Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology. Chad Zimprich January 2015
|
|
- Malcolm Matthews
- 6 years ago
- Views:
Transcription
1 Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology Chad Zimprich January 2015
2 Presentation verview HaloTag Fusion Technology Design Functionality Ligands Imaging Focus on HaloTag for: Cellular localization studies Protein trafficking o Real-time o Spatial/Temporal o Multiplexing o High content screening 2
3 What is HaloTag Technology? A Unique, Multifunctional Protein Fusion Tag HaloTag : Engineered 34.1kDa halophilic bacterial hydrolase Binds to chloralkane substrate and locks with covalent attachment Faster kinetics than the biotin:streptavidin interaction No homolog in mammalian cells = no background Read more about the development of this powerful fusion tag: hana, R.F., et al. (2009) Prot. Exp. Purif. 68, Protein of Interest HaloTag + N- or C- terminal fusions Protein of Interest Cl Chloroalkane Linker Binding and Functional Group Functional Group Covalent bond between HaloTag and chloroalkane (+ functional group) 3
4 HaloTag Fusion Protein Technology A Powerful, Multifunctional Fusion Protein Tag Protein of Interest Functional Group Cl HaloTag Surfaces/Resins Capture and Display Protein arrays Purification Interactions Magnetic, non-magnetic resins, glass slides Cl Cl HaloTag Fluorescent Ligands Labeling and Detection Cellular imaging Many colors of cell Gel analysis permeable & impermeable ligands Quantitation Animal Imaging Cl HaloTag Reactive Ligands Custom Modifications Attach to particles, surfaces Attach special ligands e.g. Quantum Dots, PET ligands 4
5 HaloTag Fusion Protein Technology Many Applications with a Single Fusion Protein Protein:Protein Interactions Ga s AC Protein Localization & Trafficking Protein:Nucleic Acid Interactions Protein of Interest Purify Structural Studies Enzymatic Assays Kinetic Studies 5
6 Multiple Cell Permeable & Impermeable Fluorescent HaloTag Ligands Available Y Y Y Y Y Y Y Y Y Membrane impermeable ligands label fusion protein where HaloTag is outside the cells Cell permeable ligands label all HaloTag proteins throughout cells Sequential labeling with impermeable then permeable ligands enables differential labeling 6
7 Simple Intracellular Labeling and Imaging with HaloTag Technology Transfect HT-RF expression vector Add fluorescent ligand Image live or fixed cells Wash out unbound ligand GST Alternate labeling protocol with no-washing Fluorescent Ligand covalently attached to HaloTag Fusion protein No cytotoxicity Minimal background fluorescence Multiple colors available Cell permeable (complete cell staining) Cell impermeable (cell surface staining) Rapid and easy protocols 7
8 HaloTag Intracellular Protein Localization and Detection Throughout the Cell 8
9 HaloTag Protein Trafficking Real-time Imaging Signal (TNFa, LPS, UV ) NFkB Signaling Pathway p50 p65 IkB P p50 p65 P IkB P P p50 p65 P IkB P P p50 p65 p50 p65 Cell membrane Cytoplasm Nucleus 0 min 5 min 10 min 20 min HeLa cells expressing p65- HaloTag labeled with TMR Ligand Treated with TNFa Imaged (5min/frame; 120min) 40 min 60 min 80 min 100 min GV Los, et al. HaloTag: a novel protein labeling technology for cell imaging and protein analysis. ACS Chem Biol, Jun 2008; 3(6):
10 HaloTag Protein Trafficking Spatial and Temporal Analysis Label w/ impermeable GREEN Label w/ permeable RED Wash Image Incubate 12 hrs Image 1. Label with cell impermeable ligand 2. Label with cell permeable ligand 12hrs 12 hours Svendsen, S., et al. BMC Cell Biol, 9: 17,
11 Trafficking and Assembly of GABA A Receptor (LGIC superfamily) a g HaloTag - non-permeable - permeable No Effect on GABA A R Pharmacology γ2l-halotag co-expressed with α1 or b2 does not traffick to cell surface γ2l-halotag co-expressed with both α1 and β2 trafficks to cell surface In collaboration with Srinivasan Venkatachalan and Cynthia Czajkowski, UW-Madison 11
12 Monitoring GPCR Internalization: HaloTag -EDG1 The Biology of GPCRs HEK 293 cells expressing phalotag -EDG1 labeled with Alexa488 (surface) and TMR (internal) Ligands Treated with S1P Imaged (2min/frame; 30min) 12
13 Surface Receptor Internalization Assay with HaloTag ph Sensor ph Sensor Imaging Based Fluorescence Assay HaloTag ph Sensor: Dark at physiological ph HaloTag ph Sensor: Gain of signal assay Live Cell Kinetic HaloTag Dual Functionality: Receptor internalization and recycling ph Titration and Fluorescence Recovery U20S HT-EDG1 Labeled with HT-pH sensor Stimulated with S1P Images acquired 13
14 Creation of a HaloTag Ligand for High Resolution (STED) Microscopy Confirmed ligand specificity for HaloTag in cells by confocal: β1 integrin (truncation)-halotag in HeLa Cells Schroder, et al. In Vivo Labeling Method Using a Genetic Construct for Nanoscale Resolution Microscopy. Biophysical Journal 96, (1),
15 Multiplexing HaloTag Imaging with ther Methods hmgfp α-tubulin HaloTag NLS 3 -TMR ligand p65-halotag -TMR Ligand Anti- -tubulin/alexa nd Ab HaloTag imaging is compatible with: Fluorescent protein fusions Fixing and antibody staining Simultaneous labeling during fixation is also possible 15
16 High Content Screening Whole Cell-based Assays 18 h 0 h 3 h 6 h 9 h 12 h 15 h 18 h Extracellular labeling of ECS-HaloTag fusion protein with Alexa 488 HaloTag ligand Protein internalization - endosome formation punctate staining Image analysis and quantitation 16
17 HaloTag Imaging Summary Making Trafficking Studies Possible Simple, efficient labeling of HaloTag fusion proteins No cytotoxicity of HaloTag fluorescent ligands Technology enables both temporal and spatial trafficking studies Intracellular vs. cell surface differential labeling using cell permeable and impermeable labeling ligands Well-suited to high content screening due to pulse labeling Multiple label colors available Same fusion protein used for other applications: Protein:protein interactions Purification enzyme or structural studies Chromatin IP 17
18 Technical Services Scientists are Ready to Help By phone: Available 7am-6pm Central M-F nline Available 7am-6pm Central M-F Global Chat with Branch office tech serv scientists, too, after hours (language dependent) Guaranteed answers within 24hr Most responses within 2hrs 18
19 Thank You! 19
Cell Imaging. Localization: Robust protein labeling of live or fixed cells
F eat u r es & B e n efits ptions Cell Imaging with the alotag platform Localization: Robust protein labeling of live or fixed cells Trafficking & Turnover: Directly observe proteins with one or two colors
More informationMonitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics
Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Proteomics and studying dynamic interactions AP-MS Proteomics
More informationXfect Protein Transfection Reagent
Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection
More informationKinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)
Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make
More informationChallenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor
Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+
More informationCytomics in Action: Cytokine Network Cytometry
Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University
More informationHALOLINK RESIN FOR PROTEIN PULL-DOWN AND ANALYSIS
HALOLINK ESIN FO POTEIN PULL-DOWN AND ANALYSIS MAJETA UH, PH.D. 1, DAN SIMPSON, PH.D. 1, JACQUI SANKBEIL, M.S. 1, DANETTE HATZELL, PH.D. 1, NATASHA KAASSINA, M.S. 1, NADINE NASSIF, M.S. 1, JAMI ENGLISH,
More informationphab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation
phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationa) JOURNAL OF BIOLOGICAL CHEMISTRY b) PNAS c) NATURE
a) JOURNAL OF BIOLOGICAL CHEMISTRY b) c) d) ........................ JOURNAL OF BIOLOGICAL CHEMISTRY MOLECULAR PHARMACOLOGY TRENDS IN PHARMACOLOGICAL S AMERICAN JOURNAL OF PHYSIOLOGY-HEART AND CIRCULATORY
More informationQImaging Camera Application Notes Multicolor Immunofluorescence Imaging
QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationThe microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and
SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen
More informationCBI Toolbox Tour 2015
CBI Toolbox Tour 2015 Thermophoresis (NanoTemper) NT.115 & NT.LabelFree Images: NanoTemper Circular Dichroism Jasco J-1500 Spectrometer Six Position Turreted Peltier Temperature Control System Automated
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationMicroarray Industry Products
Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase
More informationIntroduction to Protein Purification
Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationNewsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions
www.iba-biotagnology.com Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions Strep-tag and One-STrEP-tag PPI Analysis with the co-precipitation/ mass spectrometry approach 3 Background
More informationRayBio Human NF-κB p65 Transcription Factor Activity Assay Kit
RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
More informationFlow Cytometry - The Essentials
Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.
More informationA Cost-effective Workflow for High-Throughput Screening of G- Protein Coupled Receptors (GPCRs)
A p p l i c a t i o n N o t e A Cost-effective Workflow for High-Throughput Screening of G- Protein Coupled Receptors (GPCRs) Monitoring Receptor Mediated Calcium Flux Paul Held and Peter Banks, BioTek
More informationCorning Microplates for Microscopy and High Content Imaging. Improve results with microplates for high resolution cell imaging
Corning Microplates for Microscopy and High Content Imaging Improve results with microplates for high resolution cell imaging High Performance for Cell-based Assays Within the drug discovery process, high
More informationOne-step split GFP staining for sensitive protein detection and localization in mammalian cells
Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationProduct Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris
Glowing Products for Science Mix-n-Stain Antibody Labeling Kits Size: 1 labeling per kit Storage: -20 o C Stability: Stable for at least 1 year from date of receipt when stored as recommended. Components:
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationspecial offers from your protein biology resource
special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research
More informationSpecies predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.
1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus
More informationab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit
ab128967 - Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use only
More informationImmunofluorescence images of different core histones and different histone exchange assay.
Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,
More informationProfiling Ligands Of GPCR Targets Using An Optical Biosensor With Dynamic Mass Redistribution Technology
Profiling Ligands Of GPCR Targets Using An Optical Biosensor With Dynamic Mass Redistribution Technology Paul Lee, Ph.D. Lead Discovery Amgen Inc. Thousand Oaks, CA 2008 Label-Free Summit, Corning NY October
More informationExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system!
ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! ExiProgen - Automated Protein Synthesis/Purification System ExiProgen
More informationProtein Purification Products. Complete Solutions for All of Your Protein Purification Applications
Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to
More informationmcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
More informationApplications of HTRF and Tag-lite Assays for HTP Antibody Screening
Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Brigitte Devaux, PhD Bristol Myers Squibb, Redwood City CA HTRF Symposium April 25, 2013 1 Introduction Generate human therapeutic antibodies
More informationReal-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent
Nicola Bevan, Tim Dale, Del Trezise Essen BioScience Welwyn Garden City, Hertfordshire, UK Introduction Monoclonal antibodies are now widely used as anti-cancer, antiinflammatory and anti-viral therapeutic
More informationCytoPainter Golgi Staining Kit Green Fluorescence
ab139483 CytoPainter Golgi Staining Kit Green Fluorescence Instructions for Use Designed for the detection of Golgi bodies by microscopy This product is for research use only and is not intended for diagnostic
More informationThe Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More informationab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
More informationStrategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
More informationQuickTiter Adenovirus Titer ELISA Kit
Product Manual QuickTiter Adenovirus Titer ELISA Kit Catalog Number VPK-110 2 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Recombinant adenoviruses have tremendous
More informationFocus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer
xcelligence System Real-Time Cell Analyzer Focus Application Cell Migration Featured Study: Inhibition of Cell Migration by Gene Silencing Markus Greiner and Richard Zimmermann Department of Medical Biochemistry
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationOptimization of 2D Gel Transblotting for Host Cell Protein Analysis
Optimization of 2D Gel Transblotting for Host Cell Protein Analysis Jon Johansen, Matt Hoelter & Nancy Kendrick* Kendrick Labs Inc, Madison, WI www.kendricklabs.com Talk Outline Biologic drugs, recombinant
More informationSupplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward
Landes Bioscience www.landesbioscience.com Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward The level of HER2 expression is a predictor of antibody- HER2 trafficking behavior
More informationab Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit
ab64264 - Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More informationab SUMOylation Assay Kit
ab139470 SUMOylation Assay Kit Instructions for Use For the generation and detection of SUMOylated proteins in vitro. This product is for research use only and is not intended for diagnostic use. Version
More informationHow to perform-control immunostaining experiment - microscopist subjective point of view. Pawel Pasierbek
How to perform-control immunostaining experiment - microscopist subjective point of view. Pawel Pasierbek Immunolabeling and fluorescent detection became such a standard procedure in the biomedical research
More informationCharacterization of Aptamer Binding using SensíQ SPR Platforms
Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional
More informationAnalysis of receptor oligomerization by FRAP microscopy
TIGP CBMB Student Seminar Analysis of receptor oligomerization by FRAP microscopy Dorsch S, Klotz KN, Engelhardt S, Lohse MJ, Bünemann M Nat Methods. 2009 Mar;6(3):225 30. K. Vijayasarathy March 10 th
More informationThe mechanism(s) of protein folding. What is meant by mechanism. Experimental approaches
The mechanism(s) of protein folding What is meant by mechanism Computational approaches Experimental approaches Questions: What events occur and in what time sequence when a protein folds Is there a specified
More information-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay
-PLEX Immunogenicity Assay Application Note 1 Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay The use of biotherapeutics, biosimilars, and combination biotherapies
More informationKinase Activity: a total solution
Kinase Activity: a total solution Protein arrays for multiplex kinetic measurements Robust Instrumentation User friendly software Kinetic data at your fingertips! PamGene s novel platform for profiling
More informationSUMOstar Gene Fusion Technology
Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com
More informationCell Health and Viability Assays Real-time automated measurements of cell health and viability inside your incubator
INCUCYTE LIVE-CELL ANALYSIS SYSTEM Cell Health and Viability Assays Real-time automated measurements of cell health and viability inside your incubator See what your cells are doing and when they do it
More informationThe Making of the Fittest: Natural Selection and Adaptation
INTRODUCTION THE ROCK POCKET MOUSE THE BIOCHEMISTRY AND CELL SIGNALING PATHWAY OF MC1R The rock pocket mouse, Chaetodipus intermedius, is a small, nocturnal animal found in the deserts of the southwestern
More informationThe Confo body technology, a new platform to enable fragment screening on GPCRs
The Confo body technology, a new platform to enable fragment screening on GPCRs Christel Menet, PhD CSO Miptec, 216 Confo Therapeutics Incorporated in June 215 Located in Brussels, Belgium Confo Therapeutics
More informationSimultaneous multi-color, multiphoton fluorophore excitation using dual-color fiber lasers
Multiphoton Microscopy / Fiber Laser Simultaneous multi-color, multiphoton fluorophore excitation using dual-color fiber lasers Matthias Handloser, Tim Paasch-Colberg, Bernhard Wolfring TOPTICA Photonics
More information64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
More informationProtein Stability Analysis Using the Optim Patrick Celie NKI Protein Facility, Amsterdam
Protein Stability Analysis Using the Optim 1000 Patrick Celie NKI Protein Facility, Amsterdam NKI Protein Facility Fundamental and translation cancer research ~ 650 scientists + supporting personnel Connected
More informationHis- Tag Protein ELISA Kit
Revised Protocol Product Manual His- Tag Protein ELISA Kit Catalog Numbers AKR- 130 96 wells FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction A polyhistidine-tag, or His-tag, is
More informationMake Your Immunology Research Easy. Kun YIN Associate Director of Marketing Division, GenScript
Make Your Immunology Research Easy Kun YIN Associate Director of Marketing Division, GenScript GenScript Overview Branch Office Amsterdam, Netherlands Branch Office Tokyo, Japan Headquarter, New Jersey,
More informationTitration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells
Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Ruud Hulspas 1 UNIT 6.29 1 Cytonome/ST, Boston, Massachusetts ABSTRACT Nonspecific antibody binding is best
More informationhfab Rhodamine Housekeeping Antibodies
hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine
More informationImmunofluorescence Staining Protocol for 3 Well Chamber, removable
Immunofluorescence Staining Protocol for 3 Well Chamber, removable This Application Note presents a simple protocol for the cultivation, fixation, and staining of cells using the 3 Well Chamber, removable.
More informationExiProgen Protein Synthesis RNA/DNA Prep System
Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! - Automated Protein Synthesis/Purification System Bioneer's is the world's
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More informationRayBio Human bfgf ELISA Kit
RayBio Human bfgf ELISA Kit User Manual (for Cell Lysate and Tissue Lysate) (Revised Mar 1, 2012) RayBio Human bfgf ELISA Kit Protocol (Cat#: ELH-bFGF-001C) RayBiotech, Inc. We Provide You With Excellent
More informationab Hypoxic Response Human Flow Cytometry Kit
ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationSupplemental Movie Legend.
Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,
More informationSmall-Molecule Drug Target Identification/Deconvolution Technologies
Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationMATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (minigel. Reagents Provided in Kit
Lot # XXXXX ITCH/AIP4 Ubiquitin Ligase Kit Cat. # K-270 MATERIAL DATA SHEET The mammalian Itchy homolog, or ITCH, (also known as Atrophin-1-interacting protein 4 or AIP4) is a HECT domain class ubiquitin
More informationNori TM Canine TGFβ2 ELISA Kit DataSheet
TGF-β2 (Transforming growth factor-beta 2) is a secreted protein known as a cytokine that performs many cellular functions and has a vital role during embryonic development (alternative names: Glioblastoma-derived
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-06 PROTEIN PURIFICATION AND PEPTIDE ISOLATION USING CHROMATOGRAPHY TRANSCRIPT Welcome to the proteomics course. Today, we will talk about protein purification and peptide isolation using chromatography
More informationsirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
More informationSPHERO TM Coated Particles
SPHERO TM Coated Particles Manufactured by either passive adsorption or covalent coupling depending upon the intended application Stable for several years under proper storage condition Available in a
More informationMechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force. Supporting Information
Mechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force Benjamin M. Gaub and Daniel J. Müller Supporting Information Supporting Information Note
More informationEdU Flow Cytometry Kit. User Manual
User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg
More informationTransferrin Conjugates
Transferrin Conjugates Table 1 Contents and storage Material Formulation Storage Stability Transferrin conjugates* lyophilized powder containing transferrin conjugate, lyophilized in phosphate-buffered
More informationRat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
More informationSupplemental Data. Aung et al. (2011). Plant Cell /tpc
35S pro:pmd1-yfp 10 µm Supplemental Figure 1. -terminal YFP fusion of PMD1 (PMD1-YFP, in green) is localized to the cytosol. grobacterium cells harboring 35S pro :PMD1-YFP were infiltrated into tobacco
More informationChicken EpithelialGut CellLines 1
Chicken EpithelialGut CellLines 1 Content 01 Introduction p 3 02 Characterization p 5 03 Infection and inhibition p 6 04 Protein expression system p 8 05 NutriProof p 10 06 Contact p 12 01...which came
More informationCase Studies ZoBio
Case Studies 2011 ZoBio ZoBio Corporate Overview Founded as Dutch BV 11/2004 Full access to all lab facilities of UL Self funded (grants and commercial activities) Doubled income 5 consecutive years 9
More informationStrep-Tactin XT Spin Column
Strep-Tactin XT Spin Column Purification Protocol Last date of revision Last June date 2017 of revision June 2017 Version PR90-0001 Version PR90-0001 For research use only Important licensing information
More informationTechnical tips Session 5
Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationThe Procedure for Optimized ELISA Protocol
Contact Us: www.pall.com/contact The Procedure for Optimized ELISA Protocol The Procedure for Optimized ELISA Protocol Background Methods Results Discussion Conclusions Summary Background The membrane
More informationRotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein
Rotation Report Sample Version 2 Due Date: August 9, 1998 Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein Anita H. Corbett Advisor: Amy Jones Rotation 1 Abstract:
More informationFigure 1. Schematic of Ats1p expression plasmid.
Abstract: Anita Corbett page 2 The goal of my rotation project was to express, purify, and examine the exchange activity of a putative guanine nucleotide exchange factor, Ats1p. The S. cerevisiae ATS1
More information!! PLEASE READ BEFORE USE!!
In situ Proximity Ligation Assay protocols!! PLEASE READ BEFORE USE!! The test protocol is a guideline, user need to determine their optimal experimental condition for best performance. The following protocol
More informationSupplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means
More informationPost-expansion antibody delivery, after epitope-preserving homogenization.
Supplementary Figure 1 Post-expansion antibody delivery, after epitope-preserving homogenization. (a, b) Wide-field fluorescence images of Thy1-YFP-expressing mouse brain hemisphere slice before expansion
More informationPHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
More informationHay fever cure.coli KAIT-JAPAN
Hay fever cure.coli KAIT-JAAN Background One of six person are developed hay fever. In JAAN Hay fever measures Take a medicine (anti-allergic drug and antihistamine drug) But There is a difference in the
More information