Artificial Nucleic Acids -Their Developments and Recent Applications
|
|
- Duane Preston
- 6 years ago
- Views:
Transcription
1 Artificial Nucleic Acids -Their Developments and Recent Applications Bioorganic Chemistry Laboratory D2 Kenichiro Ito Organic Seminar 2012/5/7 1
2 Nucleic acids play central roles in life Replication Transcription Translation DNA (Reverse Transcription) mrna (RNA) Protein Central Dogma DNA Forms stable duplex by the Watson- Crick base pairing RNA Basically single-stranded (Also can form higher structure) 2
3 Targeting DNA DNA stores genetic information in vivo Mutation in genomic DNA can cause genetic diseases Genomic DNA Probe Detecting mutations in genomic DNA prediction of genetic diseases Wild type genome Mutated genome Easy detection of mutations in DNA 3
4 Targeting mrna Normal mrna Translation Defective mrna Antisense oligonucleotides -hybridize and block translation Normal proteins Defective proteins Diseases mrna is a potent drug target for therapeutics sirna oligonucleotides RISC Degradation -induce RNAi with RISC protein complex and degrade targeted RNA 4
5 Structures and interactions of DNA and RNA DNA Adenine (A) Thymine (T) RNA Adenine (A) Uracil (U) Phosphodiesterbackbone Cytosine (C) Guanine (G) Cytosine (C) Guanine (G) Recognitions of DNA and RNA are defined by base pairings of Watson-Crick s rule Easy to design nucleic acids-based targeting molecules 5
6 Tools for DNA/RNA targeting Nuclease resistance Sequence recognition Recognition of mismatched base pair Natural nucleic acids Poor (Natural phosphodiester linkage) Fixed (Four general bases) Normal Artificial nucleic acids Good (non-natural backbone) Tunable (modified base) Good (flexibility of backbone) Toxicity Low Low (*up to the modification) Artificial nucleic acids are more useful tools than natural ones in DNA/RNA targeting in vivo and in vitro 6
7 Table of contents Base modifications ( Tuning base pairing) Backbone modifications 1. PNA (Peptide nucleic acid) 2. BNA (Bridged nucleic acid) 3. UNA (Unlocked nucleic acid) 7
8 Base modification- G-Clamp G-Clamp: Cytosine nucleobase with 9-(2-guanidinoethoxy) phenoazide G C G:C 3 hydrogen bonds K. Lin and M. D. Matteucci, J. Am. Chem. Soc. 1998, 120, C. J. Wilds et al. Angew. Chem. Int. Ed. 2002, 41, 115. G-Clamp G:G-Clamp 5 hydrogen bonds 1 substitution of C to G-Clamp Tm (10 bp) = +18 C G 8
9 Base modification Us and D for PNA T A A:T 2 hydrogen bonds 2-thiouracil (Us) J. Lohse et al. Proc. Natl. Acad. Sci. USA, 1999, 96, ,6-diaminopurine (D) G. Haaima et al. Nucleic Acids Res. 1997, 25, Incorporated into PNA Stabilization of PNA/DNA duplex Destabilization of PNA/PNA duplex A D Us T Us A:Us 2 hydrogen bonds D:T 3 hydrogen bonds Higher affinity to natural nucleic acids, Avoiding self-duplex forming of PNA D D:Us 2 hydrogen bonds Steric hindrance 9
10 Backbone modification #1: PNA- peptide nucleic acid PNA: DNA mimic with poly[n-(2-aminoethyl)glycine] backbone DNA PNA Phosphodiester bond Amide bond PNA is charge-neutral, while DNA has negative charges P. E. Nielsen, et al. Science. 1991, 254, DNA/PNA has no electrostatic repulsion and more stable than DNA/DNA duplex PNA is resistant to degradation by nucleases 10
11 DNA detection using PNA probes- Molecular beacon PNA Molecular beacon (for detection of a point mutation in DNA) DABCYL (quencher) Fluorescein 1. Wild-type DNA 2. DNA with a mutation DNA recognition sequence Hybridization Gap-cleaving enzyme S. Ye et al. Anal. Biochem. 2007, 363, 300. Fluorescence Quench
12 Backbone modifications of PNA Further modifications of PNA backbone have been achieved. PNA (Standard) Positive charges and chirality Lys-PNA (D-Lysine side chain) Rigidity Cyp-PNA (trans-cyclopentyl linkage) Backbone is fixed in the best angle by the linkage lower entropy cost Electrostatic stabilization of PNA/DNA duplex D-lysine can give rigidity of right-handed helical structures for DNA/PNA duplex S. Sforza et al. Eur. J. Org. Chem. 2000, J. K. Pokorski et al, J. Am. Chem. Soc. 2004, 126,
13 Artificial nucleic acids for RNA targeting in vivo For in vivo use, artificial nucleic acids need Low-toxicity High resistance to nucleases High binding affinity to DNAs or RNAs Easy transfection Being recognized by several proteins (PNA) Improvement is necessary for in vivo usage RNA is more potent target in vivo 1.Antisense oligonucleotide 2.siRNA oligonucleotide a 1.BNA (Bridged nucleic acid) 2.UNA (Unlocked nucleic acid) 13
14 Backbone modification #2: BNA- bridged nucleic acid 2,4 -BNA: 2 -O, 4 -C-methylene- -D-ribofuranosyl monomer 2,4 -BNA DNA C2 -endo C3 -endo RNA Locked in C3 -endo pucker J. Wengel, Acc. Chem. Res. 1998, 32, 301. S. Obika Tetrahedron Lett. 1998, 38, C2 -endo C3 -endo 14
15 DNA 2,4 -BNA prefers A-type duplex 2,4 -BNA O4 -endo Energy C3 -endo C2 -endo B-type duplex C3 -endo locked RNA Stable as A-type duplex O4 -endo Energy C2 -endo A-type duplex Contribution to stability of 2,4 -BNA/RNA duplex C3 -endo K. A. Brameld et al. J. Am. Chem. Soc. 1999, 121,
16 2,4 -BNA is compatible with in vivo usage 1. High resistance to nucleases (in blood serum) DNA BNA, DNA chimera 2. Low toxicity (no febrile reaction of mice) Remaining nucleic acid duplex Time (min) BNA 3. Easy transfection with general transfection reagents Highly compatible with in vivo usage PS: Phosphorothioate DNA Highly resistant to nucleases C. Wahlestedt et al. Proc. Natl. Acad. Sci. USA, 2000, 97,
17 Further bridges of BNA 2,4 -BNA (LNA) Ethylene-BNA (ENA) N-methyl-BNA (BNA NC ) K. Morita et al. Bioorg. Med. Chem. Lett. 2002, 12, 73. S. M. A. Rahman et al. Angew. Chem. Int. Ed. 2007, 46, RNA selectivity Good Good Very Good Nuclease resistance Good Very Good Very Good 17
18 Backbone modification #3: UNA- unlocked nucleic acid RNA UNA Flexible structure by lacking the C2 -C3 - bond of the ribose ring of RNA P. Nielsen et al. Bioorg. Med. Chem. Lett. 1995, 3, 19. Single-stranded RNA RNA duplex RNA/UNA duplex Unfavorable enthalpy loss reduction of duplex stability 18
19 UNA is highly suitable for sirna 1. UNA has high nuclease resistance. Stability of natural sirna and 2, 4 -BNA (LNA) or UNA-modified sirna in mice: Natural RNA BNA/UNA M. B. Laursen et al. Mol. Biosyst. 2010, 6,
20 UNA is highly suitable for sirna 2. UNA-modified sirna can reduce off-targeting Off-targeting (genes) Natural sirna + UNA at the ends + UNA at 7 th position of antisense Natural RNA UNA N. Vaish et al. Nucleic Acids Res. 2011, 39,
21 Summary of backbone modified artificial nucleic acids Nuclease resistance PNA BNA UNA Very High High High Binding affinity Strong Strong Weak Reduction of off-targeting Good Good Very Good (Tunable) Transfection Difficult Easy Easy Compatibility with enzymes Poor Good Good Probe Antisense oligo sirna oligo : Very suitable : usable : not usable 21
22 Summary Nucleic Acids 1. Base modifications 2. Backbone modifications Tuning of base pairings -Stronger base pairs -Repulsion of modified bases Unique nucleic acids such as PNA probes BNA antisense oligos UNA sirna Practical usage for researches and therapeutics (As nucleic acid drugs and research tools) 22
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More informationStructural Bioinformatics (C3210) DNA and RNA Structure
Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit
More informationCentral Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)
More informationDNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationDNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationDivision Ave. High School Ms. Foglia AP Biology. Nucleic acids. AP Biology Nucleic Acids. Information storage
Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 1 DNA Nucleic Acids Function: u genetic material stores information w genes w blueprint for building proteins n DNA RNA proteins transfers
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationThe Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines
DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic
More informationRNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.
The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,
More informationChapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning
More informationDNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More informationDNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More informationCHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith
CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:
More informationThe Central Dogma of Molecular Biology
The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction
More informationNucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,
More informationCHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis
More informationChapter 3 Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
More informationNucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and
More informationFrederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria
Frederick Griffith Live Smooth Bacteria Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S Bacteria Live Smooth Bacteria Frederick Griffith Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationNucleic acids AP Biology
Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 Nucleic Acids Function: u genetic material DNA stores information w genes w blueprint for building proteins n DNA RNA proteins transfers
More informationSmart Oligo & Probe Design
roduct rofile Custom ligo Synthesis, antisense oligos, RA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sira, 2'-F bases; 2-5 linked ligos Smart ligo & robe Design For research
More informationDNA & Protein Synthesis #21
Name: Period: Date: Living Environment Lab DNA & Protein Synthesis #21 Introduction Of all the molecules that is in the body, DNA is perhaps the most important. DNA or dioxiribosenucleic acid is important
More informationReview of ORGANIC CHEMISTRY
Nucleic Acids: DNA Review of ORGANIC CHEMISTRY Definition: Contains CARBON (C) and Hydrogen (H) Large polymers can be made of smaller individual monomers. Ex: For carbohydrates, polysaccharides are large
More informationRNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation
RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss
More informationNUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More informationChapter 8 Nucleotides & Nucleic Acids
Chapter 8 Nucleotides & Nucleic Acids We Need Nucleic Acids! RNA rrna DNA RNA mrna Protein Protein Trait Pol trna DNA contains genes, the information needed to synthesize functional proteins and RNAs DNA
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationDNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.
DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types
More informationBCMB Nucleic Acids - Chapter 33. DNA is the genetic component of life
BCMB 3100 - Nucleic Acids - Chapter 33 Discovery of DNA Nucleotides, nucleosides & bases Polynucleotides DNA as genetic material Structure of double-stranded DNA Chromatin RNA Nucleases 1 DNA is the genetic
More informationRNA Part I: Chemical Structure of RNA
RA Part I: Chemical Structure of RA Structural differences between RA and DA Resistance of phosphate esters to basic hydrolysis The 2 - group of RA facilitates chemical cleavage in aqueous a by forming
More informationNON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28
More informationDNA - The Double Helix
Name Date Period DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including
More informationsirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
More information24.5. Lesson 24.5 Nucleic Acids. Overview. In this lesson, you will cover the topics of DNA replication, gene mutation, and DNA technologies.
24.5 Lesson 24.5 Nucleic Acids Objectives 24.5.1 Identify the functions of DNA and RNA. 24.5.2 Identify the number of bases of DNA required to specify one amino acid in a peptide chain. 24.5.3 Explain
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationNucleic Acids and the RNA World. Pages Chapter 4
Nucleic Acids and the RNA World Pages 74-89 Chapter 4 RNA vs. Protein Chemical Evolution stated that life evolved from a polymer called a protein. HOWEVER, now many scientists question this. There is currently
More informationUNIT 4. DNA, RNA, and Gene Expression
UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain
More informationLecture 2: Central Dogma of Molecular Biology & Intro to Programming
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints
More informationUnit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
More informationDNA Replication AP Biology
DNA Replication 2007-2008 Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationDNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationBiochemistry study of the molecular basis of life
Biochemistry : An Introduction Biochemistry study of the molecular basis of life n Study of the chemistry of living organisms Studies organic molecules & organic reactions in living organisms n Living
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationDNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
More informationDNA & DNA Replication
DNA & DNA Replication DNA Structure How did Watson and Crick contribute to our understanding of genetics? Watson and Crick developed the double helix model for DNA DNA Structure What is a double helix?
More information1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
More informationMolecular Biology of the Gene
Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationDNA: The Molecule of Heredity
1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate
More informationNUCLEIC ACIDS: DNA AND RNA. HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University
NUCLEIC ACIDS: DNA AND RNA HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1 BUILDING BLOCKS OF NUCLEIC ACIDS 2 Nucleic Acids are important for
More informationDNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
More informationName: Date: Pd: Nucleic acids
Name: Date: Pd: DNA - The Double Helix Nucleic acids Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of
More informationTHE COMPONENTS & STRUCTURE OF DNA
THE COMPONENTS & STRUCTURE OF DNA - How do genes work? - What are they made of, and how do they determine the characteristics of organisms? - Are genes single molecules, or are they longer structures made
More informationBrief History. Many people contributed to our understanding of DNA
DNA (Ch. 16) Brief History Many people contributed to our understanding of DNA T.H. Morgan (1908) Frederick Griffith (1928) Avery, McCarty & MacLeod (1944) Erwin Chargaff (1947) Hershey & Chase (1952)
More informationGriffith Avery Franklin Watson and Crick
to. Protein Griffith Avery Franklin Watson and Crick Although Mendel understood that we inherit information, he didn t know how In 1928 Frederick Griffith was studying two forms of bacteria species One
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More information1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).
1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil
More information4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.
1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationDNA Replication AP Biology
DNA Replication 2007-2008 Watson and Crick 1953 article in Nature Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationDNA Replication. Packet #17 Chapter #16
DNA Replication Packet #17 Chapter #16 1 HISTORICAL FACTS ABOUT DNA 2 Historical DNA Discoveries 1928 Frederick Griffith finds a substance in heat-killed bacteria that transforms living bacteria 1944 Oswald
More informationBIOCHEMISTRY Nucleic Acids
BIOCHEMISTRY Nucleic Acids BIOB111 CHEMISTRY & BIOCHEMISTRY Session 17 Session Plan Types of Nucleic Acids Nucleosides Nucleotides Primary Structure of Nucleic Acids DNA Double Helix DNA Replication Types
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationCentral Dogma of Biology DNA RNA. Protein
Central Dogma of Biology DNA Mostly only in viruses RNA In all cells Protein Processes in the central dogma (Mostly) RNA virus processes DNA Cellular processes Replication Reverse transcription Transcription
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationAP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationThe Molecul Chapter ar Basis 16: The M of olecular Inheritance Basis of Inheritance Fig. 16-1
he Chapter Molecular 16: he Basis Molecular of Inheritance Basis of Inheritance Fig. 16-1 dditional Evidence hat DN Is the Genetic Material It was known that DN is a polymer of nucleotides, each consisting
More informationWhat is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
More informationDNA: The Molecule of Heredity How did scientists discover that genes are made of DNA?
DNA: The Molecule of Heredity How did scientists discover that genes are made of DNA? By the late 1800s, scientists knew that genetic information existed as distinct units called genes. hapter 11 By the
More informationDo you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationDNA Structure and Replication
Name: DNA Structure and Replication 1. DNA: Deoxyribonucleic Acid a. Credit for discovery is given to Watson & Crick b. DNA stands for c. This chemical substance is present in the of all cells in all living
More informationDepartment. Zoology & Biotechnology QUESTION BANK BIOTECHNOLOGY SEMESTER-V
Department of Zoology & Biotechnology QUESTION BANK BIOTECHNOLOGY SEMESTER-V Unit-1 Genetic Material Different forms of DNA(DNA topology):- B-form, Z-form, D-form; Gene structure-introns,exaons and pseudogenes:
More information