Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology. Chad Zimprich January 2015

Size: px
Start display at page:

Download "Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology. Chad Zimprich January 2015"

Transcription

1 Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology Chad Zimprich January 2015

2 Presentation verview HaloTag Fusion Technology Design Functionality Ligands Imaging Focus on HaloTag for: Cellular localization studies Protein trafficking o Real-time o Spatial/Temporal o Multiplexing o High content screening 2

3 What is HaloTag Technology? A Unique, Multifunctional Protein Fusion Tag HaloTag : Engineered 34.1kDa halophilic bacterial hydrolase Binds to chloralkane substrate and locks with covalent attachment Faster kinetics than the biotin:streptavidin interaction No homolog in mammalian cells = no background Read more about the development of this powerful fusion tag: hana, R.F., et al. (2009) Prot. Exp. Purif. 68, Protein of Interest HaloTag + N- or C- terminal fusions Protein of Interest Cl Chloroalkane Linker Binding and Functional Group Functional Group Covalent bond between HaloTag and chloroalkane (+ functional group) 3

4 HaloTag Fusion Protein Technology A Powerful, Multifunctional Fusion Protein Tag Protein of Interest Functional Group Cl HaloTag Surfaces/Resins Capture and Display Protein arrays Purification Interactions Magnetic, non-magnetic resins, glass slides Cl Cl HaloTag Fluorescent Ligands Labeling and Detection Cellular imaging Many colors of cell Gel analysis permeable & impermeable ligands Quantitation Animal Imaging Cl HaloTag Reactive Ligands Custom Modifications Attach to particles, surfaces Attach special ligands e.g. Quantum Dots, PET ligands 4

5 HaloTag Fusion Protein Technology Many Applications with a Single Fusion Protein Protein:Protein Interactions Ga s AC Protein Localization & Trafficking Protein:Nucleic Acid Interactions Protein of Interest Purify Structural Studies Enzymatic Assays Kinetic Studies 5

6 Multiple Cell Permeable & Impermeable Fluorescent HaloTag Ligands Available Y Y Y Y Y Y Y Y Y Membrane impermeable ligands label fusion protein where HaloTag is outside the cells Cell permeable ligands label all HaloTag proteins throughout cells Sequential labeling with impermeable then permeable ligands enables differential labeling 6

7 Simple Intracellular Labeling and Imaging with HaloTag Technology Transfect HT-RF expression vector Add fluorescent ligand Image live or fixed cells Wash out unbound ligand GST Alternate labeling protocol with no-washing Fluorescent Ligand covalently attached to HaloTag Fusion protein No cytotoxicity Minimal background fluorescence Multiple colors available Cell permeable (complete cell staining) Cell impermeable (cell surface staining) Rapid and easy protocols 7

8 HaloTag Intracellular Protein Localization and Detection Throughout the Cell 8

9 HaloTag Protein Trafficking Real-time Imaging Signal (TNFa, LPS, UV ) NFkB Signaling Pathway p50 p65 IkB P p50 p65 P IkB P P p50 p65 P IkB P P p50 p65 p50 p65 Cell membrane Cytoplasm Nucleus 0 min 5 min 10 min 20 min HeLa cells expressing p65- HaloTag labeled with TMR Ligand Treated with TNFa Imaged (5min/frame; 120min) 40 min 60 min 80 min 100 min GV Los, et al. HaloTag: a novel protein labeling technology for cell imaging and protein analysis. ACS Chem Biol, Jun 2008; 3(6):

10 HaloTag Protein Trafficking Spatial and Temporal Analysis Label w/ impermeable GREEN Label w/ permeable RED Wash Image Incubate 12 hrs Image 1. Label with cell impermeable ligand 2. Label with cell permeable ligand 12hrs 12 hours Svendsen, S., et al. BMC Cell Biol, 9: 17,

11 Trafficking and Assembly of GABA A Receptor (LGIC superfamily) a g HaloTag - non-permeable - permeable No Effect on GABA A R Pharmacology γ2l-halotag co-expressed with α1 or b2 does not traffick to cell surface γ2l-halotag co-expressed with both α1 and β2 trafficks to cell surface In collaboration with Srinivasan Venkatachalan and Cynthia Czajkowski, UW-Madison 11

12 Monitoring GPCR Internalization: HaloTag -EDG1 The Biology of GPCRs HEK 293 cells expressing phalotag -EDG1 labeled with Alexa488 (surface) and TMR (internal) Ligands Treated with S1P Imaged (2min/frame; 30min) 12

13 Surface Receptor Internalization Assay with HaloTag ph Sensor ph Sensor Imaging Based Fluorescence Assay HaloTag ph Sensor: Dark at physiological ph HaloTag ph Sensor: Gain of signal assay Live Cell Kinetic HaloTag Dual Functionality: Receptor internalization and recycling ph Titration and Fluorescence Recovery U20S HT-EDG1 Labeled with HT-pH sensor Stimulated with S1P Images acquired 13

14 Creation of a HaloTag Ligand for High Resolution (STED) Microscopy Confirmed ligand specificity for HaloTag in cells by confocal: β1 integrin (truncation)-halotag in HeLa Cells Schroder, et al. In Vivo Labeling Method Using a Genetic Construct for Nanoscale Resolution Microscopy. Biophysical Journal 96, (1),

15 Multiplexing HaloTag Imaging with ther Methods hmgfp α-tubulin HaloTag NLS 3 -TMR ligand p65-halotag -TMR Ligand Anti- -tubulin/alexa nd Ab HaloTag imaging is compatible with: Fluorescent protein fusions Fixing and antibody staining Simultaneous labeling during fixation is also possible 15

16 High Content Screening Whole Cell-based Assays 18 h 0 h 3 h 6 h 9 h 12 h 15 h 18 h Extracellular labeling of ECS-HaloTag fusion protein with Alexa 488 HaloTag ligand Protein internalization - endosome formation punctate staining Image analysis and quantitation 16

17 HaloTag Imaging Summary Making Trafficking Studies Possible Simple, efficient labeling of HaloTag fusion proteins No cytotoxicity of HaloTag fluorescent ligands Technology enables both temporal and spatial trafficking studies Intracellular vs. cell surface differential labeling using cell permeable and impermeable labeling ligands Well-suited to high content screening due to pulse labeling Multiple label colors available Same fusion protein used for other applications: Protein:protein interactions Purification enzyme or structural studies Chromatin IP 17

18 Technical Services Scientists are Ready to Help By phone: Available 7am-6pm Central M-F nline Available 7am-6pm Central M-F Global Chat with Branch office tech serv scientists, too, after hours (language dependent) Guaranteed answers within 24hr Most responses within 2hrs 18

19 Thank You! 19

Cell Imaging. Localization: Robust protein labeling of live or fixed cells

Cell Imaging. Localization: Robust protein labeling of live or fixed cells F eat u r es & B e n efits ptions Cell Imaging with the alotag platform Localization: Robust protein labeling of live or fixed cells Trafficking & Turnover: Directly observe proteins with one or two colors

More information

Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics

Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Proteomics and studying dynamic interactions AP-MS Proteomics

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+

More information

Cytomics in Action: Cytokine Network Cytometry

Cytomics in Action: Cytokine Network Cytometry Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University

More information

HALOLINK RESIN FOR PROTEIN PULL-DOWN AND ANALYSIS

HALOLINK RESIN FOR PROTEIN PULL-DOWN AND ANALYSIS HALOLINK ESIN FO POTEIN PULL-DOWN AND ANALYSIS MAJETA UH, PH.D. 1, DAN SIMPSON, PH.D. 1, JACQUI SANKBEIL, M.S. 1, DANETTE HATZELL, PH.D. 1, NATASHA KAASSINA, M.S. 1, NADINE NASSIF, M.S. 1, JAMI ENGLISH,

More information

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

a) JOURNAL OF BIOLOGICAL CHEMISTRY b) PNAS c) NATURE

a) JOURNAL OF BIOLOGICAL CHEMISTRY b) PNAS c) NATURE a) JOURNAL OF BIOLOGICAL CHEMISTRY b) c) d) ........................ JOURNAL OF BIOLOGICAL CHEMISTRY MOLECULAR PHARMACOLOGY TRENDS IN PHARMACOLOGICAL S AMERICAN JOURNAL OF PHYSIOLOGY-HEART AND CIRCULATORY

More information

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen

More information

CBI Toolbox Tour 2015

CBI Toolbox Tour 2015 CBI Toolbox Tour 2015 Thermophoresis (NanoTemper) NT.115 & NT.LabelFree Images: NanoTemper Circular Dichroism Jasco J-1500 Spectrometer Six Position Turreted Peltier Temperature Control System Automated

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

Microarray Industry Products

Microarray Industry Products Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase

More information

Introduction to Protein Purification

Introduction to Protein Purification Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions

Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions www.iba-biotagnology.com Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions Strep-tag and One-STrEP-tag PPI Analysis with the co-precipitation/ mass spectrometry approach 3 Background

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

Flow Cytometry - The Essentials

Flow Cytometry - The Essentials Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.

More information

A Cost-effective Workflow for High-Throughput Screening of G- Protein Coupled Receptors (GPCRs)

A Cost-effective Workflow for High-Throughput Screening of G- Protein Coupled Receptors (GPCRs) A p p l i c a t i o n N o t e A Cost-effective Workflow for High-Throughput Screening of G- Protein Coupled Receptors (GPCRs) Monitoring Receptor Mediated Calcium Flux Paul Held and Peter Banks, BioTek

More information

Corning Microplates for Microscopy and High Content Imaging. Improve results with microplates for high resolution cell imaging

Corning Microplates for Microscopy and High Content Imaging. Improve results with microplates for high resolution cell imaging Corning Microplates for Microscopy and High Content Imaging Improve results with microplates for high resolution cell imaging High Performance for Cell-based Assays Within the drug discovery process, high

More information

One-step split GFP staining for sensitive protein detection and localization in mammalian cells

One-step split GFP staining for sensitive protein detection and localization in mammalian cells Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Product Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris

Product Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris Glowing Products for Science Mix-n-Stain Antibody Labeling Kits Size: 1 labeling per kit Storage: -20 o C Stability: Stable for at least 1 year from date of receipt when stored as recommended. Components:

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

special offers from your protein biology resource

special offers from your protein biology resource special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research

More information

Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.

Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog. 1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus

More information

ab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit

ab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit ab128967 - Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use only

More information

Immunofluorescence images of different core histones and different histone exchange assay.

Immunofluorescence images of different core histones and different histone exchange assay. Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,

More information

Profiling Ligands Of GPCR Targets Using An Optical Biosensor With Dynamic Mass Redistribution Technology

Profiling Ligands Of GPCR Targets Using An Optical Biosensor With Dynamic Mass Redistribution Technology Profiling Ligands Of GPCR Targets Using An Optical Biosensor With Dynamic Mass Redistribution Technology Paul Lee, Ph.D. Lead Discovery Amgen Inc. Thousand Oaks, CA 2008 Label-Free Summit, Corning NY October

More information

ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system!

ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! ExiProgen - Automated Protein Synthesis/Purification System ExiProgen

More information

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to

More information

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details

More information

Applications of HTRF and Tag-lite Assays for HTP Antibody Screening

Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Brigitte Devaux, PhD Bristol Myers Squibb, Redwood City CA HTRF Symposium April 25, 2013 1 Introduction Generate human therapeutic antibodies

More information

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent Nicola Bevan, Tim Dale, Del Trezise Essen BioScience Welwyn Garden City, Hertfordshire, UK Introduction Monoclonal antibodies are now widely used as anti-cancer, antiinflammatory and anti-viral therapeutic

More information

CytoPainter Golgi Staining Kit Green Fluorescence

CytoPainter Golgi Staining Kit Green Fluorescence ab139483 CytoPainter Golgi Staining Kit Green Fluorescence Instructions for Use Designed for the detection of Golgi bodies by microscopy This product is for research use only and is not intended for diagnostic

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

ab Ubiquitylation Assay Kit

ab Ubiquitylation Assay Kit ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.

More information

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects

More information

QuickTiter Adenovirus Titer ELISA Kit

QuickTiter Adenovirus Titer ELISA Kit Product Manual QuickTiter Adenovirus Titer ELISA Kit Catalog Number VPK-110 2 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Recombinant adenoviruses have tremendous

More information

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer xcelligence System Real-Time Cell Analyzer Focus Application Cell Migration Featured Study: Inhibition of Cell Migration by Gene Silencing Markus Greiner and Richard Zimmermann Department of Medical Biochemistry

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Optimization of 2D Gel Transblotting for Host Cell Protein Analysis

Optimization of 2D Gel Transblotting for Host Cell Protein Analysis Optimization of 2D Gel Transblotting for Host Cell Protein Analysis Jon Johansen, Matt Hoelter & Nancy Kendrick* Kendrick Labs Inc, Madison, WI www.kendricklabs.com Talk Outline Biologic drugs, recombinant

More information

Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward

Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward Landes Bioscience www.landesbioscience.com Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward The level of HER2 expression is a predictor of antibody- HER2 trafficking behavior

More information

ab Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit

ab Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit ab64264 - Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use

More information

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in

More information

ab SUMOylation Assay Kit

ab SUMOylation Assay Kit ab139470 SUMOylation Assay Kit Instructions for Use For the generation and detection of SUMOylated proteins in vitro. This product is for research use only and is not intended for diagnostic use. Version

More information

How to perform-control immunostaining experiment - microscopist subjective point of view. Pawel Pasierbek

How to perform-control immunostaining experiment - microscopist subjective point of view. Pawel Pasierbek How to perform-control immunostaining experiment - microscopist subjective point of view. Pawel Pasierbek Immunolabeling and fluorescent detection became such a standard procedure in the biomedical research

More information

Characterization of Aptamer Binding using SensíQ SPR Platforms

Characterization of Aptamer Binding using SensíQ SPR Platforms Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional

More information

Analysis of receptor oligomerization by FRAP microscopy

Analysis of receptor oligomerization by FRAP microscopy TIGP CBMB Student Seminar Analysis of receptor oligomerization by FRAP microscopy Dorsch S, Klotz KN, Engelhardt S, Lohse MJ, Bünemann M Nat Methods. 2009 Mar;6(3):225 30. K. Vijayasarathy March 10 th

More information

The mechanism(s) of protein folding. What is meant by mechanism. Experimental approaches

The mechanism(s) of protein folding. What is meant by mechanism. Experimental approaches The mechanism(s) of protein folding What is meant by mechanism Computational approaches Experimental approaches Questions: What events occur and in what time sequence when a protein folds Is there a specified

More information

-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay

-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay -PLEX Immunogenicity Assay Application Note 1 Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay The use of biotherapeutics, biosimilars, and combination biotherapies

More information

Kinase Activity: a total solution

Kinase Activity: a total solution Kinase Activity: a total solution Protein arrays for multiplex kinetic measurements Robust Instrumentation User friendly software Kinetic data at your fingertips! PamGene s novel platform for profiling

More information

SUMOstar Gene Fusion Technology

SUMOstar Gene Fusion Technology Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com

More information

Cell Health and Viability Assays Real-time automated measurements of cell health and viability inside your incubator

Cell Health and Viability Assays Real-time automated measurements of cell health and viability inside your incubator INCUCYTE LIVE-CELL ANALYSIS SYSTEM Cell Health and Viability Assays Real-time automated measurements of cell health and viability inside your incubator See what your cells are doing and when they do it

More information

The Making of the Fittest: Natural Selection and Adaptation

The Making of the Fittest: Natural Selection and Adaptation INTRODUCTION THE ROCK POCKET MOUSE THE BIOCHEMISTRY AND CELL SIGNALING PATHWAY OF MC1R The rock pocket mouse, Chaetodipus intermedius, is a small, nocturnal animal found in the deserts of the southwestern

More information

The Confo body technology, a new platform to enable fragment screening on GPCRs

The Confo body technology, a new platform to enable fragment screening on GPCRs The Confo body technology, a new platform to enable fragment screening on GPCRs Christel Menet, PhD CSO Miptec, 216 Confo Therapeutics Incorporated in June 215 Located in Brussels, Belgium Confo Therapeutics

More information

Simultaneous multi-color, multiphoton fluorophore excitation using dual-color fiber lasers

Simultaneous multi-color, multiphoton fluorophore excitation using dual-color fiber lasers Multiphoton Microscopy / Fiber Laser Simultaneous multi-color, multiphoton fluorophore excitation using dual-color fiber lasers Matthias Handloser, Tim Paasch-Colberg, Bernhard Wolfring TOPTICA Photonics

More information

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)

More information

Protein Stability Analysis Using the Optim Patrick Celie NKI Protein Facility, Amsterdam

Protein Stability Analysis Using the Optim Patrick Celie NKI Protein Facility, Amsterdam Protein Stability Analysis Using the Optim 1000 Patrick Celie NKI Protein Facility, Amsterdam NKI Protein Facility Fundamental and translation cancer research ~ 650 scientists + supporting personnel Connected

More information

His- Tag Protein ELISA Kit

His- Tag Protein ELISA Kit Revised Protocol Product Manual His- Tag Protein ELISA Kit Catalog Numbers AKR- 130 96 wells FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction A polyhistidine-tag, or His-tag, is

More information

Make Your Immunology Research Easy. Kun YIN Associate Director of Marketing Division, GenScript

Make Your Immunology Research Easy. Kun YIN Associate Director of Marketing Division, GenScript Make Your Immunology Research Easy Kun YIN Associate Director of Marketing Division, GenScript GenScript Overview Branch Office Amsterdam, Netherlands Branch Office Tokyo, Japan Headquarter, New Jersey,

More information

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Ruud Hulspas 1 UNIT 6.29 1 Cytonome/ST, Boston, Massachusetts ABSTRACT Nonspecific antibody binding is best

More information

hfab Rhodamine Housekeeping Antibodies

hfab Rhodamine Housekeeping Antibodies hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine

More information

Immunofluorescence Staining Protocol for 3 Well Chamber, removable

Immunofluorescence Staining Protocol for 3 Well Chamber, removable Immunofluorescence Staining Protocol for 3 Well Chamber, removable This Application Note presents a simple protocol for the cultivation, fixation, and staining of cells using the 3 Well Chamber, removable.

More information

ExiProgen Protein Synthesis RNA/DNA Prep System

ExiProgen Protein Synthesis RNA/DNA Prep System Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system! - Automated Protein Synthesis/Purification System Bioneer's is the world's

More information

IMMUNOPRECIPITATION (IP)

IMMUNOPRECIPITATION (IP) 1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us

More information

RayBio Human bfgf ELISA Kit

RayBio Human bfgf ELISA Kit RayBio Human bfgf ELISA Kit User Manual (for Cell Lysate and Tissue Lysate) (Revised Mar 1, 2012) RayBio Human bfgf ELISA Kit Protocol (Cat#: ELH-bFGF-001C) RayBiotech, Inc. We Provide You With Excellent

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

Supplemental Movie Legend.

Supplemental Movie Legend. Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,

More information

Small-Molecule Drug Target Identification/Deconvolution Technologies

Small-Molecule Drug Target Identification/Deconvolution Technologies Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

MATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (minigel. Reagents Provided in Kit

MATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (minigel. Reagents Provided in Kit Lot # XXXXX ITCH/AIP4 Ubiquitin Ligase Kit Cat. # K-270 MATERIAL DATA SHEET The mammalian Itchy homolog, or ITCH, (also known as Atrophin-1-interacting protein 4 or AIP4) is a HECT domain class ubiquitin

More information

Nori TM Canine TGFβ2 ELISA Kit DataSheet

Nori TM Canine TGFβ2 ELISA Kit DataSheet TGF-β2 (Transforming growth factor-beta 2) is a secreted protein known as a cytokine that performs many cellular functions and has a vital role during embryonic development (alternative names: Glioblastoma-derived

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA LECTURE-06 PROTEIN PURIFICATION AND PEPTIDE ISOLATION USING CHROMATOGRAPHY TRANSCRIPT Welcome to the proteomics course. Today, we will talk about protein purification and peptide isolation using chromatography

More information

sirna Overview and Technical Tips

sirna Overview and Technical Tips 1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION

More information

SPHERO TM Coated Particles

SPHERO TM Coated Particles SPHERO TM Coated Particles Manufactured by either passive adsorption or covalent coupling depending upon the intended application Stable for several years under proper storage condition Available in a

More information

Mechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force. Supporting Information

Mechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force. Supporting Information Mechanical stimulation of Piezo1 receptors depends on extracellular matrix proteins and directionality of force Benjamin M. Gaub and Daniel J. Müller Supporting Information Supporting Information Note

More information

EdU Flow Cytometry Kit. User Manual

EdU Flow Cytometry Kit. User Manual User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg

More information

Transferrin Conjugates

Transferrin Conjugates Transferrin Conjugates Table 1 Contents and storage Material Formulation Storage Stability Transferrin conjugates* lyophilized powder containing transferrin conjugate, lyophilized in phosphate-buffered

More information

Rat IGF-1 ELISA Kit (rigf-1-elisa)

Rat IGF-1 ELISA Kit (rigf-1-elisa) Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar

More information

Supplemental Data. Aung et al. (2011). Plant Cell /tpc

Supplemental Data. Aung et al. (2011). Plant Cell /tpc 35S pro:pmd1-yfp 10 µm Supplemental Figure 1. -terminal YFP fusion of PMD1 (PMD1-YFP, in green) is localized to the cytosol. grobacterium cells harboring 35S pro :PMD1-YFP were infiltrated into tobacco

More information

Chicken EpithelialGut CellLines 1

Chicken EpithelialGut CellLines 1 Chicken EpithelialGut CellLines 1 Content 01 Introduction p 3 02 Characterization p 5 03 Infection and inhibition p 6 04 Protein expression system p 8 05 NutriProof p 10 06 Contact p 12 01...which came

More information

Case Studies ZoBio

Case Studies ZoBio Case Studies 2011 ZoBio ZoBio Corporate Overview Founded as Dutch BV 11/2004 Full access to all lab facilities of UL Self funded (grants and commercial activities) Doubled income 5 consecutive years 9

More information

Strep-Tactin XT Spin Column

Strep-Tactin XT Spin Column Strep-Tactin XT Spin Column Purification Protocol Last date of revision Last June date 2017 of revision June 2017 Version PR90-0001 Version PR90-0001 For research use only Important licensing information

More information

Technical tips Session 5

Technical tips Session 5 Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation

More information

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna

More information

The Procedure for Optimized ELISA Protocol

The Procedure for Optimized ELISA Protocol Contact Us: www.pall.com/contact The Procedure for Optimized ELISA Protocol The Procedure for Optimized ELISA Protocol Background Methods Results Discussion Conclusions Summary Background The membrane

More information

Rotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein

Rotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein Rotation Report Sample Version 2 Due Date: August 9, 1998 Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein Anita H. Corbett Advisor: Amy Jones Rotation 1 Abstract:

More information

Figure 1. Schematic of Ats1p expression plasmid.

Figure 1. Schematic of Ats1p expression plasmid. Abstract: Anita Corbett page 2 The goal of my rotation project was to express, purify, and examine the exchange activity of a putative guanine nucleotide exchange factor, Ats1p. The S. cerevisiae ATS1

More information

!! PLEASE READ BEFORE USE!!

!! PLEASE READ BEFORE USE!! In situ Proximity Ligation Assay protocols!! PLEASE READ BEFORE USE!! The test protocol is a guideline, user need to determine their optimal experimental condition for best performance. The following protocol

More information

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means

More information

Post-expansion antibody delivery, after epitope-preserving homogenization.

Post-expansion antibody delivery, after epitope-preserving homogenization. Supplementary Figure 1 Post-expansion antibody delivery, after epitope-preserving homogenization. (a, b) Wide-field fluorescence images of Thy1-YFP-expressing mouse brain hemisphere slice before expansion

More information

PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF

PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract

More information

Hay fever cure.coli KAIT-JAPAN

Hay fever cure.coli KAIT-JAPAN Hay fever cure.coli KAIT-JAAN Background One of six person are developed hay fever. In JAAN Hay fever measures Take a medicine (anti-allergic drug and antihistamine drug) But There is a difference in the

More information