Wnt16 smact merge VK/AB

Size: px
Start display at page:

Download "Wnt16 smact merge VK/AB"

Transcription

1 A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day old (A) or 4.5 week old () wild-type (WT) or MGPdeficient (KO) mice [nuclei counterstained with DAPI (blue)]. In A, adjacent sections were incubated with control IgG. And in, adjacent sections were stained for deposition of calcified (black) and glycosaminoglycan-rich (blue) matrices by von Kossa (VK) and Alcian blue (A) stains, respectively. Scale bar in A = mm. Scale bar in = 5 mm.

2 b-catenin luciferase activity (fold) A pwnt6: - + Wnt6 GAPDH Medium Cell lysate pwnt6-medium: - + SUPPLEMENTAL FIGURE II: Active Wnt6 is secreted by transfected Cos7 cells. A, Western blot for Wnt6 protein in equal volumes of conditioned medium collected from mock-transfected Cos7 cells or Cos7 cells transfected with Wnt6 plasmid (pwnt6). Roughly equal numbers of cells were used in this experiment as evident from Western blot for GAPDH in total cell lysates., Activity of the TCF/LEF-responsive luciferase reporter dependent on canonical b-catenin signaling in cells treated with mock- or pwnt6-conditioned medium (N=3)., p<.5.

3 Smad-dependent luciferase activity MP: + + Noggin: + - LDN9389: SUPPLEMENTAL FIGURE III: Efficiency of MP inhibitors. Noggin ( ng/ml) or LDN9389 (5 nmol/l) effects on MP- induced activity of Smad-dependent luciferase reporter in A cells treated with recombinant MP (5 ng/ml) for 48 hours (N=4)., p<.

4 SUPPLEMENTAL FIGURE IV: Adapted representation of Ingenuity Pathway Analysis (IPA). RNA deep sequencing data revealing the interactions between 33 (gray symbols) out of 6 signature transcripts and molecules of the Mechanistic IPA network. The presence of known direct and indirect relationships between signature genes and members of the network are indicated with solid and dashed lines, respectively. For clarity, relationships between non-signature molecules were omitted.

5 A psmad smactin psmad/smact/dapi phase WT KO psmad/5/dapi WT-d3 KO-d3 vertebra limb/bone SUPPLEMENTAL FIGURE V: Smad activation in MGP-null aortic tissue. A, Immunostaining for phosphorylated Smads (psmad) implicates activation of TGFb signaling in aortae from 4.5 week old (d3) MGP-null (KO) but not in wild-type (WT) mice [nuclei counterstained with DAPI (blue)]. Phase images of tissue morphology (right panels) show cartilaginous metaplasia in KO aorta in contrast to typical aortic morphology in WT tissue with characteristic elastic lamina. Scale bar = mm, Lack of immunostaining for phosphorylated Smads and 5 (psmad/5) suggests no activity of the MP signaling in aortae from 4.5 week old (d3) wild-type (WT) and MGP-null (KO) mice [nuclei counterstained with DAPI (blue)]. Cartilaginous metaplasia is outlined with white dashed oval. Control sections of neonatal mice showed positive stain for psmad/5 in both developing vertebrae and limb bones. Scale bar = mm in aortae. Scale bar = 5 mm in neonatal tissues.

6 8 6 4 GAG deposition (fold) DMEM DMEM-S TGFb: TGFb: TGFb3: SUPPLEMENTAL FIGURE VI: TGFb-induced chondrogenic transformation in WT VSMCs. Equal pro-chondrogenic activities of the TGFb isoforms ( ng/ml) on A micromasses cultured for 8 days is shown by similar levels of glycosaminoglycan (GAG) synthesis detected with Alcian blue stain. Graph shows quantitation of extracted Alcian blue dye normalized to crystal violet stain for cell density (N=4)., p<..

7 Wnt6 mrna (fold) Wnt6 protein (fold) A TGFb: - + Wnt6 GAPDH TGFb: - + TGFb: Wnt6: SUPPLEMENTAL FIGURE VII: TGFb-induced repression of Wnt6 in VSMCs and effects on chondrogenesis. A, Expression of Wnt6 is reduced by TGFb3 ( ng/ml, 7 hours) in rat A VSMCs. Real-time PCR analysis for expression of Wnt6 mrna (left) and Western blot for protein levels (right) (N=3)., p<.., Representative images of A VSMCs micromasses treated with TGFb3 and Wnt6 and stained with Alcian blue dye to detect GAG.

8 osteogenic gene expression (fold) relative cell number (% of untreated) LDH release in medium (AU) SMC markers (fold) SMC markers (fold) A Cnn MHC sma smact Wnt6 shscr: + - shwnt6: C D SP OPN TGFb: + + Wnt6: TGFb: + Wnt6: - + SUPPLEMENTAL FIGURE VIII: Effects of Wnt6 on gene expression in wild type VSMC. A-, Wnt6 supports expression of smooth muscle contractile markers. Down-regulation of Wnt6 by sirna results in down-regulation of contractile markers (A). In contrast, exogenous Wnt6 induces contractile markers expression inhibited by TGFb ().Gene expression analyzed by real-time PCR and compared to expression in non-transformed VSMC after normalization to ribosomal protein L9 expression (N=3). C, Expression of osteogenic genes in 8 days old rat A VSMCs micromasses in the presence or absence of exogenous Wnt6 (N=4). D-E, Exogenous Wnt6 did not affect either total cell number (detected by DNA staining with Crystal violet (D) or cytotoxicity in 4 day old chondrogenic micromasses (detected by release of lactate dehydrogenase into the medium) (E) compared to micromasses cultured in plain DMEM (N=4). NS not significant NS calponin MHC sma smact E TGFb: Wnt6: NS TGFb: + Wnt6: - - +

9 Notch gene expression (fold) Notch gene expression (fold) A Dll Notch Jag Hey Hes DAPT: Notch Dll Jag Jag.5 TGFb: SUPPLEMENTAL FIGURE IX. TGFb3 inhibits Notch signaling in wild type VSMC. Real-time PCR analysis of the expression of Notch genes in A VSMCs treated with either Notch inhibitor DAPT (A, N=3) or exogenous TGFb ( ng/ml) (, N=3)., p<.5;, p<.;, p<..

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the

More information

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

Please read manual carefully before starting experiment

Please read manual carefully before starting experiment RayBio Cell-Based Phosphorylation ELISA Kit - Preliminary For the semi-quantitative detection of both phosphorylated and pan human, mouse or rat proteins in adherent whole cell lines. User Manual (Revised

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

Supplemental Material for

Supplemental Material for Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,

More information

INVESTIGATION OF MSC DIFFERENTIATION ON ELECTROSPUN NANOFIBROUS SCAFFOLDS

INVESTIGATION OF MSC DIFFERENTIATION ON ELECTROSPUN NANOFIBROUS SCAFFOLDS With support of NSF Award no. EEC-0754741 INVESTIGATION OF MSC DIFFERENTIATION ON ELECTROSPUN NANOFIBROUS SCAFFOLDS NSF Summer Undergraduate Fellowship in Sensor Technologies Emily Wible (Bioengineering)

More information

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,

More information

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into

More information

Center Drive, University of Michigan Health System, Ann Arbor, MI

Center Drive, University of Michigan Health System, Ann Arbor, MI Leukotriene B 4 -induced reduction of SOCS1 is required for murine macrophage MyD88 expression and NFκB activation Carlos H. Serezani 1,3, Casey Lewis 1, Sonia Jancar 2 and Marc Peters-Golden 1,3 1 Division

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/157/ra4/dc1 Supplementary Materials for Genome-Wide RNAi Screen Reveals Disease-Associated Genes That Are Common to Hedgehog and Wnt Signaling Leni S. Jacob,

More information

Supplemental figure 1. Dys-regulated signal pathways in MSCs from TNF-Tg. mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics

Supplemental figure 1. Dys-regulated signal pathways in MSCs from TNF-Tg. mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics Supplemental figure 1. Dys-regulated signal pathways in MSCs from TN-Tg mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics esources software. The top 53 and top 11 dys-regulated

More information

Sex affects BMPR-II signalling in pulmonary artery smooth muscle

Sex affects BMPR-II signalling in pulmonary artery smooth muscle Sex affects BMPR-II signalling in pulmonary artery smooth muscle cells. Kirsty M Mair, Xu Dong Yang, Lu Long, Kevin White, Emma Wallace, Marie-Ann Ewart, Craig K Docherty, Nicholas W Morrell, and Margaret

More information

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),

More information

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit Catalog #: PEL-Stat3-Y705 User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

ENCODE RBP Antibody Characterization Guidelines

ENCODE RBP Antibody Characterization Guidelines ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

Alternative Cleavage and Polyadenylation of RNA

Alternative Cleavage and Polyadenylation of RNA Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related

More information

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit Catalog #: PEL-Stat3-Y705-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information enclosed ISO

More information

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:

More information

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2 Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,

More information

Supplementary Figure Legend

Supplementary Figure Legend Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3575 In the format provided by the authors and unedited. Supplementary Figure 1 Validation of key reagents and assays a, top, IHC with antibody recognizing specifically

More information

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

Supplementary Figures Montero et al._supplementary Figure 1

Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 1 Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 2 Supplementary Figure 1. Transcripts arising from the structurally conserved subtelomeres

More information

Supplementary Figure and Table Legends

Supplementary Figure and Table Legends 1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for

More information

Supporting Information

Supporting Information Supporting Information Signal mingle: Micropatterns of BMP-2 and fibronectin on soft biopolymeric films regulate myoblast shape and SMAD signaling. Vincent Fitzpatrick, Laure Fourel, Olivier Destaing,

More information

RayBio Phospho- Akt (Ser473) ELISA Kit

RayBio Phospho- Akt (Ser473) ELISA Kit RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)

More information

Click here to read the case study about protein synthesis.

Click here to read the case study about protein synthesis. Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

mir-24-mediated down-regulation of H2AX suppresses DNA repair

mir-24-mediated down-regulation of H2AX suppresses DNA repair Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn

More information

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

Application Note sirna dependent gene silencing in HeLa cells cultivated on various cell culture surfaces

Application Note sirna dependent gene silencing in HeLa cells cultivated on various cell culture surfaces Application Note sirna dependent gene silencing in HeLa cells cultivated on various cell culture surfaces 1 Introduction 1.1 RNA interference (RNAi) One of the most important advances in biology in the

More information

Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts

Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts Cell Stem Cell Supplemental Information Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts Jurian Schuijers, Jan Philipp Junker, Michal Mokry, Pantelis Hatzis, Bon-Kyoung

More information

Impact of source tissue and ex vivo expansion on the characterization of goat mesenchymal stem cells

Impact of source tissue and ex vivo expansion on the characterization of goat mesenchymal stem cells JOURNAL OF ANIMAL SCIENCE AND BIOTECHNOLOGY Impact of source tissue and ex vivo expansion on the characterization of goat mesenchymal stem cells Mohamad-Fauzi et al. Mohamad-Fauzi et al. Journal of Animal

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

Generation of ips-derived model cells for analyses of hair shaft differentiation

Generation of ips-derived model cells for analyses of hair shaft differentiation Supplementary Material Generation of ips-derived model cells for analyses of hair shaft differentiation Takumi Kido, Tomoatsu Horigome, Minori Uda, Naoki Adachi, Yohei Hirai Department of Biomedical Chemistry,

More information

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177

More information

GUGAUAAUGGAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGCUUGCGAGGUAUGA GAAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA

GUGAUAAUGGAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGCUUGCGAGGUAUGA GAAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA Precursor mmu-mir-8- GUGAUAAUGGAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGCUUGCGAGGUAUGA GAAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA Precursor mmu-mir-8- GACCAGUUGCCGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAA

More information

Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms

Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,

More information

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics

More information

Chicken EpithelialGut CellLines 1

Chicken EpithelialGut CellLines 1 Chicken EpithelialGut CellLines 1 Content 01 Introduction p 3 02 Characterization p 5 03 Infection and inhibition p 6 04 Protein expression system p 8 05 NutriProof p 10 06 Contact p 12 01...which came

More information

TransIT-TKO Transfection Reagent

TransIT-TKO Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery

More information

CD34 Cells at the Apex of the Human Hematopoietic Stem Cell Hierarchy Have Distinctive Cellular and Molecular Signatures

CD34 Cells at the Apex of the Human Hematopoietic Stem Cell Hierarchy Have Distinctive Cellular and Molecular Signatures Article CD34 Cells at the Apex of the Human Hematopoietic Stem Cell Hierarchy Have Distinctive Cellular and Molecular Signatures Fernando Anjos-Afonso, 1, * Erin Currie, 1 Hector G. Palmer, 2 Katie E.

More information

Read and take notes on pages

Read and take notes on pages Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have

More information

Defective Myofibroblast Formation from Mesenchymal Stem Cells in the Aging Murine Heart

Defective Myofibroblast Formation from Mesenchymal Stem Cells in the Aging Murine Heart The American Journal of Pathology, Vol. 179, No. 4, October 2011 Copyright 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved. DOI: 10.1016/j.ajpath.2011.06.022

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1 Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

More information

SUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit

SUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit SUPPLEMENTARY INFORMATION Transcriptional output transiently spikes upon mitotic exit Viola Vaňková Hausnerová 1, 2, Christian Lanctôt 1* 1 BIOCEV and Department of Cell Biology, Faculty of Science, Charles

More information

Bronchial epithelium and its associated tissues act as a

Bronchial epithelium and its associated tissues act as a The Journal of Immunology A JNK-Independent Signaling Pathway Regulates TNF -Stimulated, c-jun-driven FRA-1 Protooncogene Transcription in Pulmonary Epithelial Cells 1 Pavan Adiseshaiah,* Dhananjaya V.

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description

More information

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer xcelligence System Real-Time Cell Analyzer Focus Application Cell Migration Featured Study: Inhibition of Cell Migration by Gene Silencing Markus Greiner and Richard Zimmermann Department of Medical Biochemistry

More information

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li,

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information

cdna by PCR with primers BglII-PacI-MAML (5 -GGCCAGATCTTTAATTAAGCCGCCAC CATGGCGCTGCCGCGGCACA-3 ) and XhoI-PmeI-GFP (5 - GGCCCTCGAGGTTTAAACT

cdna by PCR with primers BglII-PacI-MAML (5 -GGCCAGATCTTTAATTAAGCCGCCAC CATGGCGCTGCCGCGGCACA-3 ) and XhoI-PmeI-GFP (5 - GGCCCTCGAGGTTTAAACT Supplementary Materials and Methods Generation of ptof-dnmaml1 Platinum Pfx DNA polymerase (Invitrogen) was used to amplify GFP-DNMAML1 cdna by PCR with primers BglII-PacI-MAML (5 -GGCCAGATCTTTAATTAAGCCGCCAC

More information

IPA Advanced Training Course

IPA Advanced Training Course IPA Advanced Training Course Academia Sinica 2015 Oct Gene( 陳冠文 ) Supervisor and IPA certified analyst 1 Review for Introductory Training course Searching Building a Pathway Editing a Pathway for Publication

More information

JANUARY 20, 2006 VOLUME 281 NUMBER 3 JOURNAL OF BIOLOGICAL CHEMISTRY 1765

JANUARY 20, 2006 VOLUME 281 NUMBER 3 JOURNAL OF BIOLOGICAL CHEMISTRY 1765 THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 3, pp. 1765 1770, January 20, 2006 Printed in the U.S.A. RhoA Modulates Smad Signaling during Transforming Growth Factor- -induced Smooth Muscle Differentiation

More information

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Topical sirna for management of androgenic alopecia and oily skin Quark Pharmaceuticals, Inc.

Topical sirna for management of androgenic alopecia and oily skin Quark Pharmaceuticals, Inc. Topical sirna for management of androgenic alopecia and oily skin 1 2017 Quark Pharmaceuticals, Inc. About Quark Founded in 1993; privately held Late stage pharmaceutical company with 2 Phase 3 programs,

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting. Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice

More information

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting S317 Biological science: from genes to species Notes to accompany the slidecast on theory of SDS PAGE and Western blotting SDS PAGE SDS PAGE is a standard technique for determining the molecular size of

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means

More information

TransIT -mrna Transfection Kit

TransIT -mrna Transfection Kit INTRODUCTION TransIT -mrna Transfection Kit is designed to transfect RNA into a broad range of cell types with minimal cellular toxicity. RNA delivery avoids transcriptional regulation effects by directly

More information

SUPPLEMENTAL MATERIALS

SUPPLEMENTAL MATERIALS SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,

More information

OPPF-UK Standard Protocols: Mammalian Expression

OPPF-UK Standard Protocols: Mammalian Expression OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA

More information

Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo

Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453

More information