Self-assembly of oligonucleotides

Size: px
Start display at page:

Download "Self-assembly of oligonucleotides"

Transcription

1 Self-assembly of oligonucleotides Dr. K. Uma Maheswari Professor, School of Chemical & Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9

2 Table of Contents 1 APPLICATIONS OF SELF-ASSEMBLED DNA NANOSTRUCTURES MOLECULAR BEACON CANCER THERAPY SENSORS DNA NANOMECHANICAL DEVICES MOLECULAR SWITCHES INFORMATION STORAGE MOLECULAR ELECTRONICS PLASMONICS CONCLUSION REFERENCE ADDITIONAL READING...9 Joint Initiative of IITs and IISc Funded by MHRD Page 2 of 9

3 In the previous lectures, we had seen some of the devices that could be constructed using oligonucleotides. In this lecture, we will attempt to explore the possible applications of these structures in different fields. Many of the applications are yet to be translated into commercial products due to a host of challenges. However, none of these challenges are related to the function of these structures. 1 Applications of self-assembled DNA nanostructures 1.1 Molecular beacon A beacon literally means a device that helps to indicate the location of an object. Example: a lighthouse, tail lights in a car etc. Similarly, molecular beacons are made up of oligonucleotides that have been used to indicate the presence of a particular nucleic acid sequence in a sample. Just as conventional beacons indicate the location by glowing, these molecular beacons are also designed to indicate the presence of a specific nucleic acid sequence by emission of electromagnetic radiation in the visible range. So what is the principle of these molecular beacons? The spontaneous process of hybridization between two oligonucleotide sequences based on the complementary base pairing is the underlying principle of this molecular beacon. The molecular beacon consists of a single stranded DNA known as a probe strand, which folds in to a hairpin loop because of some complementary base pairing between the two ends of the strand. This is known as self-complementary pairing. One end of the strand is modified to covalently attach a fluorescent molecule while the other end is linked to a quencher (like gold nanoparticle). When the probe strand is in this conformation, the emission from the fluorescent probe is quenched by the quencher because of their close proximity. The sequence of the probe strand in the molecular beacon is chosen such that it is exactly complementary to the nucleic acid sequence it is to detect. The strand can be modified at the terminals with short sequences to ensure formation of the hairpin loop structure spontaneously. Now, let us add the sample. If the sample contains the nucleic acid sequence of interest, it will hybridize with the probe strand by complementary base pairing. This will lead to straightening of the hairpin loop thereby separating the fluorescent molecule and the quencher. This will cause appearance of the emission by the fluorescent molecule. Why should the hairpin structure change? The number of complementary base pairs formed between the nucleic acid sequence in the sample and the probe strand are greater than those that existed between the two terminals of the same probe strand. Greater complementary base pairing means greater number of hydrogen bonds between the base pairs and thus greater stability. This drives the straightening of the hairpin loop structure of the probe DNA strand. Such types of molecular beacons are now commonly used in the RT-PCR technique to denote the Joint Initiative of IITs and IISc Funded by MHRD Page 3 of 9

4 progress of the amplification reaction. The following animation (Figure 1) depicts the functioning of a molecular beacon. Fig.1: Functioning of molecular beacon Note: Can be viewed only in Acrobat Reader 9.0 and above 1.2 Cancer therapy The molecular beacon concept can be exploited for killing cancer cells. How? Gold nanoparticles can be used as the quencher and the sequence in the molecular beacon could be designed to specifically pair with a oligonucleotide sequence unique to the cancer cell. Now gold nanoparticles can also serve as an antenna and can be heated by an inductively coupled radio frequency magnetic field from outside. This local increase in temperature can bring about denaturation of DNA in the cancer cell thus leading to its death. This concept can be highly effective if applied. However, the challenges involved in realizing this concept practically are: (i) Identification of unique cancer DNA signatures still to be accomplished and (ii) methods to deliver these beacons into the cancer cell selectively, enable their escape from the endosome and guide their entry into the nucleus of cancer cells are yet to be developed. The following animation (Figure 2) describes the concept involved in the treatment of cancer employing molecular beacons. Joint Initiative of IITs and IISc Funded by MHRD Page 4 of 9

5 Fig. 2: Molecular beacons for cancer therapy Note: Can be viewed only in Acrobat Reader 9.0 and above 1.3 Sensors The ability of the oligonucleotides to be modified at the 5 and 3 terminals coupled with their ability to hybridize with complementary bases through hydrogen bonds can be exploited for biosensing applications. For example, the molecular beacon concept can be extended to identify specific gene sequences in a sample by observing the intensity of fluorescence. Another interesting oligonucleotide structure that has been developed recently as a ph sensor involves formation of unnatural base pairs by hydrogen bonding a phenomenon known as Hoogsteen pairing. The DUTE device had highlighted the formation of G-quartets through hydrogen bonds under specific Joint Initiative of IITs and IISc Funded by MHRD Page 5 of 9

6 ionic concentrations. Similarly, an A-motif has been recently developed using a gold nanoparticle-adenosine rich oligonucleotide hybrid structure. The principle of this sensor is very simple. Gold-oligonucleotide hybrids were formed by thiolating one end of the oligonucleotides to form a thiol link with the gold nanoparticle. Each gold nanoparticle was linked with eight oligonucleotides. Four of these nucleotides were rich in adenosine residues while the other four oligonucleotides were short spacer strands. When the gold nanoparticle-oligonucleotide hybrid is at physiological ph, the emission due to the surface plasmon resonance of the individual gold nanoparticles is observed. When the ph is lowered, the emission wavelength shifts indicating a change in the size of the gold nanoparticles. Why is this shift observed? At acidic ph, the adenosine residues become protonated thereby increasing the number of hydrogen donor groups and hence the ability to hybridize. Formation of hydrogen bonds with adjacent adenosine residues is known as Hoogsteen base pairing. This hydridization will cause association of neighbouring oligonucleotide strands and hence result in aggregation of the gold nanoparticles. This leads to the shift in the emission wavelength. The following animation (Figure 3) represents the principle of a goldoligonucleotide hybrid. Fig. 3: Principle of gold-oligonucleotide hybrid Note: Can be viewed only in Acrobat Reader 9.0 and above This aggregation is ph dependent and hence can be used as a ph sensor. What advantages does this DNA hybrid sensor possess over conventional fluorescent ph sensors? The fluorescent sensors do not function well below ph 5 but the DNA hybrid Joint Initiative of IITs and IISc Funded by MHRD Page 6 of 9

7 sensor can function effectively in low ph. The active ph range can be tuned by altering the length of the oligonucleotide and substituting certain A residues with T residues. 1.4 DNA Nanomechanical devices The forces generated during the conformation changes of the active DNA structures are very high and can be harnessed to push or pull nanostructured elements in a device. For example, it has been estimated that the transition from the open state to the closed state in a DNA tweezer involves a force of about 15 pn. Similarly, in the case of a DUTE device, the force involved to fold the structure is about 2.2 pn while the force generated during its extension is about 20.7 pn. This property can be exploited in the design and development of nanomechanical devices. 1.5 Molecular switches Another interesting possibility of these active structures could be as molecular switches that can turn on or off a chemical interaction by alternately exposing or masking a target group attached to one of the terminals of the probe strand as it toggles from one state to another in response to the introduction of the stimulus. This concept can be exploited for highly efficient organic synthesis in response to environmental cues. This same concept can be built upon to provide an effective platform for synthetic biology. What is synthetic biology? It involves use of engineered biological systems natural or biomimetic, to understand complex biological phenomena or to use these systems for production of commercially useful products such as pharmaceuticals, fuels or food. How can DNA nanostructures be useful in synthetic biology? The nucleic acid self-assembled structures can serve as scaffolds that mimic natural compartments to bring about selective interaction of enzymes and substrates. Though the practical realization of this concept is still far off, the development of such structures offers new directions in the field synthetic biology. 1.6 Information storage The self-assembled DNA active device can be used to store information just like a computer that stores information in the form of binary digits 0 and 1. Each conformation state can be equated to either a 0 or a 1. A DNA array could be constructed by immobilizing the strands on a substrate. All strands could be at the same conformation. The addition of fuel strand to specific sites in the array could transfer the information by bringing about the conformation change at the specific sites. Addition of anti-fuel strands can reprogram the array where now fresh information could be stored! The same concept can be extended to development of molecular logic gates that can form the basis of an exciting new era of DNA computing. The following animation (Figure 4) explains this concept. Joint Initiative of IITs and IISc Funded by MHRD Page 7 of 9

8 Fig. 4: Use of DNA structures for information storage Note: Can be viewed only in Acrobat Reader 9.0 and above 1.7 Molecular electronics The DNA wires can find extensive use in molecular electronics where high aspect ratios can be achieved without compromising the electrical conductivity. Also design of ultrafine conducting pathways has always been a challenge in miniaturization of electronic devices. Such conducting pathways are difficult to create reproducibly and in a defect-free manner by currently available nanofabrication techniques. Use of selfassembled oligonucleotide wires offers a viable alternative for creating conducting pathways in miniaturized electronic structures. Recently, scientists have developed a bi-fi or biological internet, that can enable transmit messages to cells over long distances. They have employed a virus known as M13 that can effectively pack the DNA introduced by the scientists in a protein casing and send it to cells even in remote location. This bi-fi has enormous potential in cell reprogramming and molecular therapy! Joint Initiative of IITs and IISc Funded by MHRD Page 8 of 9

9 1.8 Plasmonics When metal nanoparticles such as gold or silver are exposed to electromagnetic radiations, the electrons in their conduction band exhibit a phenomenon known as surface plasmon resonance. An enhancement in the field can be achieved if the nanoparticles are closely spaced due to coupling between the neighbouring particles. However, the size and shape of the nanoparticle array is a major determinant in realizing optimal field enhancements. In this regard, self-assembled oligonucleotide arrays can be useful to enable precise positioning of the nanoparticles and control the spacing between them. Only hitch in exploiting the nucleic acid arrays is the limitations imposed by the length of the oligonucleotides used. For effective transmission, longer lengths are required and hence optimization and control of the self-assembly involving long nucleotide chains need to be achieved. 2 Conclusion The scope of DNA nanotechnology is infinite and this lecture attempted to provide a glimpse into the interesting possibilities that exist in manipulating this unique biomolecule for applications that can be applied in diverse fields. In future, it is likely that DNA-based devices become a commercial reality. 3 Reference Encyclopedia of Nanoscience & Nanotechnology, Volumes 2 & 9. Edited by: H.S. Nalwa, American Scientific Publishers, Additional Reading 1. Tunable, colorimetric DNA-based ph sensors mediated by A-motif formation, Sonali Saha, Kasturi Chakraborty and Yamuna Krishnan, Chem. Commun., 2012, 48, Nanomechanical Devices Based on DNA, Christof M. Niemeyer and Michael Adler, Angew. Chem. Int. Ed. 2002, 41, No. 20, Joint Initiative of IITs and IISc Funded by MHRD Page 9 of 9

Your Name: MID TERM ANSWER SHEET SIN: ( )

Your Name: MID TERM ANSWER SHEET SIN: ( ) MIDTERM EXAMINATION (October 23, 2008) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Professor Seung-Wuk Lee Fall Semester, 2008 0. Write down your name and the last digit of your SIN in

More information

Name: SID: ( ) MIDTERM EXAMINATION (October 7, 2014) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Fall Semester, 2014

Name: SID: ( ) MIDTERM EXAMINATION (October 7, 2014) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Fall Semester, 2014 MIDTERM EXAMINATION (October 7, 2014) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Fall Semester, 2014 0. Write down your name and the last 4 digits of your SID on all the pages (1) 1.

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

DNA & Protein Synthesis UNIT D & E

DNA & Protein Synthesis UNIT D & E DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

The Structure and Genetic Map of Lambda phage

The Structure and Genetic Map of Lambda phage NPTEL Biotechnology - Systems Biology The Structure and Genetic Map of Lambda phage Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

DNA Technology. B. Using Bacteria to Clone Genes: Overview:

DNA Technology. B. Using Bacteria to Clone Genes: Overview: DNA Technology A. Basic Vocabulary: is DNA from 2 different sources that is combined. is the direct manipulation of genes for practical purposes. literally means or in a test tube or flask. is the manipulation

More information

DNA Transcription. Visualizing Transcription. The Transcription Process

DNA Transcription. Visualizing Transcription. The Transcription Process DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription

More information

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329. Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

2 Gene Technologies in Our Lives

2 Gene Technologies in Our Lives CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA

PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE-452017 INDIA BIOINFORMATICS Bioinformatics is considered as amalgam of biological sciences especially Biotechnology with

More information

Molecular Genetics Student Objectives

Molecular Genetics Student Objectives Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source

More information

Nanobiotechnology. Place: IOP 1 st Meeting Room Time: 9:30-12:00. Reference: Review Papers. Grade: 50% midterm, 50% final.

Nanobiotechnology. Place: IOP 1 st Meeting Room Time: 9:30-12:00. Reference: Review Papers. Grade: 50% midterm, 50% final. Nanobiotechnology Place: IOP 1 st Meeting Room Time: 9:30-12:00 Reference: Review Papers Grade: 50% midterm, 50% final Midterm: 5/15 History Atom Earth, Air, Water Fire SEM: 20-40 nm Silver 66.2% Gold

More information

Chapter 5 DNA and Chromosomes

Chapter 5 DNA and Chromosomes Chapter 5 DNA and Chromosomes DNA as the genetic material Heat-killed bacteria can transform living cells S Smooth R Rough Fred Griffith, 1920 DNA is the genetic material Oswald Avery Colin MacLeod Maclyn

More information

What Are the Chemical Structures and Functions of Nucleic Acids?

What Are the Chemical Structures and Functions of Nucleic Acids? THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,

More information

Artificial Nucleic Acids -Their Developments and Recent Applications

Artificial Nucleic Acids -Their Developments and Recent Applications Artificial Nucleic Acids -Their Developments and Recent Applications Bioorganic Chemistry Laboratory D2 Kenichiro Ito Organic Seminar 2012/5/7 1 Nucleic acids play central roles in life Replication Transcription

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Nucleic Acids, Proteins, and Enzymes

Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

Chapter 3 Nucleic Acids, Proteins, and Enzymes

Chapter 3 Nucleic Acids, Proteins, and Enzymes 3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Digitally Programmed Cells

Digitally Programmed Cells Digitally Programmed Cells Ron Weiss PI: Tom Knight MIT Artificial Intelligence Laboratory Goal Process-Control Cellular Computers -- Microbial Robotics Unique features: small, self-replicating, energy-efficient

More information

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Protein Folding Problem I400: Introduction to Bioinformatics

Protein Folding Problem I400: Introduction to Bioinformatics Protein Folding Problem I400: Introduction to Bioinformatics November 29, 2004 Protein biomolecule, macromolecule more than 50% of the dry weight of cells is proteins polymer of amino acids connected into

More information

Investigating Protein Stability with the Optical Tweezer

Investigating Protein Stability with the Optical Tweezer Investigating Protein Stability with the Optical Tweezer I. Introduction. Various experimental and computational techniques have been developed to study the process by which proteins go from a linear sequence

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix

RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided. AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

Chapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.

Chapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc. Chapter 10 DNA: The Molecule of Heredity Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc. 10.1 What Is The Structure Of DNA? Deoxyribonucleic acid (DNA) is

More information

Storage and Expression of Genetic Information

Storage and Expression of Genetic Information Storage and Expression of Genetic Information 29. DNA structure, Replication and Repair ->Ch 25. DNA metabolism 30. RNA Structure, Synthesis and Processing ->Ch 26. RNA metabolism 31. Protein Synthesis

More information

CREOL, The College of Optics & Photonics, University of Central Florida

CREOL, The College of Optics & Photonics, University of Central Florida Metal Substrate Induced Control of Ag Nanoparticle Plasmon Resonances for Tunable SERS Substrates Pieter G. Kik 1, Amitabh Ghoshal 1, Manuel Marquez 2 and Min Hu 1 1 CREOL, The College of Optics and Photonics,

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information Materials and methods 1. Chemicals and oligonucleotides Oligonucleotides

More information

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not

More information

Vocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase

Vocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase DNA and Replication TEKS (6) Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: (A)

More information

Structural Bioinformatics (C3210) DNA and RNA Structure

Structural Bioinformatics (C3210) DNA and RNA Structure Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.

DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand. DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose

More information

Designing Real-Time Assays on the SmartCycler II System

Designing Real-Time Assays on the SmartCycler II System Designing eal-time Assays on the SmartCycler II System Cepheid Technical Support Overview This document provides general guidelines for the design of real-time experiments on the Cepheid SmartCycler II

More information

Improving the Limit of Detection of Lateral Flow Assays using 3DNA Technology

Improving the Limit of Detection of Lateral Flow Assays using 3DNA Technology Improving the Limit of Detection of Lateral Flow Assays using 3DNA Technology Introduction Lateral Flow (LF) and similar assays represent a unique growing class of Point of Care (POC) tests designed to

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

Label-free interaction analysis in realtime using surface plasmon resonance

Label-free interaction analysis in realtime using surface plasmon resonance GE Healthcare Technology Note 23 Biacore systems Label-free interaction analysis in realtime using surface plasmon resonance Providing quantitative data on: report point Specificity sensorgram To what

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

1. A brief overview of sequencing biochemistry

1. A brief overview of sequencing biochemistry Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry

More information

Biochemistry. Central dogma. Structure and Function of Biomolecules II

Biochemistry. Central dogma. Structure and Function of Biomolecules II . Paper : 03 Module : 07 Principal Investigator: Dr. Sunil Kumar Khare, Professor Dept. of Chemistry, I.I.T. Delhi Paper Coordinator: Content Writer: Dr. Sunil Kumar Khare and Prof. M. N. Gupta Dr. Sunil

More information

Plasmonic Nanostructures II

Plasmonic Nanostructures II Plasmonic Nanostructures II Dr. Krüger / Prof. M. Zacharias, IMTEK, Propagation of SPPs Propagation distance decreases with decreasing strip width! 2 Dr. Krüger / Prof. M. Zacharias, IMTEK, Bound and leaky

More information

If Dna Has The Instructions For Building Proteins Why Is Mrna Needed

If Dna Has The Instructions For Building Proteins Why Is Mrna Needed If Dna Has The Instructions For Building Proteins Why Is Mrna Needed if a strand of DNA has the sequence CGGTATATC, then the complementary each strand of DNA contains the info needed to produce the complementary

More information

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints

More information

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t. BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid

More information

Central Dogma. 1. Human genetic material is represented in the diagram below.

Central Dogma. 1. Human genetic material is represented in the diagram below. Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)

More information

Bi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1

Bi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1 Bi 8 Lecture 7 PROTEIN STRUCTURE, Functional analysis, and evolution Ellen Rothenberg 26 January 2016 Reading: Ch. 3, pp. 109-134; panel 3-1 (end with free amine) aromatic, hydrophobic small, hydrophilic

More information

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane

More information

NANOSCALE MANUFACTURING

NANOSCALE MANUFACTURING NANOSCALE MANUFACTURING From the Bottom Up: DNA Focus Todd Nilsen Overview Current Techniques Lithography Mechanical Stamping Advantages/Disadvantages New Technology Bottom Up Approach Using DNA Protein

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology Brought American Society of Cytopathology Core Curriculum in Molecular Biology Brought American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives

More information

Written by: Prof. Brian White

Written by: Prof. Brian White Molecular Biology II: DNA Transcription Written by: Prof. Brian White Learning Goals: To work with a physical model of DNA and RNA in order to help you to understand: o rules for both DNA & RNA structure

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

RNA & PROTEIN SYNTHESIS

RNA & PROTEIN SYNTHESIS RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Characterization of Aptamer Binding using SensíQ SPR Platforms

Characterization of Aptamer Binding using SensíQ SPR Platforms Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional

More information

Chapter 14 Active Reading Guide From Gene to Protein

Chapter 14 Active Reading Guide From Gene to Protein Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single

More information

Click here to read the case study about protein synthesis.

Click here to read the case study about protein synthesis. Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics

More information

Covalently bonded sugar-phosphate backbone with relatively strong bonds keeps the nucleotides in the backbone connected in the correct sequence.

Covalently bonded sugar-phosphate backbone with relatively strong bonds keeps the nucleotides in the backbone connected in the correct sequence. Unit 14: DNA Replication Study Guide U7.1.1: DNA structure suggested a mechanism for DNA replication (Oxford Biology Course Companion page 347). 1. Outline the features of DNA structure that suggested

More information

Chapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates

Chapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates Chapter 4 Fluorescence Resonance Energy Transfer (FRET) by Minor Groove-Associated Cyanine-Polyamide Conjugates The work described in this chapter was accomplished in collaboration with V. Rucker (Dervan

More information

Introduction to DNA Computing

Introduction to DNA Computing Introduction to DNA Computing The lecture notes were prepared according to Leonard Adleman s seminal paper Molecular Computation of Solutions to Combinatorial Problems and Keith Devlin s explanatory article

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

How Do You Clone a Gene?

How Do You Clone a Gene? S-20 Edvo-Kit #S-20 How Do You Clone a Gene? Experiment Objective: The objective of this experiment is to gain an understanding of the structure of DNA, a genetically engineered clone, and how genes are

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

Developmental Biology BY1101 P. Murphy

Developmental Biology BY1101 P. Murphy Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision

More information

Write down your name and the last 4 digits of your SID on all the pages (1)

Write down your name and the last 4 digits of your SID on all the pages (1) * MIDTERM EXAMINATION (Oct 20, 2015) BIOE150. Introduction to Bio-Nanoscience & Bio- Nanotechnology Fall Semester, 2015 Write down your name and the last 4 digits of your SID on all the pages (1) 1. Define

More information

Polymerase Chain Reaction (PCR) and Its Applications

Polymerase Chain Reaction (PCR) and Its Applications Polymerase Chain Reaction (PCR) and Its Applications What is PCR? PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by Dr. Kary Mullis,

More information

BIOCHEMISTRY Nucleic Acids

BIOCHEMISTRY Nucleic Acids BIOCHEMISTRY Nucleic Acids BIOB111 CHEMISTRY & BIOCHEMISTRY Session 17 Session Plan Types of Nucleic Acids Nucleosides Nucleotides Primary Structure of Nucleic Acids DNA Double Helix DNA Replication Types

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

Introduction of Biosensors

Introduction of Biosensors Introduction of Biosensors Lecture April 17 Jeff T.H.Wang website: http://pegasus.me.jhu.edu/~thwang/ New course : BioMEMS and BioSensing (Spring 04 ) What s is a biosensor? Target 4.22 Signal Signal Analtye

More information

DNA Structure and Replication, and Virus Structure and Replication Test Review

DNA Structure and Replication, and Virus Structure and Replication Test Review DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the

More information

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction RNA Secondary Structure Prediction Outline 1) Introduction: RNA structure basics 2) Dynamic programming for RNA secondary structure prediction The Central Dogma of Molecular Biology DNA CCTGAGCCAACTATTGATGAA

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information