and gel electrophoresis to create genetic
More information2. Relay characteristics of proteins and protein electrophoresis / fractionation.
UNIT: Proteins 15prot_elec.wpd Task Electrophoresis Objectives Upon completion of this exercise, the student will be able to: 1. Review electrophoresis information as presented in class. 2. Relay characteristics
More informationChapter 10 Analytical Biotechnology and the Human Genome
Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationPERFORMANCE MADE EASY REAL-TIME PCR
PERFORMANCE MADE EASY REAL-TIME PCR The MyGo Pro real-time PCR instrument provides unmatched performance in a convenient format. Novel Full Spectrum Optics deliver 120 optical channels of fluorescence
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationThermo Scientific EASY-nLC 1200 System. Leading in simplicity. and performance
Thermo Scientific EASY-nLC 1200 System Leading in simplicity and performance Peak performance made EASY Effortless ultra high performance for everybody A straightforward LC-MS solution Optimized and integrated
More informationProcedure for GeneMapper ID-X for Casework
Procedure for GeneMapper ID-X for Casework 1.0 Purpose-This procedure specifies the steps for performing analysis on DNA samples amplified with AmpFlSTR Identifiler Plus using the GeneMapper ID-X (GMID-X)
More informationAgilent VEE Pro 9.3. Data Sheet
Agilent VEE Pro 9.3 Data Sheet Agilent VEE 9.3 Features New sample programs for Agilent 33500 series function/arbitrary waveform generator, 34411A digital multimeter and DSO/MSO oscilloscopes. General
More informationSanger Sequencing: Troubleshooting Guide
If you need help analysing your Sanger sequencing output, this guide can help. CONTENTS 1 Introduction... 2 2 Sequence Data Evaluation... 2 3 Troubleshooting... 4 3.1 Reviewing the Sequence... 4 3.1.1
More informationBenchSmart 96. Semi-automated Pipetting Higher Accuracy, Greater Flexibility
BenchSmart 96 Semi-automated Pipetting Higher Accuracy, Greater Flexibility For scientists looking to maximize their data quality and research productivity, a new semiautomated approach to 96-well pipetting
More informationRelative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA)
The LightCycler 480 System Short Guide Topic: Purpose: Assay Principle: Detection Format: Result: Relative Quantification (Mono-Color) Describes how to set up and perform mono-color Relative Quantification
More informationAgarose Gel Electrophoresis Lab
Agarose Gel Electrophoresis ACTIVITY AT A GLANCE Goal: This lab will determine the presence or absence of PCR products and uantify the size (length of the DNA molecule) of the products. Learning Objectives:
More informationINNOVATION TO MEET YOUR NEEDS
INNOVATION TO MEET YOUR NEEDS High Throughput The throughput is optimized splitting the pipetting phases of Reagents and Samples into different cycles. The innovative technical solutions adopted by LIAISON
More informationTips DNA Sequencing (Revision Date: 09 July 2007)
Tips DNA Sequencing (Revision Date: 09 July 2007) 1. PCR product: clone, or directly sequence? 2. How do I clean DNA template for sequencing? 3. How much DNA should I use in a sequencing reaction? 4. Why
More informationquantitate host cell DNA with high sensitivity and throughput resdnaseq Host Cell DNA Quantitation Systems: CHO, E.
quantitate host cell DNA with high sensitivity and throughput resdnaseq Host Cell DNA Quantitation Systems: CHO, E. coli, Vero, NS0 Precision counts Integrated real-time qpcr systems for quantitation of
More informationHiPer Gel Extraction Teaching Kit (Column Based)
HiPer Gel Extraction Teaching Kit (Column Based) Product Code: HTBM010 Number of experiments that can be performed: 10 Duration of Experiment Agarose Gel Electrophoresis: 1 hour Protocol: 1 hour Agarose
More informationDNA RESTRICTION ANALYSIS
DNA RESTRICTION ANALYSIS In this experiment, DNA from the bacteriophage Lambda (48,502 base pairs in length) is cut with a variety of restriction enzymes and the resulting fragments are separated using
More informationCapillary Electrophoresis of Proteins
Capillary Electrophoresis of Proteins SDS Capillary Gel Electrophoresis SDS-CGE Outline CE-SDS Gel Analysis Description of Technique Method Development Tips PA800 plus kits SDS-MW IgG Purity & Heterogeneity
More informationLaboratory Validation. Chapter 16
Laboratory Validation Chapter 16 Importance The DNA profile is used to convict or free a suspect It must be perfect! No mistakes like we have in regular laboratories all the time Also DNA evidence must
More informationOPTIDOSE Traceable Polymer System OPTIDOSE Test Kits
OPTIDOSE Traceable Polymer System OPTIDOSE Test Kits Ever since polymers have been used as dispersants in cooling water treatment systems, there has been a need for a method of testing the polymer concentration.
More informationB-BOX Blue Light LED epi-illuminator. Catalogue No.: VE0100. Operator s Manual Ver
B-BOX Blue Light LED epi-illuminator Catalogue No.: VE0100 Operator s Manual Ver. 1.3.1 Checking List VE0100 VE0101 VE0102 B-BOX Blue Light LED epi-illuminator dapter, AC 100-240V, 50/ 60 Hz, 1.8m Power
More informationMultiplex PCR reaction
Multiplexed Detection of Pathogens using Fluorescence Resonance Energy Transfer in a Spatial Detection Format Multiplex PCR reaction Bruce Applegate Collaborators: Sergei Savikhin Pina Fratamico Wilfredo
More information