Nodes of regulation in cellular systems
|
|
- Octavia Owens
- 6 years ago
- Views:
Transcription
1 Nodes of regulation in cellular systems cell membrane signal transduction ligands receptors oligomerization transport signal transduction modified protein Golgi transcription factor transport ER transport activation protein posttranslational modification poly-ubiquitination degradation nucleus DNA transcription splicing pre-mrna processing pre-micro-rna mrna micro-rna transport mrna translation micro-rna 5 degradation
2 Specific cell ablation or cell labeling in transgenic mice loxp loxp Stop DTR (Diphteria toxin receptor) good promoter (e.g. pcaggs) loxp Stop cross-breeding with a cell-type specific Cre strain DTR is expressed only in specific cell types injection of diphteria toxin leads to specific killing of these cells loxp EYFP (enhanced yellow fluorescent protein) good promoter (e.g. pcaggs) > fluorescent labeling of a specific cell type of interest 13
3 Transfections Usually designates the incorporation of DNA into mammalian cells. DNA present in form of plasmids. Transient Transfection: plasmid remains outside of the genome and is slowly lost (degradation, dilution by cell division), exception: episomal replication e.g. SV40-Plasmids in COS-cells). The transfection efficiency varies but can reach close to 100% Stable Transfection: integration of foreign DNA into the genome (Efficiency: usually below 0.1%). Isolation of stably transfected clones requires selection genes (for antibiotic resistance, e.g. puromycin, G418 ). Plasmids are usually linearized before transfection to increase the possibility of correct integration. 41
4 Professional Design of sirna or shrna Design via company website This delivers a list of several possible sequences (gene specific, checked by BLAST) with a score based on empirically determined criteria: Nature Biotechnology 22, , 2004 Check literature for functional sirna sequences For transduction of primary cells: lentiviral shrna constructs (also work in non dividing cells) there are also inducible lentiviral constructs available ( Many vectors can also be obtained from plasmid repositories: Addgene: Belgian repository: 71
5 Molecular weight assessment after SDS-PAGE log[mw] migration distance starting from stacking gel/separation gel interface 80
6 EMSA s (Electrophoretic mobility shift assays) used to monitor active transcription factors (by binding to short, labeled oligonucleotides comprising the bound DNA sequence) Example: comp.: competitor: non-labeled ds-oligo of the same sequence (usually added in > 10-fold molar excess) competes with the labeled oligo for binding to the TF > reduces the specific signal mut.comp.: mutated competitor: should not compete for specific binding
7 EMSA Alternative: ABCD Assay (Avidin-Biotin Complex with DNA) TF dsoligo Biotin Streptavidin 87
8 Microscopy: Human vision and the concept of magnification image formation in the human eye 2-step magnification principle of a microscope with 2 lenses: objective and eye piece (occular) 185
9 Basics of optical resolution I Fine structures induce a diffraction of light (light of zero-order, 1st order...). Light diffraction on a small iris is more or less equal to diffraction on small cellular structures: sinθ(1) = 1.22(λ/d) θ... angle to the first light minimum λ... wavelength d... diameter of the iris for very small angles θ: θ(1) 1.22(λ/d) objects that are closer than θ(1) cannot be resolved as separate objects 186
10 Basics of optical resolution II The more orders of light are resolved the better is the resolution. The optical resolution that can be achieved is defined by the so called numerical Aperture (N.A.) of the objective. N.A. = i sin q i... Refraction index of the medium (e.g. 1.0 for air, up to 1.56 for oil) q... half of the objective opening angle (Aperture) 187
11 Phase contrast Unstained objects such as cells slow down the light (the phase of the passing light) by ¼ λ. Phase contrast rings in the objective can accelerate the light, which does not pass through cells by ¼ λ, the resulting difference of ½ λ causes an interference, which leads to contrast enhancement. ¼ λ ½ λ 194
12 Fluorescence Filter Cubes The filter cube consists of: 1. Excitation filter: just the correct excitation light (wavelength) passes the filter 2. Dichroic mirror: is reflective for the excitation light but transmittent for the emission light (the emitted fluorescence) separates excitation from fluorescence light sample 3. Emission filter: filters the emitted light so that just the correct wavelength (e.g. in double fluorescence) reaches the detector 207
13 Protocol of an immunofluorescence staining Fixation: 15 min 4% Paraformaldehyd 3x 5 min mit TBST wash (50mM Tris- HCl ph7.4, 150 mm NaCl, 0.1%Triton) Block: 1 h at RT with 3% BSA in TBS Incubation with 1. Ab: anti-iκb (rabbit polyclonal, sc-371 Santa Cruz) 1:300 in TBS/3% BSA, over night at 4 C (or 1 h at 37 C). 2x 5 min wash with TBST, 1x 5 min with TBS Incubation with Alexa488 goat antirabbit 1:2000 in TBS/BSA: 1 h at 37 C 3x 5 min wash with TBST, 1x 5 min with TBS Mounting 215
14 Confocal microscopy removes the blur from thicker objects
15 Optical sectioning and 3Dprojections z-stack Acquisition of a z-stack (image slices along the z- axis) allows reconstruction of a 3D-projection, which can be shown as animation projection 3D rendering 220
16 Spectral imaging Resolving spectral information on a pixel-by-pixel basis Emission finger printing : emission scan of a microscopy sample ( lambda stack of images) at a given excitation wavelength (e.g. with Zeiss LSM META systems or with Leica confocal microscopes ) Alternative: Excitation scan (at a constant emission wavelength; e.g. using a monochromator light source) Combinations of excitation and emission finger printing (e.g using filter wheels) Increases the number of markers to be measured in parallel Can be used to discriminate fluorophores with overlapping spectra Can be used to discriminate specific fluorescence from autofluorescence Leica concept Zeiss META concept 221
17 Spectral imaging example I: CFP, GFP and YFP 224
18 Spectral imaging example II: strongly overlapping dyes SYTOX Green (nucleus), Alexa Fluor 488 conjugated to phalloidin (filamentous actin network), and Oregon Green 514 conjugated to goat anti-mouse primary antibodies (targeting mitochondria). Invitrogen Spectra Viewer home/products-and- Services/Applications/Cell- Analysis/Labeling- Chemistry/Fluorescence- SpectraViewer.html 225
19 Separation of specific fluorescence from autofluorescence by spectral imaging 226
20 FRAP: Fluorescence Recovery After Photobleaching FRAP at the membrane Non linear regression analysis y = span (1-e -kx ) + bottom An image is taken then a region of the cell is bleached by high laser intensity, followed by a time series of images after bleaching. Briefly after bleaching the region is significantly darker and then the fluorescence intensity increases again (fluorescence reoovery) due to diffusion of molecules into the bleached area. The kinetics of recovery depends on the diffusion coefficience; the extent of recovery (the plateau to which the fluorescence recovers) is a measure of the overall mobility (the fraction of mobile molecules versus molecules immobilized, e.g. to the cytoskeleton) FRAP in the cytosol: 236
21 FLIP: Fluorescence Loss in Photobleaching to determine the dynamic shuttling of molecules between different compartments of the cell A certain compartment A (e.g. the cytosol) 120 is repetitively bleached by the laser and 100 the fluorescence decrease in a different 80 compartment B is monitored by time lapse microscopy. Molecules that shuttle from B 60 to A are bleached in A > thus the 40 compartment B gets dimmer when there is 20 a dynamic distribution of molecules between A and B. 0 cytosol nucleus
22 FLIP to determine a nuclear export signal and a nucleolar localization signal NFκB inducing kinase truncated NIK without the export sequence: nuclear FLIP (bleach in nucleus outside nucleoli) nuclear nucleolar sec
23 FCS: Fluorescence Correlation Spectroscopy to determine diffusion coefficients and interactions between molecules. The sample is illuminated by the laser at a very small spot, the movements of molecules in this spot (in and out) cause fluorescence fluctuations, which are analyzed by correlation functions
24 Spectral crosstalk of donor and acceptor ECFP and EYFP-Scans 1.2 relative fluorescence raw FRET-channel: Donor Excitation + Acceptor Emission nm Excitation window of donor Emission window of acceptor Problems: 1. Co-excitation of the acceptor at the Donor-excitation wavelength > Non-FRET-Fluorescence in the raw-fret channel 2. Signal-overlap of donor into the acceptor channel > Non-FRET fluorescence in the raw-fret channel 249
25 3-Filter FRET Microscopy 3 Images are taken (under constant camera settings): 1. Donor (e.g. CFP-excitation and emission), 2. Acceptor (e.g.yfp-excitation and emission this signal is not affected by FRET 3. FRET-Filter (raw FRET: CFP-excitation and YFP-emission). A normalized FRET signal (image) can be calculated by using correction factors obtained with single stained samples: FRETc = I FRET -corr CFP x I CFP corr YFP x I YFP corr CFP : ca corr YFP : ca CFP / YFP neg. control CFP-YFP pos. control 251
26 FRET microscopy example corrected FRET = I FRET -corr CFP x I CFP corr YFP x I YFP sample Donor channel Acceptor channel FRET channel corr. factor corrected FRET CFP alone YFP alone non-bound CFP + YFP bound CFP-YFP neg. control Donor Acceptor corrected FRET normalized FRET Normalized FRET (normalized to diff. expression levels): = sample 252
27 FRET Microscopy by acceptor bleaching and monitoring donor recovery (do not use for CFP / YFP) Donor recovery after acceptor bleaching: An image of the donor in the presence of the acceptor is taken, then the acceptor is bleached (partially), followed by acquisition of a second donor image Donor FRET Acceptor Donor Acceptor 255
28 FRET analysis with self-written ImageJ macro neg. control Negative Control sample IKK1+Myc 1 sample IKK2+ Myc 2 sample
Partha Roy
Fluorescence microscopy http://micro.magnet.fsu.edu/primer/index.html Partha Roy 1 Lecture Outline Definition of fluorescence Common fluorescent reagents Construction ti of a fluorescence microscope Optical
More informationSpectral Separation of Multifluorescence Labels with the LSM 510 META
Microscopy from Carl Zeiss Spectral Separation of Multifluorescence Labels with the LSM 510 META Indians living in the South American rain forest can distinguish between almost 200 hues of green in their
More informationResolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f
Microscopes and Microscopy MCB 380 Good information sources: Alberts-Molecular Biology of the Cell http://micro.magnet.fsu.edu/primer/ http://www.microscopyu.com/ Approaches to Problems in Cell Biology
More informationPractical light microscopy: an introduction
Practical light microscopy: an introduction Dr. Mark Leake, Oxford University www.physics.ox.ac.uk/users/leake Aim of today s talk: Explanation of the very (very) basics of how a light microscope works
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationFLUORESCENT PEPTIDES. Outstanding Performance and Wide Application Range
FLUORESCENT PEPTIDES Peptides and amino acids labeled with and Tide Quencher TM We offer peptides and amino acids tagged with fluorescent dyes. They meet highest demands in fluorescence intensity and photo-stability,
More informationChallenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor
Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationCytoPainter Golgi Staining Kit Green Fluorescence
ab139483 CytoPainter Golgi Staining Kit Green Fluorescence Instructions for Use Designed for the detection of Golgi bodies by microscopy This product is for research use only and is not intended for diagnostic
More informationConfocal Microscopes. Evolution of Imaging
Confocal Microscopes and Evolution of Imaging Judi Reilly Hans Richter Massachusetts Institute of Technology Environment, Health & Safety Office Radiation Protection What is Confocal? Pinhole diaphragm
More informationDolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system
Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION
More informationMasayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies
Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,
More informationDescription: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
More informationQImaging Camera Application Notes Multicolor Immunofluorescence Imaging
QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody
More informationIntroduction to Fluorescence Jablonski Diagram
ntroduction to Fluorescence Jablonski Diagram Excited Singlet Manifold S1 internal conversion S2 k -isc k isc Excited riplet Manifold 1 S0 k nr k k' f nr fluorescence k p phosphorescence Singlet round
More informationHow to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationIntroduction to N-STORM
Introduction to N-STORM Dan Metcalf Advanced Imaging Manager Outline Introduction Principles of STORM Applications N-STORM overview Biological Scale Mitochondrion Microtubule Amino Acid 1Å Kinesin 1nm
More informationFlow Cytometry - The Essentials
Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationhfab Rhodamine Housekeeping Antibodies
hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine
More informationHow to perform-control immunostaining experiment - microscopist subjective point of view. Pawel Pasierbek
How to perform-control immunostaining experiment - microscopist subjective point of view. Pawel Pasierbek Immunolabeling and fluorescent detection became such a standard procedure in the biomedical research
More informationGenetically targeted all-optical electrophysiology with a transgenic Credependent
Genetically targeted all-optical electrophysiology with a transgenic Credependent Optopatch mouse Short title: Transgenic Optopatch mouse Shan Lou 1, Yoav Adam 1, Eli N. Weinstein 1,4, Erika Williams 2,
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationLab 1A: Microscopy I. Name: Section:
Lab 1A: Microscopy I A response is required for each item marked: (# ). Your grade for the lab 1 report (1A and 1B combined) will be the fraction of correct responses on a 50 point scale[(# correct/# total)
More informationCationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery
Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery Sriram Vaidyanathan, 1 Junjie Chen, 2 Bradford G. Orr, 3 Mark M. Banaszak Holl
More informationSuper-resolution Microscopy
Semr oc kwhi t epaperser i es : 1. Introduction Super-resolution Microscopy Fluorescence microscopy has revolutionized the study of biological samples. Ever since the invention of fluorescence microscopy
More informationAzure Biosystems Western Blotting Workflow
Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.
Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image
More informationTest Your Plate Reader Set-up Before Using LanthaScreen Eu Assays
Test Your Plate Reader Set-up Before Using LanthaScreen Eu Assays Purpose This LanthaScreen Eu Microplate Reader Test provides a method to verify the ability of your fluorescent plate reader to detect
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationBasic Fluorescence Microscopy and Sample Preparation. Eva Wegel
Basic Fluorescence Microscopy and Sample Preparation Eva Wegel eva.wegel@bioch.ox.ac.uk Visible Light 390 700 nm visible to the human eye White light is split into its components through a prism Reason:
More informationFluorescent Nanoparticles for Western Blotting
imaging tech note 3179 Fluorescent Nanoparticles for Western Blotting Kevin McDonald, Ahmed Elbaggari, and Marina Pekelis, Bio-Rad Laboratories, Inc., Hercules, CA 94547 USA Introduction Western blotting
More informationTotal Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices.
DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support
More informationLab module 6b Receptor-mediated endocytosis
Goal for the module Lab module 6b Receptor-mediated endocytosis To follow the movement of a degraded ligand, LDL, and a recycled ligand, transferrin, as they undergo endocytic processing. Pre-lab homework
More informationProduct Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris
Glowing Products for Science Mix-n-Stain Antibody Labeling Kits Size: 1 labeling per kit Storage: -20 o C Stability: Stable for at least 1 year from date of receipt when stored as recommended. Components:
More informationover time using live cell microscopy. The time post infection is indicated in the lower left corner.
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected
More informationRayBio Human NF-κB p65 Transcription Factor Activity Assay Kit
RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
More informationImagerie et spectroscopie de fluorescence par excitation non radiative
Imagerie et spectroscopie de fluorescence par excitation non radiative comment s affranchir de la limite de diffraction Rodolphe Jaffiol, Cyrille Vézy, Marcelina Cardoso Dos Santos LNIO, UTT, Troyes NanoBioPhotonics
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationImmunostaining Protocols
Immunostaining Protocols Lula L. Hilenski, Ph.D. Director Microscopy in Medicine Core Emory University Variables in standard immunostaining protocol 2-step or indirect immunofluorescence 1. Substrate on
More informationMSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.
MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput
More informationMethods of Culturing Microorganisms. Chapter 3. Five Basic Techniques of Culturing Bacteria. Topics
Chapter 3 Topics Methods of Culturing Microorganisms Microscope (History, Types, Definitions) Staining (Gram s) Methods of Culturing Microorganisms Five basic techniques of culturing Media Microbial growth
More informationDetermining fluorescence Limit of Detection with Nanoparticle Tracking Analysis (NTA)
Determining fluorescence Limit of Detection with Nanoparticle Tracking Analysis (NTA) FLUORESCENCE DETECTION PARTICLE SIZE PARTICLE CONCENTRATION Introduction The ability to detect nanoparticle fluorescence
More informationSupplemental information
Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry
More informationImmunohistochemistry: Basics and Methods
Immunohistochemistry: Basics and Methods Bearbeitet von Igor B Buchwalow, Werner Böcker 1st Edition. 2010. Buch. x, 153 S. Hardcover ISBN 978 3 642 04608 7 Format (B x L): 15,5 x 23,5 cm Gewicht: 445 g
More informationFinal exam. Please write your name on the exam and keep an ID card ready.
Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationMicroarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6
Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...
More informationSimultaneous multi-color, multiphoton fluorophore excitation using dual-color fiber lasers
Multiphoton Microscopy / Fiber Laser Simultaneous multi-color, multiphoton fluorophore excitation using dual-color fiber lasers Matthias Handloser, Tim Paasch-Colberg, Bernhard Wolfring TOPTICA Photonics
More informationComparison of LANCE Ultra TR-FRET to PerkinElmer s Classical LANCE TR-FRET Platform for Kinase Applications
Comparison of LANCE Ultra TR-FRET to PerkinElmer s Classical LANCE TR-FRET Platform for Kinase Applications LANCE ULTRA TR-FRET TECHNOLOGY A P P L I C A T I O N N O T E Introduction Protein kinases play
More informationInnovations To Meet Your Needs
Innovations To Meet Your Needs Cooled CCD Camera 1340 x 1037 pixel resolution for greatest image quality 12-bit precision provides 3 orders of linear dynamic range Windows and Power Macintosh Software
More informationTransport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene
Aalborg Universitet Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene Publication date: 2009 Document Version Publisher's PDF, also
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationDiscovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A
Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets
More informationReading for lecture 11
Reading for lecture 11 1. Optical Tweezers, Myosin 2. Atomic Force Microscopy (AFM) 3. Single-Molecule Fluorescence Microscopy 4. Patch-Clamp 5. Genetic Techniques Key references are included in italics
More informationStellaris RNA FISH Protocol for Simultaneous IF + FISH in Adherent Cells
Stellaris RNA FISH Protocol for Simultaneous IF + FISH in Adherent Cells General Protocol & Storage Product Description A set of Stellaris RNA FISH Probes is comprised of up to 48 singly labeled oligonucleotides
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationSimple Conversion of ELISA to PerkinElmer s High Sensitivity DELFIA Technology
APPLICATION NOTE HTS Reagents Authors: Matthew Marunde Stephen Hurt PerkinElmer, Inc. Waltham, MA Simple Conversion of ELISA to PerkinElmer s High Sensitivity DELFIA Technology Introduction Immunoassays
More informationBIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology
BIOTECHNOLOGY Subject Code: BT Course Structure Sections/Units Section A Section B Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6 Unit 7 Section C Section D Section E Topics Engineering Mathematics General
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationFluorescence Nanoscopy
Fluorescence Nanoscopy Keith A. Lidke University of New Mexico panda3.phys.unm.edu/~klidke/index.html Optical Microscopy http://en.wikipedia.org/wiki/k%c3%b6hler_illumination 30 µm Fluorescent Probes Michalet
More informationWelcome! openmicberkeley.wordpress.com. Open Berkeley
Welcome! openmicberkeley.wordpress.com Agenda Jen Lee: Introduction to FRET Marla Feller: Using FRET sensors to look at time resolved measurements Becky Lamason: Using FRET to determine if a bacterial
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationKinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)
Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make
More informationSupplemental Data. Regulating Gene Expression. through RNA Nuclear Retention
Supplemental Data Regulating Gene Expression through RNA Nuclear Retention Kannanganattu V. Prasanth, Supriya G. Prasanth, Zhenyu Xuan, Stephen Hearn, Susan M. Freier, C. Frank Bennett, Michael Q. Zhang,
More informationCell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential
Supporting Online Material Materials and methods Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Medium (Gibco BRL, Invitrogen Corporation, Carlsbad, CA, USA), supplemented
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationab Optiblot Fluorescent Western Blot Kit
ab133410 Optiblot Fluorescent Western Blot Kit Instructions for Use For quantitative, multi-color fluorescent Western blotting. This product is for research use only and is not intended for diagnostic
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationCBI Toolbox Tour 2015
CBI Toolbox Tour 2015 Thermophoresis (NanoTemper) NT.115 & NT.LabelFree Images: NanoTemper Circular Dichroism Jasco J-1500 Spectrometer Six Position Turreted Peltier Temperature Control System Automated
More informationAutomated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis
A p p l i c a t i o n N o t e Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis Brad Larson, BioTek Instruments, Inc., Winooski, VT USA Asha Sinha
More informationLiving up to Life. Sample Preparation. for. Ground State Depletion (GSD) Super-resolution imaging. Protocol guide for Leica SR GSD system. Version 1.
Sample Preparation for Ground State Depletion (GSD) Super-resolution imaging Protocol guide for Leica SR GSD system Version 1.0 1 1. Introduction Ground State Depletion (GSD) is the ultimate super-resolution
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationChapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates
Chapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates The work described in this chapter was accomplished in collaboration with V. Rucker (Dervan
More informationIn-Gel Western Detection Using Near-Infrared Fluorescence
In-Gel Western Detection Using Near-Infrared Fluorescence Developed for: Aerius, and Odyssey Family of Imagers Please refer to your manual to confirm that this protocol is appropriate for the applications
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationA Comparison of AlphaLISA and TR-FRET Homogeneous Immunoassays in Serum-Containing Samples
application Note A Comparison of and Homogeneous Immunoassays in Serum-Containing Samples Authors Anuradha Prasad, PhD, Catherine Lautenschlager, PhD, Stephen Hurt, PhD, David Titus, PhD and Stéphane Parent,
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationIn-Cell Western Kits I and II
Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp
More informationFisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).
175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further
More informationSupplementary Figures and Legends
Supplementary Figures and Legends Figure S1. Tests of the optical alignment and focal properties of the confocal microscope. (A) Images of the optical cross-section of fluorescent microspheres differing
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationDigitally Programmed Cells
Digitally Programmed Cells Ron Weiss PI: Tom Knight MIT Artificial Intelligence Laboratory Goal Process-Control Cellular Computers -- Microbial Robotics Unique features: small, self-replicating, energy-efficient
More informationConcepts and Methods in Developmental Biology
Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationTo isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
More informationImproving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is
More informationwestern blotting tech
western blotting tech note 6148 Transfer of High Molecular Weight Proteins to Membranes: A Comparison of Transfer Efficiency Between Blotting Systems Nik Chmiel, Bio-Rad Laboratories, Inc., 6000 James
More informationFranzens-Universitaet Graz, Humboldtstrasse 50, 8010 Graz. Phone: ++43 (0) Fax: ++43 (0)
Extracellular nucleases and extracellular DNA play important roles in Vibrio cholerae biofilm formation Andrea Seper 1, Vera H. I. Fengler 1, Sandro Roier 1, Heimo Wolinski 1, Sepp D. Kohlwein 1, Anne
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More information