Justin Veazey. Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy

Transcription

1 Veazey 1 Justin Veazey 7A Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy Construction of recombinants GFPuv-pGEM-T easy and GFPuv-pUC19 Transformation and analysis of recombinant puc19 and pgem-t easy Plasmids into XL1 Blue E.coli

2 Veazey 2 Abstract: Digested puc19, pgem-t, and GFPuv PCR products were digested with EcoRI and HindIII respectively. Analyzed digested products through 1% Agarose Gel Electrophoresis. Digestion was observed through UV analysis and GFPuv was ligated into pgem-t easy and puc19 with T4 DNA ligase. GFPuv-pGEM-T easy and GFPuv-pUC19 were incorporated and transformed competent XL1-Blue E. coli. Successful transformation was verified through colony fluorescence under Ultraviolet(UV) light and growth on Lysogeny broth(lb) plates containing Ampicillin(amp), IPTG, and X-gal indicator. Electrophoresis of genetic fragment transformation was further verified via linear regression of UV analytical data when compared with ProMega lab results. (Promega) The sample was calculated to contain 758 base pairs (bp) via GFPuv and have a molecular mass of 5.00x10 5 Daltons with approximately 94% precision as calculated in respect to SnapGene findings. (GSL Biotech)

3 Veazey 3 Results The following were put through 1% agarose gel electrophoresis in Figure 1: GFPuv and puc19 digested with EcoRI and HindIII, undigested GFPuv, undigested puc19, E. coli DNA, and Kilobase plus ladder. Figure 1. 1% agarose Gel electrophoresis (units in bp) Lane 1: undigested puc19 2: digested puc19 3: Kilobase plus ladder 4: undigested GFPuv 5: digested GFPuv 6: E.coli The log 10 of base pairs of the kilobase ladder was graphed against the relative migration distance. A trend line was generated and used to calculate the relative size of the generated DNA fragments relative to the known kilobase plus DNA ladder.

4 Log (bp) Veazey Relative distance moved y = x R² = Figure 2: Log 10 (basepairs) vs Relative Migration-Distance of 1% Agarose Gel electrophoresis DNA samples of the successful recombinant GFPuv-pUC19 plasmid were digested and analyzed via 1% agarose gel electrophoresis: Non-recombinant puc19, recombinant puc19, recombinant pgem-t easy, non-recombinant pgem-t easy, GFPuv PCR product, and Kilobase plus DNA ladder are shown in Figure 3.

5 Log (bp) Veazey 5 Figure 3. 1% Agarose gel electrophoresis: Lanes 1-3: recombinant puc19 (unit in bp) 4: puc19 non-recombinant 5: recombinant pgem-t easy 6: non-recombinant pgem-t easy 7: GFPuv PCR product 8: Kilobase plus DNA ladder The results from the plot of relative migration distance verses the log 10 of the known kilo base plus standards can be seen in Figure y = x R² = Relative distance moved Figure 4. Log 10 (base pairs) Vs. Relative Migration-Distance

6 Veazey 6 Discussion The most prominent Lane in seen in Figure 1 is the double stranded undigested DNA of E.coli in lane 7. This lane is clearly overloaded as it bleeds into the other lanes and is overlysaturated compared to samples in other lanes. puc19 can be digested by EcoRI while HindIII can digest pgem-t. GFPuv, being exposed to both digestion enzymes,. Lanes 5 and 6 are of the pgem-t easy plasmids are displayed as slightly larger than the puc19 plasmids by having shorter relative migration distances. puc19 is 9 relative migration distance units below pgem- T easy and therefore smaller because it moved a larger distance through the agarose gel in the same amount of time. Though puc19 and pgem-t easy have differing sizes they share a similar sized band as the GFPuv PCR product that was being incorporated. The recombinant plasmid was introduced to competent E. coil cells and proven successful through growth and fluorescence on LB plates containing: ampicillin, IPTG, and X- gal. The recombinant colonies resulted in no color-positive tests while non-recombinant showed up as blue. Figure 3 is the result of DNA from successfully transformed E.coli cells being amplified through PCR and verified through electrophoresis. The pgem-t and pgem-t easy vectors were created by ligation with EcoR V. EcoRI V adds a 3` terminal thymidine to both ends of the vector helping to inhibit the re-circularization while also providing an easily assessed overhang for heat tolerant polymerases, such as the Taq polymerase we used, to bind to. (Promega) All lanes contain the GFPuv related band, yet the non-recombinant did not fluoresce in the LB medium under ultraviolet light, possibly signaling a non-functional incorporation of GFPuv. The fragment bands helped to portray the successful incorporation of GFPuv more accurately, signaled by the insertional inactivation of the β-galactosidase. The β-galactosidase inactivation

7 Veazey 7 is verified by the lack of color in the colony from the incomplete β-galactosidase cleavage of x- gal substrate indicator. A linear regressional analysis of data from Figures 1 and 3 established the relative size against the known values of kilobase plus DNA ladder. The trend-line also served to assess the accuracy of the 1% agarose gel with respect to the known laboratory 715 bp value of pgem-t easy. (GSL Biotech) Given that pgem-t easy is 3015bp, the calculations from Figure 2 demonstrate the laboratory pgem-t easy to be around 2854bp. (Promega) Thus, our experiments yielded a 94% precision of the measurements of the agarose standard of promega. puc19 fragments shown in Figure 3 calculate to 2515 ±125.7 bp. The GFPuv PCR product in Figure 3 yielded similar results as GFPuv in Figure 1. The average number of base pairs being an approximately 758bp. Our gel electrophoresis analysis yields a 94% accuracy which places our estimated value well within the 715bp seen in other professional laboratories. (GSL Biotech)

8 Veazey 8 References Alberts, B., Bray, D., Hopkin, K., Johnson, A., Lewis, J., Martin, R., et al. (2010). Essential cell biology (3rd ed.). New York, New York: Garland Science, Taylor & Francis Group. Groub 1B. (2011). Experiment 1: Microbiological Techniques and E.Coli Transformation. GSL Biotech. (n.d.). GFPuv. SnapGene. Chicago. Retrieved from ids/gfpuv/ Promega. Complete pgem-t + pgem-t Easy Maual.

9 Veazey 9 Questions 1. What is the cofactor that is required for the T4 DNA ligase catalyzed reaction? ATP 2. Why do we analyze the digested DNA samples (puc19 and GFPuv PCR product) before performing ligation? To ensure that puc19 and GFPuv are, infact, Digested. 3. The colorless E.coli colonies in our experiment contain the recombinant pgemt/gfpuv plasmid. Some of the colonies emit green fluorescence whereas others don t when they are irradiated with long wave U.V. light. Explain; There is two different ways that the GFPuv gene can be incorporated into pgemt-easy. In one confirmation yields the colorless colonies that have a functional version of the protein and the other does not have a functional version of GFPuv.

10 Veazey 10 Appendix: GFPuv was amplified through PCR utilizing the Forward primer: CCGAAGCTTGATGAGTAAAGGAGAAGAA CTTTTC and reverse primer: CCGGAATTCTTATTTGTAGAGCTCATCCA TGCC. 1 st GFPuv movement: units Formula for trendline of Kilobase v movment units: y = (207.5) ^ = nd GFPuv movement: 203 units Formula for trendline of Kilobase v movment units: y = (203) ^2.8727= Daltons=1 base pair ( )/2=750 Group 2 s Gel (Figure 1) Lane 1: (observed lines units from well) Lane2: 128 Lane 3 Ladder: 1000 kbp kbp kbp- 93 Lane4: (brightest) Lane 6: overloaded but 47 is center of first blob has traces of 1 and 5 has trases of 2 (the larger molecules) Light recombinant (Figure 3) Lane 1; (same through 4 with 4 being more concentrated) Lane (light bottom line) Lane 6: same as lane 5 but more concentrated(brighter) Lane 7: Lane8 ladder: 2000 kbp kbp kbp Possible references: H. ( 2,3 ) Watanabe, et al. "Development Of A puc19-based Recombinant Plasmid To Serve As A Positive Control In PCR For Orientia Tsutsugamushi."Microbiology And Immunology 53.5 (2009): Scopus. Web. 23 Mar Miura, H., Inoko, H., Tanaka, M., Ohtsuka, M., Inoue, I., & Sato, M. (2011). Simple cloning strategy using GFPuv gene as positive/negative indicator. Analytical Biochemistry, 416(2), doi: /j.ab Lane 5: (GFPuv)

11 Veazey 11

12 Veazey 12