Molecular Basis of Mechanotransduction in Endothelial Cells

Size: px
Start display at page:

Download "Molecular Basis of Mechanotransduction in Endothelial Cells"

Transcription

1 Molecular Basis of Mechanotransduction in Endothelial Cells Shu Chien, M.D., Ph.D. Departments of Bioengineering and Medicine, and The Whitaker Institute of Biomedical Engineering University of California San Diego, La Jolla, CA May 16, 2006

2 Hemodynamic Forces Acting on The Blood Vessel Blood flow Normal Stress Shear Stress Stretch

3 Effects of Physico-chemical Stimuli on Signal Transduction and Gene Expression Chemical Ligand Mechanical Forces Receptor Signaling pathways Cytoplasm Sensors Trans cis Nucleus Gene Exp. Membrane Protein Exp. Functions Functions: Secretion, Migration, Remodeling, Proliferation, Apoptosis, etc. Mechanotransduction is a fundamental homeostatic process in health and disease.

4 Hemodynamic Factors Blood Cell turnover Monocyte MCP-1* LDL LDL ECs Macrophage ox-ldl Vessel wall Foam cell SMCs * Monocyte Chemotactic Protein-1

5 Atherosclerotic Lesions are Preferentially Located at Regions with Complex Flow Patterns

6 Rectangular Flow Chamber to Study the Effects of Laminar Flows on EC Monolayer Pump Air, 5% CO 2 Microscope Reservoir EC Monolayer

7 MCP-1/GAPDH (Relative Level) Effects of Laminar Shear Stress (12 dyn/cm 2 ) on MCP-1 Gene Expression in HUVECs Time under Shear Stress (hours)

8 Transcription Factor (e.g., AP-1 for MCP-I gene) AP-1 is composed of cjun and cfos Cis element in the promoter region of a gene (e.g., TRE for MCP-I gene)

9 Roles of Ras and MAP Kinases in Shear-Induced Signal Transduction and Gene Expression Shear stress Membrane GDP-Ras GTP- Ras Cytoplasm ERK cfos JNK cjun Nucleus AP-1 MCP-1 TRE Phosphorylation cascade.

10 Relative Degree of Activation Ras JNK MCP Time under Shear Stress (hours)

11 Roles of Adapter Molecules Shc, Grb2 and Sos in Shear-Induced Signal Transduction and Gene Expression Shear stress Flk-1 GTP GDP Tyr- P Shc Grb2 Sos Ras ERK JNK cfos cjun AP-1 TRE MCP-1 Receptor Tyrosine Kinases (RTKs), e.g., the Vascular Endothelial Growth Factor (VEGF) Receptor Flk-1, can mediate the shear-induction of signaling.

12 Mediation of Shear-induced Signal Transduction by Integrins and Focal Adhesion Proteins Shear stress Flk-1 GTP GDP Tyr- P Shc Grb2 Sos Signaling Ras pathways Grb2 Sos Shc FAK c-src Integrins Focal adh. site Trans cis Gene Exp. Protein Exp. e.g., α v β 3 FN, VN Extracellular matrix α v β 3 integrin interacts specifically with fibronectin and vitronectin, but not laminin or collagen. Shear-induced integrin activation leads to its association with FA proteins.

13 Mediation of Shear-induced Signal Transduction by Integrins and Focal Adhesion Proteins Shear stress Flk-1 GTP GDP Tyr- P Shc Grb2 Sos Signaling Ras pathways Grb2 Sos Shc FAK c-src Integrins Focal adh. site Trans cis Gene Exp. Protein Exp. e.g., α v β 3 FN, VN Extracellular matrix Study of temporal and spatial characteristics of Src activation by Fluorescence Resonance Energy Transfer (FRET)

14 Design Strategy for a Novel Reporter for Src Activation by Fluorescence Resonance Energy Transfer (FRET) CFP (1-227) Linker SH2(from c-src) Substrate YFP 433 nm Src Substrate Strong FRET 527 nm QuickTime and a Microsoft Video 1 decompressor are needed to see this picture. CFP YFP SH2 Src Activation

15 Design Strategy for a Novel Reporter for Src Activation by Fluorescence Resonance Energy Transfer (FRET) CFP (1-227) Linker SH2(from c-src) Substrate YFP 433 nm Src Substrate Strong FRET 527 nm 433 nm Weak FRET 490 nm CFP QuickTime and a Microsoft Video 1 decompressor are needed to see this picture. YFP QuickTime and a Microsoft Video 1 decompressor are needed to see this picture. SH2 Src Activation

16 FRET Response of Src Reporter Induced by Pervanadate (A phosphatase inhibitor that increases phosphorylation) Time Src Activation: YFP (2min between images) CFP CFP/YFP Ratio 0.42 (Hi CFP) Pervanadate The results indicate that Src activity is increased by pervanadate (Hi YFP)

17 FRET Response of Src Reporter Is Induced by Shear Stress Time (2min between images) Shear CFP/YFP Ratio 0.42 (Hi CFP) The results indicate that Src activity is increased by shear (Hi YFP)

18 Pulling Fibronectin-coated Beads induced A directional propagation of Src activation (Color changes indicates increases of Src activity after pulling. Time interval between images= 2min) 0.52 Time Force On Ratio (CFP/YFP) 0.25

19 Effects of Physico-chemical Stimuli on Signal Transduction and Gene Expression Chemical Ligand Mechanical Forces Receptor Signaling pathways Cytoplasm Sensors Trans cis Nucleus Gene Exp. Membrane Protein Exp. Functions Functions: Secretion, Migration, Remodeling, Proliferation, Apoptosis, etc.

20 Effects of Laminar and Disturbed Flows on Wound Closure in EC Monolayer Oscillatory Pump Pump Microscope Air, 5% CO 2 Reservoir Step Top View Disturbed Flow Reattachment Zone Direction of Laminar Flow BAEC Monolayer (a) Wound in Disturbed Flow (b) Wound in Laminar Flow

21 Effects of Flow Endothelial Cell Migration (hr) Static Control Laminar Flow Disturbed Flow Laminar flow enhances wound healing, which is much slower under Disturbed flow.

22 Measurement of Cell Traction Force by Using the Beads-in-Membrane Technique Cell Fibronectin Polyacrylamide Gel Embedded with Fluorescent Beads (D= 0.2 µm) 80 µm Glass Cover Slip Side View (not in proportion)

23 EC Traction on Silicon Membrane Containing Fluorescent Beads A. No Flow

24 EC Traction on Silicon Membrane Containing Fluorescent Beads B. 10 min. at 12 dyn/cm 2 Flow

25 Time *: - 4 min 0 - min + 4 min + 10 min + 30 min a c e g i 1.55E-03 cm 1.88E+06 dyn/cm 2 Mag(T EC ) (dyn/cm 2 ) 1.30E E E E E E E E E E E E E E E E+02 b d f h j

26 Force Balance in Mechanically Induced Cell Migration Shear Stress on Membrane Nucleus Intracellular Stress/Strain Junction Proteins (Intercellular Stress) Cytoskeleton Remodeling Cell-Matrix Adhesion Force

27 Multi-factorial Mechanotransduction in Shear-sensing, Signal Transduction and Gene Expression GPCR Channels Junction proteins Shear stress Integrins RTKs (e.g., Flk-1) Membrane (Caveolae) Cbl Akt lkk NFκB Ras JNKK JNK Trans cdc42 cis Rho ROCK Rac Actin Glycocalyx Gene Exp. Protein Exp. Functions Extracellular matrix Functions: Secretion, Migration, Remodeling, Proliferation, Apoptosis, etc.

28 Laminar Flow p53 GADD45 p21 cipl P-Rb Cell cycle arrest in G 0 /G 1

29 Long-term Laminar Shear Stress Causes EC Arrest S Phase G0/G1 Phase % of Total cells (hr) * * * * * (hr) Static Shear Stress

30 Effects of Flow Patterns on Cell Turnover and Permeability Sustained Laminar Flow p53 GADD45 p21 cipl P-Rb Cell cycle arrest in G 0 /G 1 Straight part of the aorta is subjected to sustained laminar shear that leads to cell cycle arrest and hence reduced endothelial permeability. Branch points have unsteady flow pattern, which accelerates cell turnover and increases permeability.

31 Endothelial Cell Mitosis ( ) and Albumin Leaky Spots ( ) In Rabbit Thoracic Aorta Intercostal Orifices Flow

32 Lipid Accumulation and Atherosclerotic Lesions around Intercostal Orifices Lipid accumulation (Rabbit Aorta) D.C. Schwenke & T.E. Carew Arteriosclerosis 9: , 1989 Atherosclerotic lesions (Human Aorta) M. Texon: Hemodynamic Basis of Atherosclerosis

33 MCP-1 Staining and Subintimal WBC Localization around Intercostal Orifices Histochemical Staining of MCP-1 (Rat Aorta) G. Norwich & S. Chien Intimal Distribution of WBC (Rabbit Aorta) Malinauskas et al., Atherosclerosis 115:145, 1995

34 Oscillatory Shears with Different net forward Flows 16 - Pulsatile Shear 16 - Reciprocating Shear (12 ± 4 dyn/cm 2 ) (0.5 ± 4 dyn/cm 2 ) Relative KLF2 mrna Level (% of control) PS RS hour

35 Differential Regulation of KLF2 at Branch Points in Vivo

36 Effects of Local Constriction on KLF2 Expression in Vivo

37 Blood Flow Patterns in Relation to Endothelial Cell Functions and Pathology Straight Part Branch Points Flow Pattern Laminar Disturbed Monocyte Adhesion EC turnover & LDL Permeability Effects on Atherogenesis Anti-Athero. Atherogenic

38 Atherosclerotic Lesions are Preferentially Located at Vessel Bifurcations

39 Hemodynamic Forces Acting on The Blood Vessel Blood flow Normal Stress Shear Stress Stretch

40 Uniaxial and Biaxial Stretch Devices L o +DL D Indenter L o Indenter A B Uniaxial Stretch Biaxial Stretch

41 Uniaxial Stretch Biaxial Stretch 10% linear strain Cell Borders (β-catenin mab / Alexa 488 anti-mouse) F-Actin (Rhodamine Phalloidin)

42 Effects of Uniaxial Stretch on Stress Fiber Orientation Static Control 10% Stretch Cell Images Frequency Distribution of Angle of Orientation Polar Plots

43 Effects of Uniaxial Stretch Magnitude on Stress Fiber Orientation P-value Static % 0.22 Cyclic Uniaxial Stretch 3% 5% 7.5% 0.04 <0.001 < % <0.001

44 Effects of Inhibition of Downstream Effectors of Rho: Rho Kinase (ROCK) and MDia on Stress Fiber Orientation Induced by 10% Stretch Transfection pef (control) pef + Y27632 pef + F1F2 1 % Stretch - 10% - 10% - 10% Cell Images Orientation distribution Inhibition of ROCK (Y27632) or MDia (F1F2 1) changed the 10% stretch-induced stress fiber orientation from perpendicular to parallel.

45 Effects of Active Mutant RhoV14 on Stress Fiber Orientation Transfection GFP (control) % Stretch - 2.5% 10% - 3% 10% Cell Images Orientation distribution

46 Effects of Active Mutant RhoV14 on Stress Fiber Orientation Transfection GFP (control) % Stretch - 2.5% 10% - 2.5% 10% Cell Images Orientation distribution

47 Effects of Active Mutant RhoV14 on Stress Fiber Orientation Transfection GFP (control) % Stretch - 2.5% 10% - 2.5% 10% Cell Images Orientation distribution

48 Effect of Active Rho Mutant (RhoV14) on Stretch-Induced Stress Fiber Orientation Random 0 Orientation Parameter GFP GFP + RhoV14 QuickTime and a TIFF (LZW) decompressor are needed to see this picture. Aligned 1

49 Effect of Active Rho Mutant (RhoV14) on Stretch-Induced Stress Fiber Orientation Random 0 Orientation Parameter GFP +2.9% QuickTime and a RhoV14 has an effect on TIFF (LZW) decompressor are needed to see this picture. stress fiber orientation GFP % equivalent to an RhoV14 additional 2.9% stretch. +2.9% Aligned 1

50 JNK Activation is Transient in Response to Uniaxial Stretch, but Sustained with Biaxial Stretch 10% Uniaxial Stretch 10% Biaxial Stretch GST c-jun Anti-JNK1 Fold JNK Activation (experiment / control) * * Time (hr) * * * * Time (hr)

51 Uniaxial Stretch Biaxial Stretch Cell and Actin Filament Orientation Time Course of JNK Activation Perpendicular to Stretch Transient Random Sustained Hypothesis Remodeling in response to uniaxial stretch leads to the subsidence of JNK activation. Significance Sustained, but not transient, JNK activation causes apoptosis.

52 6 hr

53 6 hr 90 turn 0.5 hr

54 6 hr 90 turn 0.5 hr

55 6 hr 90 turn 0.5 hr 6 hr

56 Regulation of Stress Fiber Orientation and JNK Activation by 10% Uniaxial Stretch: Effects of Change in Stretch Direction Stress Fiber Angle (relative to Current strain direction) * * 0 JNK Activation (Experiment/Control) * * C 0.5 hr 6 hr 6 hr + 90 o 0.5 hr 6 hr + 90 o 6 hr JNK activation subsided following stress fiber realignment

57 Uniaxial Stretch Equibiaxial Stretch Cell and Actin Filament Orientation Time Course of JNK Activation Perpendicular to Stretch Transient Random Sustained Apoptosis Protected Enhanced The Rho-mediated stress fiber orientation perpendicular to the direction of stretch represents a mechanism by which cells adapt to mechanical strain that involves molecular and biomechanical responses.

58 Conclusions: Importance of Directionality in Mechanotransduction Laminar flow with a net forward direction is atheroprotective, whereas disturbed flow with little net forward direction is athergenic. Uniaxial stretch with a definitive direction is antiapoptosis, whereas biaxial stretch without a net direction leads to apoptosis. The directionality of the mechanical stimuli and the consequent directional remodeling of the cytoskeleton play important roles in the modulation of cell functions in response to mechanotransduction.

Lab Module 7: Cell Adhesion

Lab Module 7: Cell Adhesion Lab Module 7: Cell Adhesion Tissues are made of cells and materials secreted by cells that occupy the spaces between the individual cells. This material outside of cells is called the Extracellular Matrix

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

7.06 Cell Biology EXAM #2 March 20, 2003

7.06 Cell Biology EXAM #2 March 20, 2003 7.06 Cell Biology EXAM #2 March 20, 2003 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write

More information

In Vitro Angiogenesis Assay Kit

In Vitro Angiogenesis Assay Kit In Vitro Angiogenesis Assay Kit Catalog Number KA1323 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

Quantification of Cell Migration and Invasion Using the IncuCyte Chemotaxis Assay

Quantification of Cell Migration and Invasion Using the IncuCyte Chemotaxis Assay APPLICATION NOTE IncuCyte ZOOM Live-Cell Imaging System Quantification of Cell Migration and Invasion Using the IncuCyte Chemotaxis Assay Lindy O Clair, Meagan Roddy, Maria Tikhonenko, Clare Syzbut, Nicola

More information

Effects of morphological patterning on endothelial cell migration

Effects of morphological patterning on endothelial cell migration Biorheology 38 (2001) 101 108 101 IOS Press Effects of morphological patterning on endothelial cell migration Song Li, Sangeeta Bhatia, Ying-Li Hu, Yan-Ting Shiu, Yi-Shuan Li, Shunichi Usami and Shu Chien

More information

Partha Roy

Partha Roy Fluorescence microscopy http://micro.magnet.fsu.edu/primer/index.html Partha Roy 1 Lecture Outline Definition of fluorescence Common fluorescent reagents Construction ti of a fluorescence microscope Optical

More information

DNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268

DNA Binding Domains: Structural Motifs. Effector Domain. Zinc Fingers. Zinc Fingers, continued. Zif268 DNA Binding Domains: Structural Motifs Studies of known transcription factors have found several motifs of protein design to allow sequence-specific binding of DNA. We will cover only three of these motifs:

More information

The MAP Kinase Family

The MAP Kinase Family The MAP Kinase Family Extracellular stimuli Classical MAP kinases Atypical MAP kinases MAPKKK MLK1/2/3/7; LZK RAF-1/A/B TAK1; TPL2 c-mos MEKK1-4; DLK ASK1/2; MLTK TAO1/2 ASK1 TAK1 MEKK1-4 MEKK2/3 TPL2???

More information

7.06 Problem Set #3, Spring 2005

7.06 Problem Set #3, Spring 2005 7.06 Problem Set #3, Spring 2005 1. The Drosophila compound eye is composed of about 800 units called ommatidia. Each ommatidium contains eight photoreceptor neurons (R1 through R8), which develop in a

More information

EXTRACELLULAR AND INTRACELLULAR PHENOMENA IN MICROFLUIDIC FLOW. A Dissertation Presented by Dwayne Andre Levar Vickers to

EXTRACELLULAR AND INTRACELLULAR PHENOMENA IN MICROFLUIDIC FLOW. A Dissertation Presented by Dwayne Andre Levar Vickers to EXTRACELLULAR AND INTRACELLULAR PHENOMENA IN MICROFLUIDIC FLOW A Dissertation Presented by Dwayne Andre Levar Vickers to The Department of Chemical Engineering in partial fulfillment of the requirements

More information

Corning Microplates for Microscopy and High Content Imaging. Improve results with microplates for high resolution cell imaging

Corning Microplates for Microscopy and High Content Imaging. Improve results with microplates for high resolution cell imaging Corning Microplates for Microscopy and High Content Imaging Improve results with microplates for high resolution cell imaging High Performance for Cell-based Assays Within the drug discovery process, high

More information

Cytomics in Action: Cytokine Network Cytometry

Cytomics in Action: Cytokine Network Cytometry Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University

More information

MICB688L/MOCB639 Advanced Cell Biology Exam II

MICB688L/MOCB639 Advanced Cell Biology Exam II MICB688L/MOCB639 Advanced Cell Biology Exam II May 10, 2001 Name: 1. Briefly describe the four major classes of cell surface receptors and their modes of action (immediate downstream only) (8) 2. Please

More information

Corning Epic System. Applications. Therapeutic Application

Corning Epic System. Applications. Therapeutic Application Corning Epic System Applications The Corning Epic System can be applied to probe many of the biomolecular interactions involved in cellular and molecular biology. Beyond its application to direct binding,

More information

Substrate rigidity and force define form through tyrosine phosphatase and kinase pathways

Substrate rigidity and force define form through tyrosine phosphatase and kinase pathways Review TRENDS in Cell Biology Vol.16 No.4 April 2006 Substrate rigidity and force define form through tyrosine phosphatase and kinase pathways Grégory Giannone 1,2 and Michael. Sheetz 1 1 Department of

More information

Platelet Adhesion and Aggregation Assays

Platelet Adhesion and Aggregation Assays PPLICTION NOTE Platelet dhesion and ggregation ssays Microfluidic assays enable multi-parametric investigation of platelet behavior under flow. Relevant Research reas: Vascular Biology, Thrombosis and

More information

Section 10. Junaid Malek, M.D.

Section 10. Junaid Malek, M.D. Section 10 Junaid Malek, M.D. Cell Division Make sure you understand: How do cells know when to divide? (What drives the cell cycle? Why is it important to regulate this?) How is DNA replication regulated?

More information

of signal transduction pathways?

of signal transduction pathways? CELL BIOLOGY Signal Transduction + How do you study activation of signal transduction pathways? + IDENTIFICATION OF PATHWAY-SPECIFIC TRANSCRIPTION ACTIVATION + EASIER, FASTER THAN BLOTTING OR GEL-SHIFT

More information

CHARACTERIZATION OF VASCULAR SMOOTH MUSCLE CELL MECHANICAL AND FRICTIONAL PROPERTIES USING ATOMIC FORCE MICROSCOPY

CHARACTERIZATION OF VASCULAR SMOOTH MUSCLE CELL MECHANICAL AND FRICTIONAL PROPERTIES USING ATOMIC FORCE MICROSCOPY Clemson University TigerPrints All Dissertations Dissertations 12-2008 CHARACTERIZATION OF VASCULAR SMOOTH MUSCLE CELL MECHANICAL AND FRICTIONAL PROPERTIES USING ATOMIC FORCE MICROSCOPY Jason Hemmer Clemson

More information

*Corresponding author. Tel: ;

*Corresponding author. Tel: ; 1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland

More information

Solution Key Problem Set

Solution Key Problem Set Solution Key- 7.013 Problem Set 5-2013 Question 1 During a summer hike you suddenly spot a huge grizzly bear. This emergency situation triggers a fight or flight response through a signaling pathway as

More information

The Making of the Fittest: Natural Selection and Adaptation

The Making of the Fittest: Natural Selection and Adaptation INTRODUCTION THE ROCK POCKET MOUSE THE BIOCHEMISTRY AND CELL SIGNALING PATHWAY OF MC1R The rock pocket mouse, Chaetodipus intermedius, is a small, nocturnal animal found in the deserts of the southwestern

More information

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+

More information

ANAT Cell Biology Lecture 11 School of Medical Sciences The University of New South Wales. UNSW Copyright Notice

ANAT Cell Biology Lecture 11 School of Medical Sciences The University of New South Wales. UNSW Copyright Notice ANAT3231 - Cell Biology Lecture 11 School of Medical Sciences The University of New South Wales The actin cytoskeleton Prof Peter Gunning Oncology Research Unit Room 502A Wallace Wurth Building Email:

More information

Contents. The Right Surface for Every Cell Extracellular Matrices and Biologically Coated Surfaces ECM Mimetic and Advanced Surfaces...

Contents. The Right Surface for Every Cell Extracellular Matrices and Biologically Coated Surfaces ECM Mimetic and Advanced Surfaces... Contents The Right Surface for Every Cell... 1 Extracellular Matrices and Biologically Coated Surfaces... 2 Corning Matrigel Matrix... 2 Corning BioCoat Cultureware... 3 ECM Mimetic and Advanced Surfaces...

More information

Resolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f

Resolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f Microscopes and Microscopy MCB 380 Good information sources: Alberts-Molecular Biology of the Cell http://micro.magnet.fsu.edu/primer/ http://www.microscopyu.com/ Approaches to Problems in Cell Biology

More information

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang

More information

5 HARNESSING THE PURSE STRING FOR

5 HARNESSING THE PURSE STRING FOR 107 5 HARNESSING THE PURSE STRING FOR ACCELERATED WOUND CLOSURE Abstract Wound healing is essential in maintaining tissue integrity. Wounds can close via lamellipodial crawling, which involves the rapid

More information

Digitally Programmed Cells

Digitally Programmed Cells Digitally Programmed Cells Ron Weiss PI: Tom Knight MIT Artificial Intelligence Laboratory Goal Process-Control Cellular Computers -- Microbial Robotics Unique features: small, self-replicating, energy-efficient

More information

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a

More information

Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney

Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney 1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.

More information

CELL BIOLOGY BIOL3030, 3 credits Fall 2012, Aug 20, Dec 14, 2012 Tuesday/Thursday 8:00 am-9:15 am Bowman-Oddy Laboratories 1049

CELL BIOLOGY BIOL3030, 3 credits Fall 2012, Aug 20, Dec 14, 2012 Tuesday/Thursday 8:00 am-9:15 am Bowman-Oddy Laboratories 1049 INSTRUCTOR: Dr. Song-Tao Liu WO3254B Tel: 419-530-7853 Email: Song-Tao.Liu@utoledo.edu OFFICE HOURS CELL BIOLOGY BIOL3030, 3 credits Fall 2012, Aug 20, 2012 - Dec 14, 2012 Tuesday/Thursday 8:00 am-9:15

More information

The mechanism(s) of protein folding. What is meant by mechanism. Experimental approaches

The mechanism(s) of protein folding. What is meant by mechanism. Experimental approaches The mechanism(s) of protein folding What is meant by mechanism Computational approaches Experimental approaches Questions: What events occur and in what time sequence when a protein folds Is there a specified

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )

More information

Meso Scale Discovery Applications

Meso Scale Discovery Applications A Suite of Assays to Detect hosphorylated Receptor Tyrosine Kinases Associated with Neoplasia Timothy S. Schaefer, Jane Zhang, Sean Higgins, Laura K. Schaefer, Robert M. Umek and Jacob N. Wohlstadter Reversible

More information

Recombinant anti-pc IgG antibodies reduce intimal thickening and vascular inflammation in a mouse model for accelerated atherosclerosis

Recombinant anti-pc IgG antibodies reduce intimal thickening and vascular inflammation in a mouse model for accelerated atherosclerosis Recombinant anti-pc IgG antibodies reduce intimal thickening and vascular inflammation in a mouse model for accelerated atherosclerosis Mark M. Ewing Departments of Cardiology and Surgery Leiden University

More information

In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay. Josephine MY Ko and Maria Li Lung *

In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay. Josephine MY Ko and Maria Li Lung * In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay Josephine MY Ko and Maria Li Lung * Clinical Oncology Department, The Univerisity of Hong Kong, Hong Kong, Hong Kong SAR *For

More information

C-type natriuretic peptide signalling and cardiovascular disease Adrian Hobbs

C-type natriuretic peptide signalling and cardiovascular disease Adrian Hobbs C-type natriuretic peptide signalling and cardiovascular disease Adrian Hobbs Professor of Cardiovascular Pharmacology William Harvey Research Institute Barts & The London School of Medicine & Dentistry

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

7.013 Practice Quiz

7.013 Practice Quiz MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel 7.013 Practice Quiz 2 2004 1 Question 1 A. The primer

More information

WOUND HEALING ON ARTIFICIAL EXTRACELLULAR MATRIX PROTEINS

WOUND HEALING ON ARTIFICIAL EXTRACELLULAR MATRIX PROTEINS WOUND HEALING ON ARTIFICIAL EXTRACELLULAR MATRIX PROTEINS Thesis by Eileen Fong In Partial Fulfillment of the Requirements For the Degree of Doctor of Philosophy California Institute of Technology Pasadena,

More information

1 Scaffolds. 2 Extracellular matrix

1 Scaffolds. 2 Extracellular matrix This lecture describes the components of the extracellular matrix and their influence on the cell properties and functions. 1 Scaffolds One of the key components of the tissue engineering triad is the

More information

Supporting Information

Supporting Information Supporting Information Shao et al. 10.1073/pnas.1504837112 SI Materials and Methods Immunofluorescence and Immunoblotting. For immunofluorescence, cells were fixed with 4% paraformaldehyde and permeabilized

More information

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating

More information

Introduction. Figure 1. Oris Cell Migration Assay Principle

Introduction. Figure 1. Oris Cell Migration Assay Principle Optimizing Performance of the Membrane-free, Oris Cell Migration Assay for High Throughput Screening using the BioTek Synergy HT Multi-Mode Microplate Reader Keren I. Hulkower, Renee L. Herber, and Scott

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

Integrin-Dependent Activation of the JNK Signaling Pathway by Mechanical Stress

Integrin-Dependent Activation of the JNK Signaling Pathway by Mechanical Stress Integrin-Dependent Activation of the JNK Signaling Pathway by Mechanical Stress Andrea Maria Pereira 1., Cicerone Tudor 2., Johannes S. Kanger 2, Vinod Subramaniam 2 *, Enrique Martin- Blanco 1 * 1 Instituto

More information

7.17: Writing Up Results and Creating Illustrations

7.17: Writing Up Results and Creating Illustrations 7.17: Writing Up Results and Creating Illustrations A Results Exercise: Kansas and Pancakes Write a 5-sentence paragraph describing the results illustrated in this figure: - Describe the figure: highlights?

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

University of Southampton Research Repository eprints Soton

University of Southampton Research Repository eprints Soton University of Southampton Research Repository eprints Soton Copyright and Moral Rights for this thesis are retained by the author and/or other copyright owners. A copy can be downloaded for personal non-commercial

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Zool 3200: Cell Biology Exam 3 3/6/15

Zool 3200: Cell Biology Exam 3 3/6/15 Name: Trask Zool 3200: Cell Biology Exam 3 3/6/15 Answer each of the following questions in the space provided; circle the correct answer or answers for each multiple choice question and circle either

More information

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc. The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration

More information

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays

More information

Imagerie et spectroscopie de fluorescence par excitation non radiative

Imagerie et spectroscopie de fluorescence par excitation non radiative Imagerie et spectroscopie de fluorescence par excitation non radiative comment s affranchir de la limite de diffraction Rodolphe Jaffiol, Cyrille Vézy, Marcelina Cardoso Dos Santos LNIO, UTT, Troyes NanoBioPhotonics

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

Tyrosine Kinase Assay Kit, Red*

Tyrosine Kinase Assay Kit, Red* Rh Tyrosine Kinase Assay Kit, Red* 1.0 INTRODUCTION Part # P2882, P2883 Lit. # L0531 Rev. 11/02 Page 1 of 6 The phosphorylation of proteins by protein tyrosine kinases (PTKs) is critical to the normal

More information

FAK biosensor was recently developed based on FRET(1). The FAT-FAK biosensor is created in

FAK biosensor was recently developed based on FRET(1). The FAT-FAK biosensor is created in Supplementary Information Materials and Methods DN Plasmids, Cell Culture and Reagents FK biosensor was recently developed based on FRET(). The FT-FK biosensor is created in pcdn3. by fusing a PCR product

More information

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps

More information

Phosphorylation of Tyrosine Residues 31 and 118 on Paxillin Regulates Cell Migration through an Association with CRK in NBT-II Cells

Phosphorylation of Tyrosine Residues 31 and 118 on Paxillin Regulates Cell Migration through an Association with CRK in NBT-II Cells Phosphorylation of Tyrosine Residues 31 and 118 on Paxillin Regulates Cell Migration through an Association with CRK in NBT-II Cells Valérie Petit,* Brigitte Boyer,* Delphine Lentz,* Christopher E. Turner,

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

The role of Merlin in Cardiovascular Disease.

The role of Merlin in Cardiovascular Disease. The role of Merlin in Cardiovascular Disease. Chun Xu Shan, B.Sc, M.Sc Thesis Submitted to Dublin City University (DCU) for the Degree of Doctor of Philosophy (Ph.D) Research was carried out in the School

More information

PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance

PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance Graduate School ETD Form 9 (Revised 12/07) PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance This is to certify that the thesis/dissertation prepared By Qiaoqiao Wan Entitled Effects of

More information

The tyrosine phosphatase SHP2 regulates recovery of endothelial adherens junctions through control of β-catenin phosphorylation

The tyrosine phosphatase SHP2 regulates recovery of endothelial adherens junctions through control of β-catenin phosphorylation MBoC ARTICLE The tyrosine phosphatase SHP2 regulates recovery of endothelial adherens junctions through control of β-catenin phosphorylation Ilse Timmerman a, Mark Hoogenboezem a, Anton M. Bennett b, Dirk

More information

DEPArray Technology. Sorting and Recovery of Rare Cells

DEPArray Technology. Sorting and Recovery of Rare Cells DEPArray Technology Sorting and Recovery of Rare Cells Delivering pure, single, viable cells The DEPArray system from Silicon Biosystems is the only automated instrument that can identify, quantify, and

More information

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene

More information

Mouse ICAM-1 / CD54 ELISA Pair Set

Mouse ICAM-1 / CD54 ELISA Pair Set Mouse ICAM-1 / CD54 ELISA Pair Set Catalog Number : SEK50440 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General

More information

Human Connective Tissue Growth Factor (CTGF) Elisa Kit

Human Connective Tissue Growth Factor (CTGF) Elisa Kit Human Connective Tissue Growth Factor (CTGF) Elisa Kit Catalog No. CSB-E07875h (96 tests) This immunoassay kit allows for the in vitro quantitative determination of human CTGF concentrations in serum,

More information

CBI Toolbox Tour 2015

CBI Toolbox Tour 2015 CBI Toolbox Tour 2015 Thermophoresis (NanoTemper) NT.115 & NT.LabelFree Images: NanoTemper Circular Dichroism Jasco J-1500 Spectrometer Six Position Turreted Peltier Temperature Control System Automated

More information

Microtubules. Forms a sheet of protofilaments that folds to a tube Both tubulins bind GTP

Microtubules. Forms a sheet of protofilaments that folds to a tube Both tubulins bind GTP Microtubules Polymerize from a-tubulin/ß-tubulin dimers Hollow tube of 13 protofilaments In vitro- filament number varies In vivo- always 13 protofilaments Forms a sheet of protofilaments that folds to

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description

More information

Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics

Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Proteomics and studying dynamic interactions AP-MS Proteomics

More information

NTM486-04, NTM174-04,

NTM486-04, NTM174-04, Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.

More information

BME Engineering Molecular Cell Biology. The Cytoskeleton (I): Actin The Cytoskeleton (II): Microtubule & Intermediate Filament

BME Engineering Molecular Cell Biology. The Cytoskeleton (I): Actin The Cytoskeleton (II): Microtubule & Intermediate Filament BME 42-620 Engineering Molecular Cell Biology Lecture 09: The Cytoskeleton (I): Actin The Cytoskeleton (II): Microtubule & Intermediate Filament BME42-620 Lecture 09, September 27, 2011 1 Outline Overviewofcytoskeletal

More information

Lab module 6b Receptor-mediated endocytosis

Lab module 6b Receptor-mediated endocytosis Goal for the module Lab module 6b Receptor-mediated endocytosis To follow the movement of a degraded ligand, LDL, and a recycled ligand, transferrin, as they undergo endocytic processing. Pre-lab homework

More information

NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE.

NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE. NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE. D. R. Aguirre, N. DiMassa, Chrystal Johnson, H. Eran, R. Perez, C.V.R. Sharma, M.V.R. Sharma,

More information

An investigation of the role of integrin alpha-6 in human induced pluripotent stem cell development and pluripotency

An investigation of the role of integrin alpha-6 in human induced pluripotent stem cell development and pluripotency An investigation of the role of integrin alpha-6 in human induced pluripotent stem cell development and pluripotency Submitted by Genna Wilber Biology and English To The Honors College Oakland University

More information

Supplemental Material for

Supplemental Material for Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,

More information

Test report and professional information. Mini-Rayonex

Test report and professional information. Mini-Rayonex 1 (5) Dartsch Scientific GmbH! Oskar-von-Miller-Str. 10! D-86956 Schongau Firma Rayonex Biomedical GmbH c/o Prof. Dietmar Heimes Sauerland-Pyramiden 1 D-57368 Lennestadt Oskar-von-Miller-Straße 10 D-86956

More information

* This work was supported, in whole or in part, by National Institutes of Health Grants HL56850 and AG S EXPERIMENTAL PROCEDURES

* This work was supported, in whole or in part, by National Institutes of Health Grants HL56850 and AG S EXPERIMENTAL PROCEDURES THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 10, pp. 6937 6951, March 5, 2010 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. p66 shc Inhibits Insulin-like

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

Interest in any of the products, request or order them at Bio-Connect.

Interest in any of the products, request or order them at Bio-Connect. NFκB Pathway Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T B +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F B +32 (0)2

More information

Chapter 3 Nucleic Acids, Proteins, and Enzymes

Chapter 3 Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

KATHOLIEKE HOGESCHOOL SINT-LIEVEN

KATHOLIEKE HOGESCHOOL SINT-LIEVEN KATHOLIEKE HOGESCHOOL SINT-LIEVEN DEPARTEMENT GENT CAMPUS GILDESTRAAT Bachelor in Biomedical laboratory technology Third year pharmacy and biotechnology Integrin Signalling Roselien Schelfaut 3FBT1 2004-2005

More information

GSI Equine VEGF ELISA Kit-DataSheet

GSI Equine VEGF ELISA Kit-DataSheet Vascular endothelial growth factor (VEGF), also known as vascular permeability factor (VPF) or vasculotropin, is a homodimeric 34-42 kda, heparin-binding glycoprotein with potent angiogenic, mitogenic

More information

Cells and Tissues. Overview CELLS

Cells and Tissues. Overview CELLS Cells and Tissues WIll The basic unit of structure and function in the human body is the cell. Each of a cell's parts, or organelles, as well as the entire cell, is organized to perform a specific function.

More information

Asier Jayo 1, Maddy Parsons 1 and Josephine C Adams 2* Abstract

Asier Jayo 1, Maddy Parsons 1 and Josephine C Adams 2* Abstract RESEARCH ARTICLE Open Access A novel Rho-dependent pathway that drives interaction of fascin-1 with p-lin-11/isl-1/mec-3 kinase (LIMK) 1/2 to promote fascin-1/actin binding and filopodia stability Asier

More information

Measuring Wound Healing and Cell Migration using Celigo Imaging Cytometer

Measuring Wound Healing and Cell Migration using Celigo Imaging Cytometer Measuring Wound Healing and Cell Migration using Celigo Imaging Cytometer Nexcelom Bioscience LLC. 360 Merrimack Street, Building 9 Lawrence, MA 01843 T: 978.327.5340 F: 978.327.5341 E: info@nexcelom.com

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),

More information

Interactions of cells with their environment; Engineering materials with biological recognition

Interactions of cells with their environment; Engineering materials with biological recognition Interactions of cells with their environment; Engineering materials with biological recognition Last time: Today: Reading: Supplementary Reading: Polyelectrolyte hydrogel swelling thermodynamics Applications

More information

Supplemental Material can be found at:

Supplemental Material can be found at: Supplemental Material can be found at: THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 16, pp. 11347 11356, April 21, 2006 Printed in the U.S.A. Robo4 Signaling in Endothelial Cells Implies Attraction

More information

Nucleic Acids, Proteins, and Enzymes

Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

Device to Dynamically Stretch Cells during Microscopic Visualization

Device to Dynamically Stretch Cells during Microscopic Visualization Project Number: KLB1101 Device to Dynamically Stretch Cells during Microscopic Visualization A Major Qualifying Project Submitted to the Faculty of the WORCESTER POLYTECHNIC INSTITUTE In partial fulfillment

More information

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro

More information

Eukaryotic Transcription

Eukaryotic Transcription Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).

More information