BA, BSc, and MSc Degree Examinations
|
|
- Chloe Morgan
- 6 years ago
- Views:
Transcription
1 Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available for this paper: 50 Instructions: Answer all ques ons in the spaces provided on the examina on paper The marks available for each ques on are indicated on the paper Materials Supplied: CALCULATOR For marker use only: Office use only: Total as % DO NOT WRITE ON THIS BOOKLET BEFORE THE EXAM BEGINS DO NOT TURN OVER THIS PAGE UNTIL INSTRUCTED TO DO SO BY AN INVIGILATOR page 1 of 12
2 Answer all questions in the spaces provided 1. This image below was taken during the practical analysing spermatogenesis in the male Locust (22, X0). a) Specify the phase and subphase(s) this picture may have been taken at. Phase: Prophase I Subphases: These are only seen during transition from pachytene, diplotene and diakenesis (will accept any of them) b) What do the arrows point at and what do they indicate has happened? Chiasmata They indicate points where DNA exchanges between non-sister chromatids may have occurred. c) What would the chromosomal content of the gametes be? 11 or 11, X LO: Describe how chromosomes behave during meiosis page 2 of 12
3 2. A pure breed of normal size albino pigeons arrive at an island and successfully reproduce with the local population, which is also a pure breed characterized by grey feathers and large body size. F1 individuals all show grey feathers and normal size. a) Using the letters G (grey feathers) and g (albino feathers) to indicate the colour of the feathers and L (normal) and l (large) to indicate the body size, write the genotype of the parents of this cross and the F1. P: ggll X GGll F1: GgLl b) If F1 pigeons mate amongst themselves, assuming these two genes are on different chromosomes, how many albino pigeons of large size would be expected out of 80? Show your working. (2 marks) GgLl x GgLl Albino ¼ X large size ¼=1/16 (1) 80/16=5 (1) c) The colonizers have a unique singing ability and display a fantail whereas the local population do not. All F1 pigeons have the unique singing ability but not the fantail. Using the symbols N (dominant) or n (recessive) for singing ability and D (dominant) or d (recessive) for fantail, write the genotypes for these two genes for the parents (P) and the F1 of this cross. P: NNdd nndd F1: NnDd d) Pigeons from the F1 generation that mated with double homozygous recessive pigeons (nndd) produced 100 progeny pigeons that were all classified as Nndd (50%) and nndd (50%). What would you conclude from this? (2 marks) NnDd X nndd The F1 only produces gametes that are Nd and nd, the same as their page 3 of 12
4 parents, indicating these genes are linked on the same chromosome at a very short distance from each other. LO: Apply basic probability rules to calculate the likelihood of genetic outcomes in Mendelian Genetics 3. In a test cross in maize between a triple heterozygous plant and a triple homozygous recessive plant 850 plants were obtained. The alleles are arranged on the chromosomes as indicated below. v cM pr cM bm Considering the genetic distances between the genes: a) Calculate the number of single crossover plants between pr and bm that would be expected from the cross above. Show your working. (3 marks) Probability of double crossovers: 0.223X0.434= =9.6782% Percentage of single crossover pr-bm= = % Number of plants out of 850=850 X %=287 b) Write the alleles of the recombinant chromosome of these single crossover classes. v pr+ bm and v+ pr bm+ LO: Explain the relationship between meiotic events and phenotypic classes for linked genes page 4 of 12
5 4. Study the pedigree below and answer the following questions: a) What is the pattern of inheritance? Autosomal recessive b) Write the genotypes that can be ascertained using letters that can clearly distinguish the mutant from the normal allele. (2 marks) I: Aa, Aa, aa, Aa II: A_, aa, aa, Aa, Aa, aa III: aa, A_ (2 marks for full answer, 0.5 deducted per mistake) c) What is the probability of individual III.2 being a carrier for this disease? 2/3 5. Provide a short definition for each of the following terms: a) Open Reading Frame Sequence of DNA consisting of triplet codons that can be translated into amino-acids starting with an initiation codon and ending with a stop codon Surprisingly few accurate definitions given the number of times the term was used in the module. b) Promoter Region of DNA where RNA polymerase binds to initiate transcription A common mistake. was to suggest the promoter is a protein c) Operon page 5 of 12
6 Cluster of genes under the control of a single promoter and transcribed as a single mrna A common mistake was to confuse operon with operator. LO: Describe the basic mechanisms of transcription and translation in prokaryotes and eukaryotes 6. A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: -GGCTAGCTGCTTCCTTGGGGA- -CCGATCGACGAAGGAACCCCT- a) Which is the template strand? A genetic code table is provided. b) Label the end of each strand with the correct 5 and 3 polarity. 3 -GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT-3 LO: Describe the basic mechanisms of transcription and translation in prokaryotes and eukaryotes LO: Solve problems to demonstrate an understanding of how gene expression is controlled. Mostly correct answers. page 6 of 12
7 7. You are using mutants to study the regulation of the lac operon in E.coli. Provide explanations for the following mutant phenotypes. a) Mutant 1 produces high levels of the lac structural proteins even in the absence of lactose. DNA sequence analysis of the promoter and operator sequences of the lac operon shows no difference to wild-type. (2 marks) This is likely to be a loss-of-function mutation in the laci repressor gene so that it fails to bind to the operator sequence and repress transcription. b) Mutant 2 produces lower levels of lac structural proteins in the presence of lactose and absence of glucose than wild-type. DNA sequence analysis of the promoter, operator and structural genes of the lac operon shows no difference to wild-type. (2 marks) This could be a loss-of-function mutation in the CAP activator protein - the lac operon is released from repression by lactose but fails to be activated by the absence of glucose Mostly correct answers for both parts a and b. Answers that showed logical thinking were credited - even if they were different to the model answer given. LO: Solve problems to demonstrate an understanding of how gene page 7 of 12
8 expression is controlled. 8. Consider the pedigree below that shows the occurrence of achondroplasia (dwarfism/short stature) in a family. Achondroplasia can be caused by mutations in the FGFR-3 gene. DNA sequencing of the FGFR-3 gene was undertaken for some of the individuals and two different alleles were identified. Partial sequence of the relevant area of these alleles is shown below with the correct reading frame of the coding strand indicated. Allele A: ATC-CTC-AGC-TAC-GGG-GTG-GGC-TTC-TTC Allele B: ATC-CTC-AGC-TAC-AGG-GTG-GGC-TTC-TTC Individuals II-2 and II-3: Both have two copies of allele A Individual III-1: One copy of allele A and one copy of allele B Individual III-2: Two copies of allele A Individuals IV-1 and IV-4: Both have one copy of allele A and one copy of allele B Individuals IV-2 and IV-3: Both have two copies of allele A. a) Which of the following provides the most likely explanation for the mode of inheritance of achondroplasia shown in the pedigree assuming that all parentage is confirmed? i) That inheritance is autosomal recessive page 8 of 12
9 ii) That inheritance is autosomal dominant but that generations I and II have been diagnosed incorrectly Mostly correct answers iii) That inheritance is autosomal dominant but has arisen spontaneously in individual III-1 b) Does the sequence difference between alleles A and B correspond to a mis-sense, nonsense, frame-shift or silent mutation? The genetic code table provided for question 6 can be used here. Missense. Mostly correct answers c) The normal physiological function of the FGFR3 protein is to negatively regulate bone formation. Do you expect the protein encoded by allele A to be more or less active than that encoded by allele B and therefore should the disease be described as being caused by a gain-of-function or loss-of-function mutation? (2 marks) Allele A will be less active. The disease is gain-of-function. Mostly correct answers though some had not understood that allele B was the disease state. LO: Define what is a gene and understand how genotype relates to phenotype LO: Describe the basic mechanisms of transcription and translation in prokaryotes and eukaryotes LO: Solve problems to demonstrate an understanding of how gene expression is controlled. 9. You are given a DNA sequence of several thousand kilobases. List four features that would indicate that the sequence is obtained from a prokaryote such as E.coli rather than a higher eukaryote such as a human? (4 marks) Genes would be closely spaced together No introns Presence of operons Lack of repetitive sequences Other possibilities accepted Many got some but not full marks. There were some answers that were too vague to gain credit (eg. just saying less complex without explaining what this means). There were also some alarming errors - eg. suggesting that prokaryotes have single-stranded rather than double-stranded DNA or that page 9 of 12
10 prokaryotes have uracil instead of thymine). Other answers suggested differences between prokaryotes and eukaryotes that would not be apparent just from the DNA sequence (eg. differences in DNA packaging). LO: Compare and contrast the content and organization of prokaryotic and eukaryotic genome 10. Describe how it was shown that DNA is the transforming agent in bacterial transformation. (4 marks) Two bacterial strains were used, one lethal to mice, one non-lethal (1). When the lethal strain was heat-inactivated and mixed with the non-lethal strain, mice injected with the mix died, showing that transformation of the non-lethal strain had taken place (1). To discover what the transforming agent was, different components of the inactivated lethal strain were destroyed before mixing with the non-lethal strain, and then injected into mice (1). Only when the DNA of the lethal strain was destroyed, the injected mice survived (1). LO: Compare and contrast the content and organization of prokaryotic and eukaryotic genome Many answers were awarded full marks. Some students did not include the inactivation of different components in their answers. Several confusions with experiments on conjugation and transduction. 11. You are provided with purified plasmid DNA (cloning vector) and purified human genomic DNA containing the sequence of interest (see pictures below). page 10 of 12
11 a) Describe how you could insert the genomic sequence of interest into the cloning vector, so that the region labelled y of the sequence of interest is adjacent to the region labelled x of the cloning vector (BamHI, EcoRI and HindIII produce cohesive ends). (6 marks) Amplification of the sequence of interest by PCR (1), using a primer with an overhang containing a EcoR1 restriction site for the primer at y (1), and a primer with an overhang containing a HindIII site for the other end of the sequence of interest (1). Cutting the plasmid (1) and PCR product with EcoR1 and HindIII (1), ligating PCR fragment into the plasmid using DNA ligase (1). Only very few answers were awarded full marks. Many students suggested insertion into the EcoRI site, but this would allow the insert to integrate in either orientation. Several students suggested using BamHI, which cannot be used as it cuts inside the sequence of interest. b) After transformation of E.coli with the resulting DNA and isolation of plasmid DNA from several E.coli clones, you carry out diagnostic restriction digests. List the DNA fragment sizes that you would obtain. page 11 of 12
12 (4 marks) Vector + insert, digested with BamHI: Vector only, digested with BamHI: Vector + insert, digested with EcoRI: Vector only, digested with EcoRI: Vector + insert, digested with BamHI: 4.5kb + 1.5kb Vector only, digested with BamHI: 4kb Vector + insert, digested with EcoRI: 6kb Vector only, digested with EcoRI: 4kb Many good answers. Answers to a) were considered when awarding marks. c) Explain how you could use PCR to confirm that the insert was inserted into the vector. (2 marks) Carry out PCR with one primer in the vector, one primer in the insert (1). You would only get a PCR product if the insert is present in the vector (1). Some answers were awarded full marks. Many students suggested blue/white selection or diagnostic digests, but these approaches don t require the use of PCR. LO4 Describe techniques of recombinant DNA technology and solve problems to demonstrate understanding page 12 of 12
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationGENETICS. I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide chains wrap around each other to form a
GENETICS I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide 1. 2. 3. chains wrap around each other to form a Chains run in opposite direction known as Type of bond between the
More informationProblem Set 2B Name and Lab Section:
Problem Set 2B 9-26-06 Name and Lab Section: 1. Define each of the following rearrangements (mutations) (use one phrase or sentence for each). Then describe what kind of chromosomal structure you might
More informationR1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1
Bcor101 Sample questions Midterm 3 1. The maps of the sites for restriction enzyme EcoR1 (R1) in the wild type and mutated cystic fibrosis genes are shown below: Wild Type R1 12 kb R1 4 kb R1 _ _ CF probe
More informationBio 311 Learning Objectives
Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,
More informationBS 50 Genetics and Genomics Week of Nov 29
BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated
More informationThe Regulation of Bacterial Gene Expression
The Regulation of Bacterial Gene Expression Constitutive genes are expressed at a fixed rate Other genes are expressed only as needed Inducible genes Repressible genes Catabolite repression Pre-transcriptional
More informationSelf-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationLinkage & Genetic Mapping in Eukaryotes. Ch. 6
Linkage & Genetic Mapping in Eukaryotes Ch. 6 1 LINKAGE AND CROSSING OVER! In eukaryotic species, each linear chromosome contains a long piece of DNA A typical chromosome contains many hundred or even
More informationRead each question, and write your answer in the space provided. 2. How did Mendel s scientific work differ from the work of T. A. Knight?
Name Date Class CHAPTER 8 DIRECTED READING Mendel and Heredity Section 8-1: The Origins of Genetics Mendel and Others Studied Garden-Pea Traits 1. What did T. A. Knight discover? 2. How did Mendel s scientific
More information1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna).
1. The diagram below shows an error in the transcription of a DNA template to messenger RNA (mrna). Which statement best describes the error shown in the diagram? (A) The mrna strand contains the uracil
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More information7.014 Quiz III 4/22/05. Write your name on this page and your initials on all the other pages in the space provided.
7.014 Quiz III 4/22/05 Your Name: TA's Name: Write your name on this page and your initials on all the other pages in the space provided. This exam has 10 pages including this coversheet. Check that you
More informationNAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late.
MIT Department of Biology 7.013: Introductory Biology - Spring 2004 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. laudette ardel NME T SE 7.013 Problem Set 3 FRIDY March 5, 2004 Problem
More information1. DNA replication. (a) Why is DNA replication an essential process?
ame Section 7.014 Problem Set 3 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68120 by 5:00pm on Friday
More information7.013 Problem Set 3 FRIDAY October 8th, 2004
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert. Weinberg, Dr. laudette ardel Name: T: 7.013 Problem Set 3 FRIDY October 8th, 2004 Problem
More informationGENETICS: BIOLOGY HSA REVIEW
GENETICS: BIOLOGY HSA REVIEW HSA Review A. Matching: On the lines provided, write the letter of the definition of each term. a. genetics f. gamete b. trait g. probability c. hybrid h. Punnett square d.
More informationAnswers to additional linkage problems.
Spring 2013 Biology 321 Answers to Assignment Set 8 Chapter 4 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_04.pdf Answers to additional linkage problems. Problem -1 In this cell, there two copies
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationChapter 14: Genes in Action
Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate
More informationNON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationSolutions to Quiz II
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationChapter 6 Linkage and Chromosome Mapping in Eukaryotes
Chapter 6 Linkage and Chromosome Mapping in Eukaryotes Early Observations By 1903 Sutton pointed out likelihood that there were many more unit factors than chromosomes in most species Shortly, observations
More informationDNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.
DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov
More informationChapter 2 - DNA MC [37 marks]
Chapter 2 - N MC [37 marks] 1. The image shows a N nucleotide. Which correctly identifies the parts labelled I and II? C 2. Which model represents transcription? 3. Which sequence represents the order
More informationGenetics Lecture Notes Lectures 17 19
Genetics Lecture Notes 7.03 2005 Lectures 17 19 Lecture 17 Gene Regulation We are now going to look at ways that genetics can be used to study gene regulation. The issue is how cells adjust the expression
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationAn introduction to genetics and molecular biology
An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular
More informationThe information provided below may be useful in answering some questions.
Molecular Exam 1 More Tutorial at www.dumblittledoctor.com The information provided below may be useful in answering some questions. INFORMATION ON COMPONENTS OF RIBOSOMES I. Prokaryotes (e.g. E. coli)
More informationCBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription:
CBA #4 Practice Exam Genetics 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: 2) (TEKS 5C) All of the following are true statements about cell differentiation EXCEPT A. Cell
More informationDNA segment: T A C T G T G G C A A A
DNA Structure, Replication, Protein Synthesis & Name Period Genetics Study Guide Chapter 12 and 13 Structure of DNA and Protein Synthesis 1. What macromolecule is coded for by genes located on DNA? Provide
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationBasic Concepts of Human Genetics
Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes
More informationUNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Bacterial pathogenesis Time Allowed: 2 hours Marking Scheme:
More informationGene Mutation, DNA Repair, and Transposition
Gene Mutation, DNA Repair, and Transposition Mutations Are Classified in Various Ways Spontaneous mutations happen naturally and randomly and are usually linked to normal biological or chemical processes
More information1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?
Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More information& Practice
IB BIOLOGY 4.1-4.3 & 10.1-10.3 Practice 1. Red-green colour blindness is a sex-linked condition. Which of the following always shows normal vision? (HL p1 May09 TZ1 q11) A. A homozygous male B. A homozygous
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationREGULATION OF GENE EXPRESSION
REGULATION OF GENE EXPRESSION Each cell of a living organism contains thousands of genes. But all genes do not function at a time. Genes function according to requirements of the cell. Genes control the
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationGenetics Final Exam Summer 2012 VERSION B. Multiple Choice (50 pts. possible) IF you completed the in-class workshop put a CHECK MARK HERE --->
enetics Final Exam Summer 2012 VERSION B Name Multiple hoice (50 pts. possible) Problems (50 points possible) Total (100 points possible) KEY IF you completed the in-class workshop put a HEK MRK HERE --->
More informationLINKAGE AND CHROMOSOME MAPPING IN EUKARYOTES
LINKAGE AND CHROMOSOME MAPPING IN EUKARYOTES Objectives: Upon completion of this lab, the students should be able to: Understand the different stages of meiosis. Describe the events during each phase of
More informationDO NOT OPEN UNTIL TOLD TO START
DO NOT OPEN UNTIL TOLD TO START BIO 312, Section 1, Spring 2011 February 21, 2011 Exam 1 Name (print neatly) Instructor 7 digit student ID INSTRUCTIONS: 1. There are 11 pages to the exam. Make sure you
More informationThe Mosaic Nature of Genomes
The Mosaic Nature of Genomes n DNA sequence is not static Mutations of single bases Large deletions Large insertions of sequence n Transferred from other species n New functions useful in particular situations
More information3. INHERITED MUTATIONS
THE CENTRAL DOGMA OF BIOLOGY 1. DNA B4.2 The genetic information encoded in DNA molecules provides instructions for assembling protein molecules. Genes are segments of DNA molecules. Inserting, deleting,
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationGene mutation and DNA polymorphism
Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationencodes a sigma factor to modify the recognition of the E.coli RNA polymerase (Several other answers would also be acceptable for each phage)
Name Student ID# Bacterial Genetics, BIO 4443/6443 Spring Semester 2001 Final Exam 1.) Different bacteriophage utilize different mechanisms to ensure that their own genes (and not host s genes) are transcribed
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationChapter 6. Linkage Analysis and Mapping. Three point crosses mapping strategy examples. ! Mapping human genes
Chapter 6 Linkage Analysis and Mapping Three point crosses mapping strategy examples! Mapping human genes Three point crosses Faster and more accurate way to map genes Simultaneous analysis of three markers
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationBio 121 Practice Exam 3
The material covered on Exam 3 includes lecture since the last exam and text chapters 13-21. Be sure that you read chapter 19, which was not represented in the notes. 1. Which of the following is an enveloped
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationToday s lecture: Types of mutations and their impact on protein function
Today s lecture: Types of mutations and their impact on protein function Mutations can be classified by their effect on the DNA sequence OR the encoded protein 1 From my Lecture 4 (10/1): Classification
More informationConcepts of Genetics Ninth Edition Klug, Cummings, Spencer, Palladino
PowerPoint Lecture Presentation for Concepts of Genetics Ninth Edition Klug, Cummings, Spencer, Palladino Chapter 5 Chromosome Mapping in Eukaryotes Copyright Copyright 2009 Pearson 2009 Pearson Education,
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More information14 Gene Expression: From Gene to Protein
CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information
More informationfour chromosomes ` four chromosomes correct markers (sister chromatids identical!)
Name KEY total=107 pts 1. Genes G and H are on one chromosome; gene F is on another chromosome. Assume the organism is diploid and that there is no crossing over in this species. You are examining the
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More information--maternal age effect: older mothers produce more aneuploid (Down's, etc.) babies than younger mothers. No effect of father's age.
Chromosomes --each gene makes a protein. A gene is just a region of the DNA on the chromosome, not different from any other part of the chromosome. Humans have about 30,000 genes. The location of a gene
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationQ1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution.
Short questions 1 point per question. Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution. Answer: Water is sucked out of the cells by osmosis (this reduces
More informationAP2013-DNAPacket-II. Use the list of choices below for the following questions:
Class: Date: AP2013-DNAPacket-II Multiple Choice Identify the choice that best completes the statement or answers the question. Use the list of choices below for the following questions: I. helicase II.
More informationPUC Vikasana Program- 2012
Chromosome Nucleus DNA PUC Vikasana Program- 2012 Introduction Molecular biology is the study of biology at a molecular level. Macromolecules and the macromolecular mechanisms. Interactions between the
More information(b) Draw a genetic linkage map showing map distances between met, thi, and pur.
Botany 132 Final exam 2002 Name Please show all of your work in answering the questions below. 1. F- bacterial cells of genotype met - thi - pur - were conjugated with F+ cells with the genotype met +
More informationDNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling
Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between
More information7 Gene Isolation and Analysis of Multiple
Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple
More informationHuman linkage analysis. fundamental concepts
Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationSome types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
More informationUnit 6: Gene Activity and Biotechnology
Chapter 16 Outline The Molecular Basis of Inheritance Level 1 Items students should be able to: 1. Recognize scientists and the experiments that lead to the understanding of the molecular basis of inheritance.
More information-Genes on the same chromosome are called linked. Human -23 pairs of chromosomes, ~35,000 different genes expressed.
Linkage -Genes on the same chromosome are called linked Human -23 pairs of chromosomes, ~35,000 different genes expressed. - average of 1,500 genes/chromosome Following Meiosis Parental chromosomal types
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationTrasposable elements: Uses of P elements Problem set B at the end
Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches
More informationVideo Tutorial 9.1: Determining the map distance between genes
Video Tutorial 9.1: Determining the map distance between genes Three-factor linkage questions may seem daunting at first, but there is a straight-forward approach to solving these problems. We have described
More informationRead and take notes on pages
Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have
More informationSummary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
More informationGENE REGULATION IN PROKARYOTES
GENE REGULATION IN PROKARYOTES Prepared by Brenda Leady, University of Toledo Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene regulation refers to
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More informationGene Linkage and Genetic. Mapping. Key Concepts. Key Terms. Concepts in Action
Gene Linkage and Genetic 4 Mapping Key Concepts Genes that are located in the same chromosome and that do not show independent assortment are said to be linked. The alleles of linked genes present together
More informationUsing mutants to clone genes
Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationGenetics and Heredity. Mr. Gagnon
Genetics and Heredity Mr. Gagnon Key Terms: Traits Heredity Genetics Purebred Genes Alleles Recessive Allele Dominant Allele Hybrids Key Concepts: What factors control the inheritance of traits in organisms?
More information