C. Incorrect! Threonine is an amino acid, not a nucleotide base.

Size: px
Start display at page:

Download "C. Incorrect! Threonine is an amino acid, not a nucleotide base."

Transcription

1 MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine. Ribose is the five-carbon sugar in RNA. It has a 2 OH, whereas deoxyribose, found in DNA, has a 2 H. B. Correct! Uracil is a pyrimidine base found only in RNA, not in DNA. Threonine is an amino acid, not a nucleotide base. Adenine is found in both RNA and DNA. We are looking for a base that is RNAspecific. RNA is a polynucleotide containing four different nitrogenous bases: the purines (adenine and guanine) and the pyrimidines (cytosine and uracil) and a sugarphosphate backbone (ribose). The correct answer is (B).

2 Question No. 2 of 10 Instructions: (1) Read the problem statement and answer choices carefully; (2) Work the problems on paper as needed; (3) Pick the correct answer; and (4) Go back to review the core concept tutorial as 2. Which of the following are components of ribonucleic acid? Question #02 (A) Amino acids. (B) Deoxyribose. (C) Thymine. (D) Ribose. Amino acids are components of proteins, not RNA. Deoxyribose is found in DNA, not RNA. Thymine is found in DNA, not RNA. D. Correct! Ribose is the sugar component of RNA nucleotides. RNA is a polynucleotide containing four different nitrogenous bases: the purines (adenine and guanine) and the pyrimidines (cytosine and uracil) and a sugarphosphate backbone (ribose). The correct answer is (D).

3 Question No. 3 of What is the difference between RNA and DNA? Question #03 (A) RNA and DNA use different nitrogenous bases. (B) RNA contains a different sugar. (C) RNA uses different patterns of hydrogen bonding. (D) RNA does not have the same 2-D or 3-D structure. Three of the four bases included in the RNA and DNA are the same (A, G, C). Only one base is different (T in DNA, U in RNA). B. Correct! RNA contains ribose, while DNA contains deoxyribose. Hydrogen bonding between the purines involves 2 H bonds and 3 H bonds in pyrimidines in both DNA and RNA. Double-stranded RNA is capable of forming helical structures just like doublestranded DNA. DNA and RNA are both nucleic acids (unbranched polynucleotides), but they do have some basic differences. DNA contains the sugar deoxyribose while RNA contains ribose. DNA contains the bases adenine, thymine, cytosine, and guanine, while RNA contains adenine, uracil, cytosine, and guanine. DNA is a double helix while RNA is often single-stranded, though it may form double-stranded or looped structures. When RNA is double stranded, it adopts a helical structure like DNA. The correct answer is (B).

4 Question No. 4 of Put the following events of transcription in the correct order. Question #04 I. The Polymerase catalyzes addition of ribonucleoside triphosphates. II. The DNA double helix is unwound. III. The Polymerase encounters a termination signal. IV. The RNA molecule is processed and leaves the nucleus. (A) II, I, III, IV (B) I, III, IV, II (C) I, II, III, IV (D) II, I, IV, III A. Correct! The transcription starts with a DNA template and ends with RNA leaving the nucleus. The transcription starts with a DNA template and ends with RNA leaving the nucleus. The transcription starts with a DNA template and ends with RNA leaving the nucleus. The transcription starts with a DNA template and ends with RNA leaving the nucleus. DNA Template Transcription factors binding to gene promoter RNA polymerase unwinds DNA next to the gene and initiates synthesis Elongation in the 5 to 3 direction Termination at stop signal Processing/Splicing (remove introns and add poly-a tail) RNA ready for transport out of the nucleus The correct answer is (A).

5 Question No. 5 of What is the major function of RNA in the cell? Question #05 (A) It functions in storage of genetic information. (B) It produces the amino acids that comprise proteins. (C) It is the catalytic molecule of the cell. (D) It functions as a mediator between DNA and protein. DNA, not RNA, functions in the storage of genetic information. trna molecules transport amino acids to ribosomes during protein synthesis, but they do not create amino acids. While there are some RNA molecules that have catalytic functions, the major catalytic molecule in the cell is proteins. D. Correct! RNA is the intermediate phase of information flow in the cell. The information stored in DNA is transcribed into RNA, which is subsequently translated into protein. Several species of RNA exist in the cell. Three major species are important for the MCAT, and they all function in protein biosynthesis: mrna (the interface between the stored information in DNA and the functional/structural version of that information as protein), trna (carries amino acids to the ribosomes), and rrna (a component of the ribosomes). The correct answer is (D).

6 Question No. 6 of What is the function of mrna in protein biosynthesis? Question #06 (A) It is the site of protein synthesis. (B) It guarantees that the correct amino acid is added. (C) It transports amino acids to the ribosome. (D) It carries the sequence information for proteins. Ribosomes are the sites of protein synthesis, and they contain rrna instead of mrna. mrna does not have a proofreading function. Removal of a misincorporated amino acid is mediated by trna synthetases. trna transports amino acids to the ribosome, not mrna. D. Correct! mrna is the intermediate step in the flow of information in the cell. mrna carries the sequence for proteins as a series of three-base codons with each codon specifying an amino acid. DNA Template Transcription mrna Translation Peptide/Protein The correct answer is (D).

7 Question No. 7 of Which of the following mrna molecules will code for a peptide, if read from the first base? Question #07 (A) 5 -ATGGTGCAGTTATAG-3 (B) 5 -UGGGCGAAUCCCUAG-3 (C) 5 -UAGCCCAUUCACUUA-3 (D) 5 -AUGCCCUUUGAUUAA-3 This molecule contains thymine, so it is a DNA molecule, not RNA. This molecule does not have the appropriate start signal, so protein biosynthesis will not be initiated. This molecule has a stop codon in the first position, so initiation of protein synthesis will not occur. D. Correct! The first codon in this molecule is a start codon, and if we read across 3 bases at a time, we find that the last codon is one of the stop codons. The start signal in mrna for protein biosynthesis is AUG, which codes for methionine. This codon will interact with a trna bearing the anti-codon UAC. Three stop codons are possible: UAA, UAG, and UGA. They do not code for amino acids. The correct answer is (D).

8 Question No. 8 of Which of the following correctly describes ribosomes? Question #08 (A) They are composed only of a nucleic acid and rrna. (B) The mrna is bound to the A site. (C) The ribosome will read the mrna in the 5 3 direction. (D) The ribosome is a nuclear structure. rrna is a nucleic acid, and it is a component of ribosomes, but several ribosomal proteins are also included in the structures called ribosomes. An aminoacyl-trna molecule (i.e., a loaded trna), not mrna, occupies the A site of ribosomes. C. Correct! Ribosomes read and physically move along mrna molecules in the 5 3 direction. Ribosomes are located in the cytoplasm. Often, a single mrna molecule will be read by several ribosomes at once in the cytoplasm. In this case, the mrna molecule is like a string and the ribosomes run along its length like beads. Such a structure is termed a polyribosome, or a polysome, and it increases the efficiency of translation. The correct answer is (C).

9 Question No. 9 of What prevents the coupling of transcription and translation in eukaryotes? Question #09 (A) The existence of the nuclear membrane. (B) Steric hindrance of RNA polymerase and ribosomes. (C) Regulatory proteins ensure that one process finishes before the other starts. (D) Transcription and translation are coupled in eukaryotes. A. Correct! The existence of the nuclear membrane physically separates the flow of information within the cell into two halves. mrna is produced in the nucleus and must be transported out through nuclear pores to be translated in the cytoplasm. In eukaryotic cells, RNA Polymerase and ribosomes do not function in the same compartment (i.e., one is nuclear, the other is cytoplasmic). The reason for sequential transcription and translation is not regulatory proteins; it is the existence of the nuclear membrane. Transcription and translation are never coupled in eukaryotes. Transcription and translation may be coupled in prokaryotes, because they do not have nuclear membranes. The correct answer is (A).

10 Question No. 10 of Which of the following is not true regarding protein biosynthesis? Question #10 (A) There may be more than one trna for each amino acid. (B) Mutations that change the reading frame can result in shortened proteins. (C) Degeneracy refers to the fact that 20 codons exist for the 64 amino acids. (D) The nascent polypeptide chain is held at the P site of the ribosome. In many cases, an amino acid may be linked to more than one trna, because of the degeneracy of the genetic code; however, each trna is specific for one and only one amino acid. A mutation that shifts the reading frame can cause an mrna molecule to be read incorrectly so that premature stop codons appear, causing protein biosynthesis to be terminated early. C. Correct! This answer has the facts completely backward. There are 20 amino acids, but 64 possible codons. The growing polypeptide is held by a trna molecule located in the P site, while the trna molecule bringing the next amino acid to the chain enters at the A site. Degeneracy, or redundancy, in the genetic code refers to the fact that there are 64 possible codons but only 20 amino acids. This means that many amino acids can be specified by more than one codon, and consequently by more than one trna. This is due to what is known as the Wobble Hypothesis. The correct answer is (C).

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?

Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein? Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA

More information

RNA & PROTEIN SYNTHESIS

RNA & PROTEIN SYNTHESIS RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Activity A: Build a DNA molecule

Activity A: Build a DNA molecule Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

DNA Replication and Protein Synthesis

DNA Replication and Protein Synthesis DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis

More information

TRANSCRIPTION AND TRANSLATION

TRANSCRIPTION AND TRANSLATION TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.

More information

DNA & Protein Synthesis UNIT D & E

DNA & Protein Synthesis UNIT D & E DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

CHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith

CHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:

More information

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs. DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

Unit VII DNA to RNA to protein The Central Dogma

Unit VII DNA to RNA to protein The Central Dogma Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase

More information

PUC Vikasana Program- 2012

PUC Vikasana Program- 2012 Chromosome Nucleus DNA PUC Vikasana Program- 2012 Introduction Molecular biology is the study of biology at a molecular level. Macromolecules and the macromolecular mechanisms. Interactions between the

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

The common structure of a DNA nucleotide. Hewitt

The common structure of a DNA nucleotide. Hewitt GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided

More information

DNA, Replication and RNA

DNA, Replication and RNA DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is

More information

DNA- THE MOLECULE OF LIFE

DNA- THE MOLECULE OF LIFE DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

Chapter 17 Nucleic Acids and Protein Synthesis

Chapter 17 Nucleic Acids and Protein Synthesis Chapter 17 Nucleic Acids and Protein Synthesis Nucleic Acids Nucleic acids are the components that make up the genetic material DNA (deoxyribonucleic acid). DNA is a macromolecule which contains all the

More information

Protein Synthesis. OpenStax College

Protein Synthesis. OpenStax College OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will

More information

STUDY GUIDE SECTION 10-1 Discovery of DNA

STUDY GUIDE SECTION 10-1 Discovery of DNA STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has

More information

Bundle 6 Test Review

Bundle 6 Test Review Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic

More information

DNA- THE MOLECULE OF LIFE. Link

DNA- THE MOLECULE OF LIFE. Link DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,

More information

Click here to read the case study about protein synthesis.

Click here to read the case study about protein synthesis. Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics

More information

Microbiology: The Blueprint of Life, from DNA to protein

Microbiology: The Blueprint of Life, from DNA to protein Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing

More information

AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review

AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar

More information

Chapter 14 Active Reading Guide From Gene to Protein

Chapter 14 Active Reading Guide From Gene to Protein Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single

More information

Protein Synthesis Making Proteins

Protein Synthesis Making Proteins Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?

More information

DNA Structure and Protein synthesis

DNA Structure and Protein synthesis DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13

Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

Chapter 14: Gene Expression: From Gene to Protein

Chapter 14: Gene Expression: From Gene to Protein Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

DNA Structure & the Genome. Bio160 General Biology

DNA Structure & the Genome. Bio160 General Biology DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:

More information

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

More information

DNA, RNA and Protein Synthesis

DNA, RNA and Protein Synthesis By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude

More information

DNA, RNA, protein synthesis. Sections , , and

DNA, RNA, protein synthesis. Sections , , and DNA, RNA, protein synthesis Sections 14.1 14.5, 15.1 15.5, and 16.4 16.6 05-09-16 Today s class Extra-credit essay Activity on mitosis, meiosis, and inheritance Lecture and activities on the lecture Extra-credit

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

2. From the first paragraph in this section, find three ways in which RNA differs from DNA.

2. From the first paragraph in this section, find three ways in which RNA differs from DNA. Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours

More information

Flow of Genetic Information

Flow of Genetic Information Flow of Genetic Information Transcription and Translation Links to the Next Generation Standards Scientific and Engineering Practices: Asking Questions (for science) and Defining Problems (for engineering)

More information

Why Nucleic Acid is Important to life? Chemistry 121(01) Winter Chapter 22. Nucleic Acids

Why Nucleic Acid is Important to life? Chemistry 121(01) Winter Chapter 22. Nucleic Acids Chemistry 121(01) Winter 2010-11 Introduction to Organic Chemistry and Biochemistry Instructor Dr. Upali Siriwardane (Ph.D. Ohio State) E-mail: upali@chem.latech.edu Office: 311 Carson Taylor Hall ; Phone:

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

UNIT 4. DNA, RNA, and Gene Expression

UNIT 4. DNA, RNA, and Gene Expression UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction

More information

RNA and PROTEIN SYNTHESIS. Chapter 13

RNA and PROTEIN SYNTHESIS. Chapter 13 RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from

More information

DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.

DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases. DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types

More information

Gene Expression REVIEW Packet

Gene Expression REVIEW Packet Name Pd. # Gene Expression REVIEW Packet 1. Fill-in-the-blank General Summary Transcription & the Big picture Like, ribonucleic acid (RNA) is a acid a molecule made of nucleotides linked together. RNA

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function

More information

The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines

The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic

More information

1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).

1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). 1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing

More information

Comparing RNA and DNA

Comparing RNA and DNA RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

DNA & DNA Replication

DNA & DNA Replication DNA & DNA Replication DNA Structure How did Watson and Crick contribute to our understanding of genetics? Watson and Crick developed the double helix model for DNA DNA Structure What is a double helix?

More information

3. INHERITED MUTATIONS

3. INHERITED MUTATIONS THE CENTRAL DOGMA OF BIOLOGY 1. DNA B4.2 The genetic information encoded in DNA molecules provides instructions for assembling protein molecules. Genes are segments of DNA molecules. Inserting, deleting,

More information

Section A: The Connection Between Genes and Proteins

Section A: The Connection Between Genes and Proteins CHAPTER 17 FROM GENE TO PROTEIN Section A: The Connection Between Genes and Proteins 1. The study of metabolic defects provided evidence that genes specify proteins 2. Transcription and translation are

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora

More information

DNA - The Double Helix

DNA - The Double Helix DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,

More information

Transcription and Translation

Transcription and Translation Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism

More information