Nodes of regulation in cellular systems

Size: px
Start display at page:

Download "Nodes of regulation in cellular systems"

Transcription

1 Nodes of regulation in cellular systems cell membrane signal transduction ligands receptors oligomerization transport signal transduction modified protein Golgi transcription factor transport ER transport activation protein posttranslational modification poly-ubiquitination degradation nucleus DNA transcription splicing pre-mrna processing pre-micro-rna mrna micro-rna transport mrna translation micro-rna 5 degradation

2 Specific cell ablation or cell labeling in transgenic mice loxp loxp Stop DTR (Diphteria toxin receptor) good promoter (e.g. pcaggs) loxp Stop cross-breeding with a cell-type specific Cre strain DTR is expressed only in specific cell types injection of diphteria toxin leads to specific killing of these cells loxp EYFP (enhanced yellow fluorescent protein) good promoter (e.g. pcaggs) > fluorescent labeling of a specific cell type of interest 13

3 Transfections Usually designates the incorporation of DNA into mammalian cells. DNA present in form of plasmids. Transient Transfection: plasmid remains outside of the genome and is slowly lost (degradation, dilution by cell division), exception: episomal replication e.g. SV40-Plasmids in COS-cells). The transfection efficiency varies but can reach close to 100% Stable Transfection: integration of foreign DNA into the genome (Efficiency: usually below 0.1%). Isolation of stably transfected clones requires selection genes (for antibiotic resistance, e.g. puromycin, G418 ). Plasmids are usually linearized before transfection to increase the possibility of correct integration. 41

4 Professional Design of sirna or shrna Design via company website This delivers a list of several possible sequences (gene specific, checked by BLAST) with a score based on empirically determined criteria: Nature Biotechnology 22, , 2004 Check literature for functional sirna sequences For transduction of primary cells: lentiviral shrna constructs (also work in non dividing cells) there are also inducible lentiviral constructs available ( Many vectors can also be obtained from plasmid repositories: Addgene: Belgian repository: 71

5 Molecular weight assessment after SDS-PAGE log[mw] migration distance starting from stacking gel/separation gel interface 80

6 EMSA s (Electrophoretic mobility shift assays) used to monitor active transcription factors (by binding to short, labeled oligonucleotides comprising the bound DNA sequence) Example: comp.: competitor: non-labeled ds-oligo of the same sequence (usually added in > 10-fold molar excess) competes with the labeled oligo for binding to the TF > reduces the specific signal mut.comp.: mutated competitor: should not compete for specific binding

7 EMSA Alternative: ABCD Assay (Avidin-Biotin Complex with DNA) TF dsoligo Biotin Streptavidin 87

8 Microscopy: Human vision and the concept of magnification image formation in the human eye 2-step magnification principle of a microscope with 2 lenses: objective and eye piece (occular) 185

9 Basics of optical resolution I Fine structures induce a diffraction of light (light of zero-order, 1st order...). Light diffraction on a small iris is more or less equal to diffraction on small cellular structures: sinθ(1) = 1.22(λ/d) θ... angle to the first light minimum λ... wavelength d... diameter of the iris for very small angles θ: θ(1) 1.22(λ/d) objects that are closer than θ(1) cannot be resolved as separate objects 186

10 Basics of optical resolution II The more orders of light are resolved the better is the resolution. The optical resolution that can be achieved is defined by the so called numerical Aperture (N.A.) of the objective. N.A. = i sin q i... Refraction index of the medium (e.g. 1.0 for air, up to 1.56 for oil) q... half of the objective opening angle (Aperture) 187

11 Phase contrast Unstained objects such as cells slow down the light (the phase of the passing light) by ¼ λ. Phase contrast rings in the objective can accelerate the light, which does not pass through cells by ¼ λ, the resulting difference of ½ λ causes an interference, which leads to contrast enhancement. ¼ λ ½ λ 194

12 Fluorescence Filter Cubes The filter cube consists of: 1. Excitation filter: just the correct excitation light (wavelength) passes the filter 2. Dichroic mirror: is reflective for the excitation light but transmittent for the emission light (the emitted fluorescence) separates excitation from fluorescence light sample 3. Emission filter: filters the emitted light so that just the correct wavelength (e.g. in double fluorescence) reaches the detector 207

13 Protocol of an immunofluorescence staining Fixation: 15 min 4% Paraformaldehyd 3x 5 min mit TBST wash (50mM Tris- HCl ph7.4, 150 mm NaCl, 0.1%Triton) Block: 1 h at RT with 3% BSA in TBS Incubation with 1. Ab: anti-iκb (rabbit polyclonal, sc-371 Santa Cruz) 1:300 in TBS/3% BSA, over night at 4 C (or 1 h at 37 C). 2x 5 min wash with TBST, 1x 5 min with TBS Incubation with Alexa488 goat antirabbit 1:2000 in TBS/BSA: 1 h at 37 C 3x 5 min wash with TBST, 1x 5 min with TBS Mounting 215

14 Confocal microscopy removes the blur from thicker objects

15 Optical sectioning and 3Dprojections z-stack Acquisition of a z-stack (image slices along the z- axis) allows reconstruction of a 3D-projection, which can be shown as animation projection 3D rendering 220

16 Spectral imaging Resolving spectral information on a pixel-by-pixel basis Emission finger printing : emission scan of a microscopy sample ( lambda stack of images) at a given excitation wavelength (e.g. with Zeiss LSM META systems or with Leica confocal microscopes ) Alternative: Excitation scan (at a constant emission wavelength; e.g. using a monochromator light source) Combinations of excitation and emission finger printing (e.g using filter wheels) Increases the number of markers to be measured in parallel Can be used to discriminate fluorophores with overlapping spectra Can be used to discriminate specific fluorescence from autofluorescence Leica concept Zeiss META concept 221

17 Spectral imaging example I: CFP, GFP and YFP 224

18 Spectral imaging example II: strongly overlapping dyes SYTOX Green (nucleus), Alexa Fluor 488 conjugated to phalloidin (filamentous actin network), and Oregon Green 514 conjugated to goat anti-mouse primary antibodies (targeting mitochondria). Invitrogen Spectra Viewer home/products-and- Services/Applications/Cell- Analysis/Labeling- Chemistry/Fluorescence- SpectraViewer.html 225

19 Separation of specific fluorescence from autofluorescence by spectral imaging 226

20 FRAP: Fluorescence Recovery After Photobleaching FRAP at the membrane Non linear regression analysis y = span (1-e -kx ) + bottom An image is taken then a region of the cell is bleached by high laser intensity, followed by a time series of images after bleaching. Briefly after bleaching the region is significantly darker and then the fluorescence intensity increases again (fluorescence reoovery) due to diffusion of molecules into the bleached area. The kinetics of recovery depends on the diffusion coefficience; the extent of recovery (the plateau to which the fluorescence recovers) is a measure of the overall mobility (the fraction of mobile molecules versus molecules immobilized, e.g. to the cytoskeleton) FRAP in the cytosol: 236

21 FLIP: Fluorescence Loss in Photobleaching to determine the dynamic shuttling of molecules between different compartments of the cell A certain compartment A (e.g. the cytosol) 120 is repetitively bleached by the laser and 100 the fluorescence decrease in a different 80 compartment B is monitored by time lapse microscopy. Molecules that shuttle from B 60 to A are bleached in A > thus the 40 compartment B gets dimmer when there is 20 a dynamic distribution of molecules between A and B. 0 cytosol nucleus

22 FLIP to determine a nuclear export signal and a nucleolar localization signal NFκB inducing kinase truncated NIK without the export sequence: nuclear FLIP (bleach in nucleus outside nucleoli) nuclear nucleolar sec

23 FCS: Fluorescence Correlation Spectroscopy to determine diffusion coefficients and interactions between molecules. The sample is illuminated by the laser at a very small spot, the movements of molecules in this spot (in and out) cause fluorescence fluctuations, which are analyzed by correlation functions

24 Spectral crosstalk of donor and acceptor ECFP and EYFP-Scans 1.2 relative fluorescence raw FRET-channel: Donor Excitation + Acceptor Emission nm Excitation window of donor Emission window of acceptor Problems: 1. Co-excitation of the acceptor at the Donor-excitation wavelength > Non-FRET-Fluorescence in the raw-fret channel 2. Signal-overlap of donor into the acceptor channel > Non-FRET fluorescence in the raw-fret channel 249

25 3-Filter FRET Microscopy 3 Images are taken (under constant camera settings): 1. Donor (e.g. CFP-excitation and emission), 2. Acceptor (e.g.yfp-excitation and emission this signal is not affected by FRET 3. FRET-Filter (raw FRET: CFP-excitation and YFP-emission). A normalized FRET signal (image) can be calculated by using correction factors obtained with single stained samples: FRETc = I FRET -corr CFP x I CFP corr YFP x I YFP corr CFP : ca corr YFP : ca CFP / YFP neg. control CFP-YFP pos. control 251

26 FRET microscopy example corrected FRET = I FRET -corr CFP x I CFP corr YFP x I YFP sample Donor channel Acceptor channel FRET channel corr. factor corrected FRET CFP alone YFP alone non-bound CFP + YFP bound CFP-YFP neg. control Donor Acceptor corrected FRET normalized FRET Normalized FRET (normalized to diff. expression levels): = sample 252

27 FRET Microscopy by acceptor bleaching and monitoring donor recovery (do not use for CFP / YFP) Donor recovery after acceptor bleaching: An image of the donor in the presence of the acceptor is taken, then the acceptor is bleached (partially), followed by acquisition of a second donor image Donor FRET Acceptor Donor Acceptor 255

28 FRET analysis with self-written ImageJ macro neg. control Negative Control sample IKK1+Myc 1 sample IKK2+ Myc 2 sample

Partha Roy

Partha Roy Fluorescence microscopy http://micro.magnet.fsu.edu/primer/index.html Partha Roy 1 Lecture Outline Definition of fluorescence Common fluorescent reagents Construction ti of a fluorescence microscope Optical

More information

Spectral Separation of Multifluorescence Labels with the LSM 510 META

Spectral Separation of Multifluorescence Labels with the LSM 510 META Microscopy from Carl Zeiss Spectral Separation of Multifluorescence Labels with the LSM 510 META Indians living in the South American rain forest can distinguish between almost 200 hues of green in their

More information

Resolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f

Resolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f Microscopes and Microscopy MCB 380 Good information sources: Alberts-Molecular Biology of the Cell http://micro.magnet.fsu.edu/primer/ http://www.microscopyu.com/ Approaches to Problems in Cell Biology

More information

Practical light microscopy: an introduction

Practical light microscopy: an introduction Practical light microscopy: an introduction Dr. Mark Leake, Oxford University www.physics.ox.ac.uk/users/leake Aim of today s talk: Explanation of the very (very) basics of how a light microscope works

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

FLUORESCENT PEPTIDES. Outstanding Performance and Wide Application Range

FLUORESCENT PEPTIDES. Outstanding Performance and Wide Application Range FLUORESCENT PEPTIDES Peptides and amino acids labeled with and Tide Quencher TM We offer peptides and amino acids tagged with fluorescent dyes. They meet highest demands in fluorescence intensity and photo-stability,

More information

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

CytoPainter Golgi Staining Kit Green Fluorescence

CytoPainter Golgi Staining Kit Green Fluorescence ab139483 CytoPainter Golgi Staining Kit Green Fluorescence Instructions for Use Designed for the detection of Golgi bodies by microscopy This product is for research use only and is not intended for diagnostic

More information

Confocal Microscopes. Evolution of Imaging

Confocal Microscopes. Evolution of Imaging Confocal Microscopes and Evolution of Imaging Judi Reilly Hans Richter Massachusetts Institute of Technology Environment, Health & Safety Office Radiation Protection What is Confocal? Pinhole diaphragm

More information

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION

More information

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,

More information

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics

More information

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody

More information

Introduction to Fluorescence Jablonski Diagram

Introduction to Fluorescence Jablonski Diagram ntroduction to Fluorescence Jablonski Diagram Excited Singlet Manifold S1 internal conversion S2 k -isc k isc Excited riplet Manifold 1 S0 k nr k k' f nr fluorescence k p phosphorescence Singlet round

More information

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

How to run Alpha assay: How to setup an Alpha assay Make your own assay! How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Introduction to N-STORM

Introduction to N-STORM Introduction to N-STORM Dan Metcalf Advanced Imaging Manager Outline Introduction Principles of STORM Applications N-STORM overview Biological Scale Mitochondrion Microtubule Amino Acid 1Å Kinesin 1nm

More information

Flow Cytometry - The Essentials

Flow Cytometry - The Essentials Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

This Document Contains:

This Document Contains: This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular

More information

hfab Rhodamine Housekeeping Antibodies

hfab Rhodamine Housekeeping Antibodies hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine

More information

How to perform-control immunostaining experiment - microscopist subjective point of view. Pawel Pasierbek

How to perform-control immunostaining experiment - microscopist subjective point of view. Pawel Pasierbek How to perform-control immunostaining experiment - microscopist subjective point of view. Pawel Pasierbek Immunolabeling and fluorescent detection became such a standard procedure in the biomedical research

More information

Genetically targeted all-optical electrophysiology with a transgenic Credependent

Genetically targeted all-optical electrophysiology with a transgenic Credependent Genetically targeted all-optical electrophysiology with a transgenic Credependent Optopatch mouse Short title: Transgenic Optopatch mouse Shan Lou 1, Yoav Adam 1, Eli N. Weinstein 1,4, Erika Williams 2,

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

Lab 1A: Microscopy I. Name: Section:

Lab 1A: Microscopy I. Name: Section: Lab 1A: Microscopy I A response is required for each item marked: (# ). Your grade for the lab 1 report (1A and 1B combined) will be the fraction of correct responses on a 50 point scale[(# correct/# total)

More information

Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery

Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery Sriram Vaidyanathan, 1 Junjie Chen, 2 Bradford G. Orr, 3 Mark M. Banaszak Holl

More information

Super-resolution Microscopy

Super-resolution Microscopy Semr oc kwhi t epaperser i es : 1. Introduction Super-resolution Microscopy Fluorescence microscopy has revolutionized the study of biological samples. Ever since the invention of fluorescence microscopy

More information

Azure Biosystems Western Blotting Workflow

Azure Biosystems Western Blotting Workflow Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX. Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image

More information

Test Your Plate Reader Set-up Before Using LanthaScreen Eu Assays

Test Your Plate Reader Set-up Before Using LanthaScreen Eu Assays Test Your Plate Reader Set-up Before Using LanthaScreen Eu Assays Purpose This LanthaScreen Eu Microplate Reader Test provides a method to verify the ability of your fluorescent plate reader to detect

More information

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna

More information

Basic Fluorescence Microscopy and Sample Preparation. Eva Wegel

Basic Fluorescence Microscopy and Sample Preparation. Eva Wegel Basic Fluorescence Microscopy and Sample Preparation Eva Wegel eva.wegel@bioch.ox.ac.uk Visible Light 390 700 nm visible to the human eye White light is split into its components through a prism Reason:

More information

Fluorescent Nanoparticles for Western Blotting

Fluorescent Nanoparticles for Western Blotting imaging tech note 3179 Fluorescent Nanoparticles for Western Blotting Kevin McDonald, Ahmed Elbaggari, and Marina Pekelis, Bio-Rad Laboratories, Inc., Hercules, CA 94547 USA Introduction Western blotting

More information

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices.

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices. DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support

More information

Lab module 6b Receptor-mediated endocytosis

Lab module 6b Receptor-mediated endocytosis Goal for the module Lab module 6b Receptor-mediated endocytosis To follow the movement of a degraded ligand, LDL, and a recycled ligand, transferrin, as they undergo endocytic processing. Pre-lab homework

More information

Product Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris

Product Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris Glowing Products for Science Mix-n-Stain Antibody Labeling Kits Size: 1 labeling per kit Storage: -20 o C Stability: Stable for at least 1 year from date of receipt when stored as recommended. Components:

More information

over time using live cell microscopy. The time post infection is indicated in the lower left corner.

over time using live cell microscopy. The time post infection is indicated in the lower left corner. Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

Imagerie et spectroscopie de fluorescence par excitation non radiative

Imagerie et spectroscopie de fluorescence par excitation non radiative Imagerie et spectroscopie de fluorescence par excitation non radiative comment s affranchir de la limite de diffraction Rodolphe Jaffiol, Cyrille Vézy, Marcelina Cardoso Dos Santos LNIO, UTT, Troyes NanoBioPhotonics

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

Immunostaining Protocols

Immunostaining Protocols Immunostaining Protocols Lula L. Hilenski, Ph.D. Director Microscopy in Medicine Core Emory University Variables in standard immunostaining protocol 2-step or indirect immunofluorescence 1. Substrate on

More information

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC. MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput

More information

Methods of Culturing Microorganisms. Chapter 3. Five Basic Techniques of Culturing Bacteria. Topics

Methods of Culturing Microorganisms. Chapter 3. Five Basic Techniques of Culturing Bacteria. Topics Chapter 3 Topics Methods of Culturing Microorganisms Microscope (History, Types, Definitions) Staining (Gram s) Methods of Culturing Microorganisms Five basic techniques of culturing Media Microbial growth

More information

Determining fluorescence Limit of Detection with Nanoparticle Tracking Analysis (NTA)

Determining fluorescence Limit of Detection with Nanoparticle Tracking Analysis (NTA) Determining fluorescence Limit of Detection with Nanoparticle Tracking Analysis (NTA) FLUORESCENCE DETECTION PARTICLE SIZE PARTICLE CONCENTRATION Introduction The ability to detect nanoparticle fluorescence

More information

Supplemental information

Supplemental information Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry

More information

Immunohistochemistry: Basics and Methods

Immunohistochemistry: Basics and Methods Immunohistochemistry: Basics and Methods Bearbeitet von Igor B Buchwalow, Werner Böcker 1st Edition. 2010. Buch. x, 153 S. Hardcover ISBN 978 3 642 04608 7 Format (B x L): 15,5 x 23,5 cm Gewicht: 445 g

More information

Final exam. Please write your name on the exam and keep an ID card ready.

Final exam. Please write your name on the exam and keep an ID card ready. Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6 Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...

More information

Simultaneous multi-color, multiphoton fluorophore excitation using dual-color fiber lasers

Simultaneous multi-color, multiphoton fluorophore excitation using dual-color fiber lasers Multiphoton Microscopy / Fiber Laser Simultaneous multi-color, multiphoton fluorophore excitation using dual-color fiber lasers Matthias Handloser, Tim Paasch-Colberg, Bernhard Wolfring TOPTICA Photonics

More information

Comparison of LANCE Ultra TR-FRET to PerkinElmer s Classical LANCE TR-FRET Platform for Kinase Applications

Comparison of LANCE Ultra TR-FRET to PerkinElmer s Classical LANCE TR-FRET Platform for Kinase Applications Comparison of LANCE Ultra TR-FRET to PerkinElmer s Classical LANCE TR-FRET Platform for Kinase Applications LANCE ULTRA TR-FRET TECHNOLOGY A P P L I C A T I O N N O T E Introduction Protein kinases play

More information

Innovations To Meet Your Needs

Innovations To Meet Your Needs Innovations To Meet Your Needs Cooled CCD Camera 1340 x 1037 pixel resolution for greatest image quality 12-bit precision provides 3 orders of linear dynamic range Windows and Power Macintosh Software

More information

Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene

Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene Aalborg Universitet Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene Publication date: 2009 Document Version Publisher's PDF, also

More information

*Corresponding author. Tel: ;

*Corresponding author. Tel: ; 1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland

More information

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets

More information

Reading for lecture 11

Reading for lecture 11 Reading for lecture 11 1. Optical Tweezers, Myosin 2. Atomic Force Microscopy (AFM) 3. Single-Molecule Fluorescence Microscopy 4. Patch-Clamp 5. Genetic Techniques Key references are included in italics

More information

Stellaris RNA FISH Protocol for Simultaneous IF + FISH in Adherent Cells

Stellaris RNA FISH Protocol for Simultaneous IF + FISH in Adherent Cells Stellaris RNA FISH Protocol for Simultaneous IF + FISH in Adherent Cells General Protocol & Storage Product Description A set of Stellaris RNA FISH Probes is comprised of up to 48 singly labeled oligonucleotides

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Simple Conversion of ELISA to PerkinElmer s High Sensitivity DELFIA Technology

Simple Conversion of ELISA to PerkinElmer s High Sensitivity DELFIA Technology APPLICATION NOTE HTS Reagents Authors: Matthew Marunde Stephen Hurt PerkinElmer, Inc. Waltham, MA Simple Conversion of ELISA to PerkinElmer s High Sensitivity DELFIA Technology Introduction Immunoassays

More information

BIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology

BIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology BIOTECHNOLOGY Subject Code: BT Course Structure Sections/Units Section A Section B Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6 Unit 7 Section C Section D Section E Topics Engineering Mathematics General

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

Fluorescence Nanoscopy

Fluorescence Nanoscopy Fluorescence Nanoscopy Keith A. Lidke University of New Mexico panda3.phys.unm.edu/~klidke/index.html Optical Microscopy http://en.wikipedia.org/wiki/k%c3%b6hler_illumination 30 µm Fluorescent Probes Michalet

More information

Welcome! openmicberkeley.wordpress.com. Open Berkeley

Welcome! openmicberkeley.wordpress.com. Open Berkeley Welcome! openmicberkeley.wordpress.com Agenda Jen Lee: Introduction to FRET Marla Feller: Using FRET sensors to look at time resolved measurements Becky Lamason: Using FRET to determine if a bacterial

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

Supplemental Data. Regulating Gene Expression. through RNA Nuclear Retention

Supplemental Data. Regulating Gene Expression. through RNA Nuclear Retention Supplemental Data Regulating Gene Expression through RNA Nuclear Retention Kannanganattu V. Prasanth, Supriya G. Prasanth, Zhenyu Xuan, Stephen Hearn, Susan M. Freier, C. Frank Bennett, Michael Q. Zhang,

More information

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Supporting Online Material Materials and methods Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Medium (Gibco BRL, Invitrogen Corporation, Carlsbad, CA, USA), supplemented

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

ab Optiblot Fluorescent Western Blot Kit

ab Optiblot Fluorescent Western Blot Kit ab133410 Optiblot Fluorescent Western Blot Kit Instructions for Use For quantitative, multi-color fluorescent Western blotting. This product is for research use only and is not intended for diagnostic

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

CBI Toolbox Tour 2015

CBI Toolbox Tour 2015 CBI Toolbox Tour 2015 Thermophoresis (NanoTemper) NT.115 & NT.LabelFree Images: NanoTemper Circular Dichroism Jasco J-1500 Spectrometer Six Position Turreted Peltier Temperature Control System Automated

More information

Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis

Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis A p p l i c a t i o n N o t e Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis Brad Larson, BioTek Instruments, Inc., Winooski, VT USA Asha Sinha

More information

Living up to Life. Sample Preparation. for. Ground State Depletion (GSD) Super-resolution imaging. Protocol guide for Leica SR GSD system. Version 1.

Living up to Life. Sample Preparation. for. Ground State Depletion (GSD) Super-resolution imaging. Protocol guide for Leica SR GSD system. Version 1. Sample Preparation for Ground State Depletion (GSD) Super-resolution imaging Protocol guide for Leica SR GSD system Version 1.0 1 1. Introduction Ground State Depletion (GSD) is the ultimate super-resolution

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Chapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates

Chapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates Chapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates The work described in this chapter was accomplished in collaboration with V. Rucker (Dervan

More information

In-Gel Western Detection Using Near-Infrared Fluorescence

In-Gel Western Detection Using Near-Infrared Fluorescence In-Gel Western Detection Using Near-Infrared Fluorescence Developed for: Aerius, and Odyssey Family of Imagers Please refer to your manual to confirm that this protocol is appropriate for the applications

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

A Comparison of AlphaLISA and TR-FRET Homogeneous Immunoassays in Serum-Containing Samples

A Comparison of AlphaLISA and TR-FRET Homogeneous Immunoassays in Serum-Containing Samples application Note A Comparison of and Homogeneous Immunoassays in Serum-Containing Samples Authors Anuradha Prasad, PhD, Catherine Lautenschlager, PhD, Stephen Hurt, PhD, David Titus, PhD and Stéphane Parent,

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

In-Cell Western Kits I and II

In-Cell Western Kits I and II Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp

More information

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA). 175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further

More information

Supplementary Figures and Legends

Supplementary Figures and Legends Supplementary Figures and Legends Figure S1. Tests of the optical alignment and focal properties of the confocal microscope. (A) Images of the optical cross-section of fluorescent microspheres differing

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Digitally Programmed Cells

Digitally Programmed Cells Digitally Programmed Cells Ron Weiss PI: Tom Knight MIT Artificial Intelligence Laboratory Goal Process-Control Cellular Computers -- Microbial Robotics Unique features: small, self-replicating, energy-efficient

More information

Concepts and Methods in Developmental Biology

Concepts and Methods in Developmental Biology Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation

More information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental

More information

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at

More information

Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm

Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is

More information

western blotting tech

western blotting tech western blotting tech note 6148 Transfer of High Molecular Weight Proteins to Membranes: A Comparison of Transfer Efficiency Between Blotting Systems Nik Chmiel, Bio-Rad Laboratories, Inc., 6000 James

More information

Franzens-Universitaet Graz, Humboldtstrasse 50, 8010 Graz. Phone: ++43 (0) Fax: ++43 (0)

Franzens-Universitaet Graz, Humboldtstrasse 50, 8010 Graz. Phone: ++43 (0) Fax: ++43 (0) Extracellular nucleases and extracellular DNA play important roles in Vibrio cholerae biofilm formation Andrea Seper 1, Vera H. I. Fengler 1, Sandro Roier 1, Heimo Wolinski 1, Sepp D. Kohlwein 1, Anne

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information