Lesson Overview DNA Replication
|
|
- Alicia Wilkins
- 6 years ago
- Views:
Transcription
1 12.3
2 THINK ABOUT IT Before a cell divides, its DNA must first be copied. How might the double-helix structure of DNA make that possible?
3 Review Question! At what stage of the cell cycle do cells duplicate their DNA? DNA replication takes place in the S phase. S phase G 1 interphase G 2 Mitosis -prophase -metaphase -anaphase -telophase
4 Copying the Code Base pairing in the double helix explained how DNA could be copied, or replicated, because each base on one strand pairs with only one base on the opposite strand.
5 Copying the Code Each strand of the double helix has all the information needed to reconstruct the other half by the mechanism of base pairing. Because each strand can be used to make the other strand, the strands are said to be complementary.
6 Copying the Code What role does DNA polymerase play in copying DNA?
7 Copying the Code What role does DNA polymerase play in copying DNA? DNA polymerase is an enzyme that joins individual nucleotides to produce a new strand of DNA.
8 The Replication Process Before a cell divides, it duplicates its DNA in a copying process called replication. Why? This process ensures that each resulting cell has the same complete set of DNA molecules.
9 The Replication Process During replication DNA molecule separates into two strands Then produces two new complementary strands following base pairing rules
10 The Replication Process Each strand of the double helix of DNA serves as a template, or model, for the new strand. Animation
11 Let s Model this with our paper! Fold your paper in half hamburger style. On each side of the paper, fold back the flaps to meet at the fold (this hides the middle section of your paper) On the top portion of your paper, record the following DNA sequence: ACT GGG ATT TGC CCC ATG GTA AAA CCC TTT On the bottom portion of your paper, write the complementary strand. They should line up when the bottom of your paper is hidden.
12 Now, mimic DNA replication: Divide the two strands and match up the complementary base pairs. Use a different color to do this Identify the parent strands Identify the complementary strands Are the two resulting copies of DNA identical?
13 The Replication Process (Skip) The two strands of the double helix separate, or unzip, allowing two replication forks to form.
14 The Replication Process (Skip) As each new strand forms, new bases are added following the rules of base pairing. Review: What would pair with Adenine? Guanine?
15 The Replication Process Result of replication is two DNA molecules identical to each other and to the original molecule. Each DNA molecule resulting from replication has one original strand and one new strand. DNA Template Parental DNA New DNA
16 The Role of Enzymes DNA replication is carried out by a series of enzymes. They first unzip a molecule of DNA by breaking the hydrogen bonds between base pairs and unwinding the two strands of the molecule. Each strand then serves as a template for the attachment of complementary bases.
17 The Role of Enzymes Animation with Helicase & DNA Polymerase The principal enzyme involved in DNA replication is called DNA polymerase. Joins individual nucleotides to produce a new strand of DNA. Proofreads each new DNA strand, ensuring that each molecule is a perfect copy of the original.
18 Telomeres The tips of chromosomes are known as telomeres. The ends of DNA molecules, located at the telomeres, are particularly difficult to copy. Over time, DNA may actually be lost from telomeres each time a chromosome is replicated.
19 Telomeres An enzyme called telomerase compensates for this problem by adding short, repeated DNA sequences to telomeres Lengthening the chromosomes slightly Makes it less likely that important gene sequences will be lost from the telomeres during replication.
20 Replication in Living Cells How does DNA replication differ in prokaryotic cells and eukaryotic cells?
21 Replication in Living Cells How does DNA replication differ in prokaryotic cells and eukaryotic cells? Replication in most prokaryotic cells starts from a single point and proceeds in two directions until the entire chromosome is copied. In eukaryotic cells, replication may begin at dozens or even hundreds of places on the DNA molecule, proceeding in both directions until each chromosome is completely copied.
22 Replication in Living Cells The cells of most prokaryotes have a single, circular DNA molecule in the cytoplasm, containing nearly all the cell s genetic information. Eukaryotic cells, on the other hand, can have up to 1000 times more DNA. Nearly all of the DNA of eukaryotic cells is found in the nucleus.
23 Prokaryotic In most prokaryotes, DNA replication does not start until regulatory proteins bind to a single starting point on the chromosome. Replication in most prokaryotic cells starts from a single point and proceeds in two directions until the entire chromosome is copied.
24 Prokaryotic Often, the two chromosomes produced by replication are attached to different points inside the cell membrane and are separated when the cell splits to form two new cells.
25 Eukaryotic Eukaryotic chromosomes are generally much bigger than those of prokaryotes.
26 Eukaryotic In eukaryotic cells, replication may begin at dozens or even hundreds of places on the DNA molecule, proceeding in both directions until each chromosome is completely copied.
27 Eukaryotic The two copies of DNA produced by replication in each chromosome remain closely associated until the cell enters prophase of mitosis. At that point, the chromosomes condense, and the two chromatids in each chromosome become clearly visible.
28 Eukaryotic They separate from each other in anaphase of mitosis, producing two cells, each with a complete set of genes coded in DNA.
29 What do BOTH prokaryotes & eukaryotes have in common with? Hydrogen bonds are broken, strands unwind & separate Each add complementary base pairs using parent strand as a template Both result in 2 identical copies of DNA, each with one parent strand and one complementary strand
Fig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm
Fig. 16-7a end Hydrogen bond end 1 nm 3.4 nm 0.34 nm (a) Key features of DNA structure end (b) Partial chemical structure end Fig. 16-8 Adenine (A) Thymine (T) Guanine (G) Cytosine (C) Concept 16.2: Many
More informationDNA STRUCTURE. Nucleotides: Nitrogenous Bases (Carry the Genetic Code) Expectation Sheet: DNA & Cell Cycle. I can statements: Basic Information:
Expectation Sheet: DNA & Cell Cycle NAME: Test is 11/8/17 I can statements: I can discuss how DNA is found in all organisms and that the structure is common to all living things. I can diagram and label
More informationName Class Date. Information and Heredity, Cellular Basis of Life Q: What is the structure of DNA, and how does it function in genetic inheritance?
12 DNA Big idea Information and Heredity, Cellular Basis of Life Q: What is the structure of DNA, and how does it function in genetic inheritance? WHAT I KNOW WHAT I LEARNED 12.1 How did scientists determine
More informationDNA is a functional genetic material as it:
DNA DNA is a functional genetic material as it: varies between species and individuals can store information remains constant within a species Replicates undergoes mutations 1 `It has not escaped our notice
More informationDNA Replication. The Organization of DNA. Recall:
Recall: The Organization of DNA DNA Replication Chromosomal form appears only during mitosis, and is used in karyotypes. folded back upon itself (chromosomes) coiled around itself (chromatin) wrapped around
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationCELLULAR PROCESSES; REPRODUCTION. Unit 5
CELLULAR PROCESSES; REPRODUCTION Unit 5 Cell Cycle Chromosomes and their make up Crossover Cytokines Diploid (haploid diploid and karyotypes) Mitosis Meiosis What is Cancer? Somatic Cells THE CELL CYCLE
More informationDNA Replication AP Biology
DNA Replication 2007-2008 Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.
More informationThe Molecular Basis of Inheritance
The Molecular Basis of Inheritance Chapter 16 Objectives Describe the contributions of the following people: Griffith; Avery, McCary, and MacLeod; Hershey and Chase; Chargaff; Watson and Crick; Franklin;
More informationChapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.
Chapter 10 DNA: The Molecule of Heredity Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc. 10.1 What Is The Structure Of DNA? Deoxyribonucleic acid (DNA) is
More information10-2 Cell Division (Pages )
10-2 Cell Division (Pages 244-245) What do you think would happen if a cell were simply to split into two, without any advance preparation? Would each daughter cell have everything it needed to survive?
More informationChapter 3. DNA Replication & The Cell Cycle
Chapter 3 DNA Replication & The Cell Cycle DNA Replication and the Cell Cycle Before cells divide, they must duplicate their DNA // the genetic material DNA is organized into strands called chromosomes
More informationDNA Replication. Back ground.. Single celled zygote goes from being single celled to 100 trillion more cells in over 240 days in humans! Wow!
DNA Replication Back ground.. Single celled zygote goes from being single celled to 100 trillion more cells in over 240 days in humans! Wow! Must be fast! six billion base pairs in a single human cell
More informationCHAPTER 16 MOLECULAR BASIS OF INHERITANCE
CHAPTER 16 MOLECULAR BASIS OF INHERITANCE DNA as genetic material? Deducted that DNA is the genetic material Initially worked by studying bacteria & the viruses that infected them 1928 Frederick Griffiths
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationTHE COMPONENTS & STRUCTURE OF DNA
THE COMPONENTS & STRUCTURE OF DNA - How do genes work? - What are they made of, and how do they determine the characteristics of organisms? - Are genes single molecules, or are they longer structures made
More informationDNA Replication AP Biology
DNA Replication 2007-2008 Watson and Crick 1953 article in Nature Double helix structure of DNA It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible
More informationDNA Structure and Replication. Higher Human Biology
DNA Structure and Replication Higher Human Biology Learning Intention Describe the structure of DNA Explain the base pairing rule using adenine, thymine, cytosine and guanine 1 Division and differentiation
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationMOLECULAR BASIS OF INHERITANCE
MOLECULAR BASIS OF INHERITANCE C H A P T E R 1 6 as genetic material? Deducted that is the genetic material Initially worked by studying bacteria & the viruses that infected them 1928 Frederick Griffiths
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationDNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.
DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose
More informationBiology Lecture 2 Genes
Genes Definitions o Gene: DNA that codes for a single polypeptide/mrna/rrna/trna o Euchromatin: region of DNA containing genes being actively transcribed o Heterochromatin: region of DNA containing genes
More informationFriday, April 17 th. Crash Course: DNA, Transcription and Translation. AP Biology
Friday, April 17 th Crash Course: DNA, Transcription and Translation Today I will 1. Review the component parts of a DNA molecule. 2. Describe the process of transformation. 3. Explain what is meant by
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationCell Division. Use Target Reading Skills. This section explains how cells grow and divide.
Name Date Class Cell Processes Guided Reading and Study Cell Division This section explains how cells grow and divide. Use Target Reading Skills As you read, make a cycle diagram that shows the events
More informationOverview: Life s Operating Instructions Concept 16.1: DNA is the genetic material The Search for the Genetic Material: Scientific Inquiry
Overview: Life s Operating Instructions In 1953, James Watson and Francis Crick introduced an elegant double-helical model for the structure of deoxyribonucleic acid, or DNA DNA, the substance of inheritance,
More informationDNA and Its Role in Heredity. DNA and Its Role in Heredity. A. DNA: The Genetic Material. A. DNA: The Genetic Material.
DNA and Its Role in Heredity A. DNA: The Genetic Material Lecture Series 8 DNA and Its Role in Heredity B. The Structure of DNA C. DNA E. DNA Proofreading and Repair F. Practical Applications of DNA A.
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationCovalently bonded sugar-phosphate backbone with relatively strong bonds keeps the nucleotides in the backbone connected in the correct sequence.
Unit 14: DNA Replication Study Guide U7.1.1: DNA structure suggested a mechanism for DNA replication (Oxford Biology Course Companion page 347). 1. Outline the features of DNA structure that suggested
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationGenetics and Heredity. Mr. Gagnon
Genetics and Heredity Mr. Gagnon Key Terms: Traits Heredity Genetics Purebred Genes Alleles Recessive Allele Dominant Allele Hybrids Key Concepts: What factors control the inheritance of traits in organisms?
More informationGenetic material must be able to:
Genetic material must be able to: Contain the information necessary to construct an entire organism Pass from parent to offspring and from cell to cell during cell division Be accurately copied Account
More informationTranscription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016
Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red
More informationBrief History. Many people contributed to our understanding of DNA
DNA (Ch. 16) Brief History Many people contributed to our understanding of DNA T.H. Morgan (1908) Frederick Griffith (1928) Avery, McCarty & MacLeod (1944) Erwin Chargaff (1947) Hershey & Chase (1952)
More informationVocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase
DNA and Replication TEKS (6) Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: (A)
More informationUNIT 4. DNA, RNA, and Gene Expression
UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain
More informationMolecular Genetics I DNA
Molecular Genetics I DNA Deoxyribonucleic acid is the molecule that encodes the characteristics of living things. It is the molecule that is passed from a mother cell to daughter cells, and the molecule
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationDNA: Structure and Replication - 1
DNA: Structure and Replication - 1 We have briefly discussed that DNA is the genetic molecule of life. In eukaryotic organisms DNA (along with its histone proteins) is found in chromosomes. All cell activities
More informationDNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.
DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov
More information4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.
1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.
More informationPre-Lab: Molecular Biology
Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationDNA Replication. Packet #17 Chapter #16
DNA Replication Packet #17 Chapter #16 1 HISTORICAL FACTS ABOUT DNA 2 Historical DNA Discoveries 1928 Frederick Griffith finds a substance in heat-killed bacteria that transforms living bacteria 1944 Oswald
More informationThe DNA Molecule: The Molecular Basis of Inheritance
Slide hapter 6 he DN Molecule: he Molecular Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil ampbell and Jane Reece Lectures by hris Romero, updated by Erin Barley
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationPowerPoint Notes on Chapter 9 - DNA: The Genetic Material
PowerPoint Notes on Chapter 9 - DNA: The Genetic Material Section 1 Identifying the Genetic Material Objectives Relate Griffith s conclusions to the observations he made during the transformation experiments.
More informationDNA Structure and Replication 1
Name: # Date: Per: Why? DNA Structure and Replication How is genetic information stored and copied? Deoxyribonucleic acid or DNA is the molecule of heredity. It contains the genetic blueprint for life.
More informationThe Molecul Chapter ar Basis 16: The M of olecular Inheritance Basis of Inheritance Fig. 16-1
he Chapter Molecular 16: he Basis Molecular of Inheritance Basis of Inheritance Fig. 16-1 dditional Evidence hat DN Is the Genetic Material It was known that DN is a polymer of nucleotides, each consisting
More informationDNA Structure and Replication
Name: DNA Structure and Replication 1. DNA: Deoxyribonucleic Acid a. Credit for discovery is given to Watson & Crick b. DNA stands for c. This chemical substance is present in the of all cells in all living
More informationDNA replication. - proteins for initiation of replication; - proteins for polymerization of nucleotides.
DNA replication Replication represents the duplication of the genetic information encoded in DNA that is the crucial step in the reproduction of living organisms and the growth of multicellular organisms.
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More information1. Describe the structure of DNA. Be sure to include what forms the skeleton and how are the strands held together? 2. Compare and contrast
1. Describe the structure of DNA. Be sure to include what forms the skeleton and how are the strands held together? 2. Compare and contrast chromosomes, chromatids, genes, and alleles. 3. Compare and contrast
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationSummary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
More informationDNA: The Molecule of Heredity
1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate
More informationChapter 2 DNA extended response [108 marks]
Chapter 2 DNA extended response [108 marks] 1a. Describe the genetic code and its relationship to polypeptides and proteins. Remember, up to TWO quality of construction marks per essay. a. (the genetic
More informationActive Learning Exercise 9. The Hereditary Material: DNA
Name Biol 211 - Group Number Active Learning Exercise 9. The Hereditary Material: DNA Reference: Chapter 16 (Biology by Campbell/Reece, 8 th ed.) 1. a.) What is a nucleotide? b.) What is a nitrogen base?
More informationMolecular Biology, Lecture 3 DNA Replication
Molecular Biology, Lecture 3 DNA Replication We will continue talking about DNA replication. We have previously t discussed the structure of DNA. DNA replication is the copying of the whole DNA content
More informationDNA and RNA 2/14/2017. What is a Nucleic Acid? Parts of Nucleic Acid. DNA Structure. RNA Structure. DNA vs RNA. Nitrogen bases.
DNA and RNA Nucleic Acids What is a Nucleic Acid? Nucleic Acids are organic molecules that carry information needed to make proteins Remember: proteins carry out ALL cellular activity There are two types
More informationWednesday, April 9 th. DNA The Genetic Material Replication. Chapter 16
Wednesday, April 9 th DNA The Genetic Material Replication Chapter 16 Modified from Kim Foglia Scientific History The march to understanding that DNA is the genetic material T.H. Morgan (1908) Frederick
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationMicrobiology: The Blueprint of Life, from DNA to protein
Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More informationDNA: Structure and Replication - 1
DNA: Structure and Replication - 1 We have briefly discussed that DNA is the genetic molecule of life. In eukaryotic organisms DNA (along with its histone proteins) is found in chromosomes. We have also
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More information12.1 Identifying the Substance of Genes
12.1 Identifying the Substance of Genes Lesson Objectives Summarize the process of bacterial transformation. Describe the role of bacteriophages in identifying genetic material. Identify the role of DNA
More informationDNA The Genetic Material
DNA The Genetic Material 2006-2007 Chromosomes related to phenotype T.H. Morgan working with Drosophila fruit flies associated phenotype with specific chromosome white-eyed male had specific X chromosome
More informationReplication. Obaidur Rahman
Replication Obaidur Rahman DIRCTION OF DNA SYNTHESIS How many reactions can a DNA polymerase catalyze? So how many reactions can it catalyze? So 4 is one answer, right, 1 for each nucleotide. But what
More informationTest Prep Pretest. in the. the. whereas prokaryotic DNA contains only replication forks during replication. Skills Worksheet
Skills Worksheet Test Prep Pretest Complete each statement by writing the correct term or phrase in the space provided. 1. In 1928, Frederick Griffith found that the capsule that enclosed one strain of
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationUnit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
More informationDNA, RNA and Protein Synthesis
By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude
More informationDNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling
Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between
More information12-1 DNA The Structure of DNA (Pages )
12-1 DNA The Structure of DNA (Pages 291-294) The Components and Structure of DNA You might think that knowing genes were made of DNA would have satisfied scientists, but that was not the case at all.
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationSeptember 19, synthesized DNA. Label all of the DNA strands with 5 and 3 labels, and clearly show which strand(s) contain methyl groups.
KEY DNA Replication and Mutation September 19, 2011 1. Below is a short DNA sequence located on the E. coli chromosome. In class we talked about how during the process of DNA replication, an enzyme adds
More informationAP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
More information3. INHERITED MUTATIONS
THE CENTRAL DOGMA OF BIOLOGY 1. DNA B4.2 The genetic information encoded in DNA molecules provides instructions for assembling protein molecules. Genes are segments of DNA molecules. Inserting, deleting,
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationThe common structure of a DNA nucleotide. Hewitt
GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided
More informationMolecular Biology of the Gene
Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides
More informationRead each question, and write your answer in the space provided. 2. How did Mendel s scientific work differ from the work of T. A. Knight?
Name Date Class CHAPTER 8 DIRECTED READING Mendel and Heredity Section 8-1: The Origins of Genetics Mendel and Others Studied Garden-Pea Traits 1. What did T. A. Knight discover? 2. How did Mendel s scientific
More informationDNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
More information