1. Mitosis = growth, repair, asexual reproduc4on
|
|
|
- Oliver Sullivan
- 6 years ago
- Views:
Transcription
1 Places Muta4ons get passed on: Cell Reproduc4on: 2 types of cell reproduc4on: 1. Mitosis = growth, repair, asexual reproduc4on Photocopy machine Growth/Repair Passed on in the same body 2. Meiosis = sexual reproduc4on ½ of your gene4cs Gametes (egg and sperm) Passed on to offspring Parental (old) DNA molecule Daughter (new) strand Daughter DNA molecules (double helices) Figure 10.6 DNA polymerases: Are enzymes Make the covalent bonds between the nucleo4des of a new DNA strand Are involved in repairing damaged DNA Zannie Dallara 1
2 Chromosome (one long piece of DNA) Centromere Sister chroma>ds Duplicated chromosome Figure 8.UN2 DNA double helix Histones Beads on a string TEM Nucleosome Figure 8.4a DNA double helix Beads on a string Histones TEM Nucleosome Tight helical fiber Looped domains Duplicated chromosomes (sister chroma>ds) Centromere TEM Figure 8.4 Zannie Dallara 2
3 Tight helical fiber Looped domains Duplicated chromosomes (sister chroma>ds) TEM Centromere Figure 8.4b Chromosome (one long piece of DNA) Centromere Sister chroma>ds Duplicated chromosome Figure 8.UN2 Chromosome duplica>on Sister chroma>ds Chromosome distribu>on to daughter cells Figure 8.5 Zannie Dallara 3
4 Species Indian muntjac deer Koala Opossum Giraffe Mouse Human Duck- billed platypus Buffalo Dog Red viscacha rat Number of chromosomes in body cells Figure 8.2 DNA Replication WHAT 1. What: Making a copy of the DNA DNA Replica>on - WHAT Model: Semiconservative Model of Replication Idea presented by Watson & Crick The two strands of the parental molecule separate, and each acts as a template for a new complementary strand New DNA consists of 1 PARENTAL (original) and 1 NEW strand of DNA DNA Template Parental DNA New DNA Zannie Dallara 4
5 DNA Replication WHY 2. Why: Because we need to make more DNA for new cells Grow Repair DNA has to be copied before a cell divides New cells will need identical DNA strands DNA Replication WHERE 3. Where: Nucleus of eukaryotes Because that is where the DNA is DNA Replication HOW 4. How: Begins at Origins of Replication Two strands open forming Replication Forks (Y-shaped region) Helicase the enzyme unzips the DNA New strands grow at the forks 3 Parental DNA Molecule 5 3 Replication Fork 5 Zannie Dallara 5
6 How: Replication: 1st step Unwind DNA helicase enzyme unwinds part of DNA helix by breaking the weak hydrogen bonds between the nitrogenous bases helicase single- stranded binding proteins replica>on fork DNA Replication HOW As the 2 DNA strands open at the origin, Replication Bubbles form Prokaryotes (bacteria) have a single bubble Bubble Eukaryotic chromosomes have MANY bubbles Bubbles Bubbles Q: What Happens when the bubbles connect? Zannie Dallara 6
7 DNA Replication - Process Large team of enzymes coordinates replication HOW: Replication: 2nd step Build daughter DNA strand u DNA polymerase: adds new complementary bases DNA Polymerase III 3 rd step: Proofreading New DNA DNA polymerase initially makes about 1 in 10,000 base pairing errors Enzymes proofread and correct these mistakes The new error rate for DNA that has been proofread is 1 in 1 billion base pairing errors What do you notice about enzyme names? Zannie Dallara 7
8 Two Types of Cell Reproduc4on: Mitosis for growth and repair in mul4cellular organisms, or asexual reproduc4on in single celled organisms Meiosis for making sperm, eggs, or spores for sexual reproduc4on Both require DNA to be duplicated first. Transcrip4on and Transla4on Order Replication Transcription Translation DNA RNA Proteins 1. DNA 2. DNA è RNA (change the T s to U s) 3. Codons (start at Met AUG) 4. Ribosome reads Codons into Amino Acids 5. Amino Acids strung together with pep4de bonds 6. Protein Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different orders to make a variety of proteins Assembled on a ribosome Zannie Dallara 8
9 RNA vs. DNA DNA Double stranded Deoxyribose sugar Bases: C,G A,T RNA Single stranded Ribose sugar Bases: C,G,A,U Both contain a sugar, phosphate, and base. RNA RNA is a nucleic acid polymer that uses a slightly different sugar than DNA and the base uracil (U) in place of thymine (T). Transcription RNA forms base pairs with DNA C-G A-U Primary transcriptlength of RNA that results from the process of transcription Zannie Dallara 9
10 TRANSCRIPTION Make the complementary strand ACGATACCCTGACGAGCGTTAGCTATCG The Genetic Language Uses 4 Letters Written Into 3-Letter Words Major players in transcription mrna- (the m is for messenger): type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus Zannie Dallara 10
11 Major players in transcription RNA polymerasecomplex of enzymes with 2 functions: Unwind DNA sequence Produce primary transcript by stringing together the chain of RNA nucleotides Transcription is done what now? Now we have mature mrna transcribed from the cell s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mrna is made, but how do we read the code? Translation Second stage of protein production mrna is on a ribosome Zannie Dallara 11
12 Translation Second stage of protein production mrna is on a ribosome trna brings amino acids to the ribosome trna Function Amino acids must be in the correct order for the protein to function correctly trna lines up amino acids using mrna code Reading the DNA code Every 3 DNA bases pairs with 3 mrna bases Every group of 3 mrna bases encodes a single amino acid Codon- coding triplet of mrna bases Zannie Dallara 12
13 ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGG ACUG Start Which codons code for which amino acids? Genetic code- inventory of linkages between nucleotide triplets and the amino acids they code for A gene is a segment of RNA that brings about transcription of a segment of RNA Transcription vs. Translation Review Transcription Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mrna Translation Process by which information encoded in mrna is used to assemble a protein at a ribosome Occurs on a Ribosome mrna protein Zannie Dallara 13
14 The Central Dogma of Molecular Genetics Transcription Translation DNA RNA Protein Trait RNA processing Basic Genetic Mechanisms are Universal The storage of genetic information in DNA, the use of an RNA intermediate that is read in three letter words, and the mechanism of protein synthesis are essentially the same in all organisms. Among other things, this means cancer can be studied productively in flies or yeast. A tobacco plant expressing the firefly luciferase gene. It also means that human genes can be expressed in a plant or mouse genes in a yeast. Zannie Dallara 14
DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
Bundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
DNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
Protein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
Chapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
Bundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
RNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
Chapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.
Chapter 10 DNA: The Molecule of Heredity Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc. 10.1 What Is The Structure Of DNA? Deoxyribonucleic acid (DNA) is
DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
3. INHERITED MUTATIONS
THE CENTRAL DOGMA OF BIOLOGY 1. DNA B4.2 The genetic information encoded in DNA molecules provides instructions for assembling protein molecules. Genes are segments of DNA molecules. Inserting, deleting,
DNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
DNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.
DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types
DNA: The Molecule of Heredity
1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.
DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov
Protein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
Chapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
Adv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016
Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red
Nucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
STUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
Gene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
RNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
DNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
DNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
UNIT 4. DNA, RNA, and Gene Expression
UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain
Nucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling
Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
Unit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis
Prokaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
Chapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
CHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith
CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:
DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
The common structure of a DNA nucleotide. Hewitt
GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided
Chapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
Gene Expression REVIEW Packet
Name Pd. # Gene Expression REVIEW Packet 1. Fill-in-the-blank General Summary Transcription & the Big picture Like, ribonucleic acid (RNA) is a acid a molecule made of nucleotides linked together. RNA
DNA REPLICATION REVIEW
Biology Ms. Ye DNA REPLICATION REVIEW 1. Number the steps of DNA replication the correct order (1, 2, 3): Name Date Block Daughter strands are formed using complementary base pairing DNA unwinds The DNA
Central Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)
Ch. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
DNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
Do you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
Name Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
Molecular Biology of the Gene
Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides
DNA Structure and Protein synthesis
DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making
DNA: The Molecule of Heredity
DNA: The Molecule of Heredity STRUCTURE AND FUNCTION - a nucleic acid o C, H, O, N, P o Made of nucleotides = smaller subunits o Components of nucleotides: Deoxyribose (simple sugar) Phosphate group Nitrogen
Fig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
Pre-Lab: Molecular Biology
Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double
THE COMPONENTS & STRUCTURE OF DNA
THE COMPONENTS & STRUCTURE OF DNA - How do genes work? - What are they made of, and how do they determine the characteristics of organisms? - Are genes single molecules, or are they longer structures made
Molecular Genetics I DNA
Molecular Genetics I DNA Deoxyribonucleic acid is the molecule that encodes the characteristics of living things. It is the molecule that is passed from a mother cell to daughter cells, and the molecule
Read and take notes on pages
Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have
What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.
DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose
Nucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
DNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
DNA, RNA and Protein Synthesis
By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude
Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
Protein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
Comparing RNA and DNA
RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd
DNA Replication AP Biology
DNA Replication 2007-2008 Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.
GENETICS and the DNA code NOTES
GENETICS and the DNA code NOTES BACKGROUND DNA is the hereditary material of most organisms. It is an organic compound made of two strands, twisted around one another to form a double helix. Each strand
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
Click here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis
Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the
DNA: Structure and Replication - 1
DNA: Structure and Replication - 1 We have briefly discussed that DNA is the genetic molecule of life. In eukaryotic organisms DNA (along with its histone proteins) is found in chromosomes. All cell activities
DNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
Protein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
Vocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase
DNA and Replication TEKS (6) Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: (A)
The Molecular Basis of Inheritance
The Molecular Basis of Inheritance Chapter 16 Objectives Describe the contributions of the following people: Griffith; Avery, McCary, and MacLeod; Hershey and Chase; Chargaff; Watson and Crick; Franklin;
DNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
Active Learning Exercise 9. The Hereditary Material: DNA
Name Biol 211 - Group Number Active Learning Exercise 9. The Hereditary Material: DNA Reference: Chapter 16 (Biology by Campbell/Reece, 8 th ed.) 1. a.) What is a nucleotide? b.) What is a nitrogen base?
Microbiology: The Blueprint of Life, from DNA to protein
Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing
Activity A: Build a DNA molecule
Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions
Ch 12 DNA and RNA. Frederick Griffith's Experiment. DNA Structureand REplication.notebook. May 02, 2012
Ch 12 NA and RNA 12.1 NA A. Genetics Study of Inheritance and the passing down of Inherited Characteristics. NA is passed down from parents to offspring on Chromosomes= Long strands of NA B. In order to
DNA: Structure and Replication - 1
DNA: Structure and Replication - 1 We have briefly discussed that DNA is the genetic molecule of life. In eukaryotic organisms DNA (along with its histone proteins) is found in chromosomes. We have also
Fig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm
Fig. 16-7a end Hydrogen bond end 1 nm 3.4 nm 0.34 nm (a) Key features of DNA structure end (b) Partial chemical structure end Fig. 16-8 Adenine (A) Thymine (T) Guanine (G) Cytosine (C) Concept 16.2: Many
GAUTENG DEPARTMENT OF EDUCATION SENIOR SECONDARY INTERVENTION PROGRAMME. LIFE SCIENCE Grade 12 Session 9: Nucleic Acids DNA and RNA (LEARNER NOTES)
Learner Note: Please ensure that you understand that the nucleus is an organelle located in a cell. Go through the structure of DNA and RNA very carefully. You MUST understand the structure and combination
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28
Chapter 15 DNA and RNA
Chapter 15 DNA and RNA www.mrcbiology.com 1 Variation Variation means that individuals in a species have different characteristics to one another. Acquired Variation are not inherited. e.g learnt during
Transcription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
DNA Structure and Replication
Name: DNA Structure and Replication 1. DNA: Deoxyribonucleic Acid a. Credit for discovery is given to Watson & Crick b. DNA stands for c. This chemical substance is present in the of all cells in all living
The Central Dogma of Molecular Biology
The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction
8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information