Supporting Information for. Bongseo Choi, 1, Hyojin Moon, 1, Sung Joon Hong, 1 Changsik Shin, 1 Yoonkyung Do, 1 Seongho Ryu, 2,* Sebyung Kang 1,*

Size: px
Start display at page:

Download "Supporting Information for. Bongseo Choi, 1, Hyojin Moon, 1, Sung Joon Hong, 1 Changsik Shin, 1 Yoonkyung Do, 1 Seongho Ryu, 2,* Sebyung Kang 1,*"

Transcription

1 Supporting Information for Effective Delivery of Antigen-Encapsulin Nanoparticle Fusions to Dendritic Cells Leads to Antigen-Specific Cytotoxic T Cell Activation and Tumor Rejection Bongseo Choi, 1, Hyojin Moon, 1, Sung Joon Hong, 1 Changsik Shin, 1 Yoonkyung Do, 1 Seongho Ryu, 2,* Sebyung Kang 1,* 1 Department of Biological Sciences, School of Life Sciences, Ulsan National Institute of Science and Technology (UNIST), Ulsan, , Korea and 2 Soonchunhyang Institute of Medi-bio Science (SIMS), Soonchunhyang University, Cheonan, , Korea 1

2 Figure S1. Characterization of Encap containing OT-1 peptides at the N-termini (OT-1-Encap-N). (A) Schematic representation of OT-1 peptide addition to the N-termini of Encap. (B) Molecular mass measurements of the dissociated subunits of Encap (bottom) and OT-1-Encap-N (top). Calculated and observed molecular masses were indicated. (C) Size exclusion elution profiles (280 nm) of Encap (bottom) and OT-1-Encap-N (top). (D) Transmission electron micrographic (TEM) image of 2 % uranyl acetate stained Encap (left) and OT-1-Encap-N (right). Scale bars (100 nm) were indicated. 2

3 Figure S2. Characterization of Encap containing OT-1 peptides at the loop region (OT-1-Encap-L). (A) Schematic representation of OT-1 peptide insertion to the loop region of Encap. (B) Molecular mass measurements of the dissociated subunits of Encap (bottom) and OT-1-Encap-L (top). Calculated and observed molecular masses were indicated. Molecular mass of the dissociated subunits of OT-1-Encap-L was smaller than that of Encap, because the residues of loop region were substituted with OT-1 peptides. (C) Size exclusion elution profiles (280 nm) of Encap (bottom) and OT-1-Encap-L (top). (D) Transmission electron micrographic (TEM) image of 2 % uranyl acetate stained Encap (left) and OT-1-Encap-L (right). Scale bars (100 nm) were indicated. 3

4 Figure S3. Encap variants and OVA protein were efficiently phagocytosed by DCs. (A) DCs harvested from naïve C57BL/6 mice were incubated with indicated proteins labeled with phrodo either at 4 C (light shaded histograms) or 37 C (dark shaded histograms) for 2 hours and data was analyzed by flow cytometry. (B) DCs were matured with fluorescein-labeled OT-1-Encap-C in the presence of poly (I:C) at 37 C for 18 hours. Subsequently, they were incubated with 50 nm of lysotracker for additional 2 hours and fluorescence cell images of them were obtained from confocal microscope. Scale bars (20 μm) were indicated. 4

5 Figure S4. The maturation of DCs were efficiently induced by OT-1-Encap-C. Immature DCs harvested from naïve C57BL/6 mice were incubated with indicated proteins in the presence of poly (I:C) at 37 C for 18 hours and the DC maturation markers (CD80, CD86 or MHC II) was stained with PE-conjugated antibodies. The degree of DC maturation was evaluated with flow cytometry. All the DC maturation markers were successfully observed in OT-1-Encap-C treated DCs similar to those of OVA protein or OT- 1 peptide treated DCs. 5

6 Figure S5. Dose-dependent OT-1 specific CD8 + T cell proliferations. DCs harvested from naïve C57BL/6 mice were pulsed with indicated amounts of Encap variants carrying OT-1 peptides and OVA protein for 3 hours. The pulsed DCs were washed and co-cultured with CFSE-labeled OT-1 CD8 + T cells at a ratio of 1:3. Four days later, different degrees of OT-1 specific CD8 + T cell proliferation were measured by flow cytometry. 6

7 Figure S6. OT-1-Encap-C treated mature DCs formed stable conjugates with OT-1 specific CD8 + T cells. DAPI stained mature OT-1-Encap-C treated mature DCs (blue) were co-cultured with 5 μm CFSE labelled CD8 + T cells (green) derived from OT-1 transgenic mice with 1:3 ratio at 37 C for 2 hours. Stable cognate interactions between OT-1-Encap-C treated mature DCs and CD8 + T cells (red arrows) were observed with confocal fluorescence microscope. Scale bars (40 μm) were indicated. 7

8 Figure S7. OT-1 peptides delivered to DCs by OT-1-Encap-C induce the differentiation of functional effector CD8 + T cells in lymph nodes. (A) Naïve C57BL/6 mice were immunized subcutaneously either with PBS, OVA protein, Encap or OT-1-Encap-C in the presence of poly (I:C) as an adjuvant. Mice were intravenously injected with CFSE-labeled syngeneic splenocytes pulsed with (CFSE hi ) or without (CFSE low ) OT-1 peptide seven days later. Next day, cytotoxicity of OT-1 specific CD8 + T cell was measured by Flow cytometry. (B) Single cells were isolated from lymph nodes and stimulated again with OT-1 peptides for 2 days. The amounts of IFN-γ produced were measured with CBA from cultured supernatants. The P values < 0.05 were considered significant (*). 8

9 Figure S8. Simple pulsing of OT-1 peptide onto Encaps does not efficiently proliferate OT-1 specific CD8 + T cells as those of OVA protein or OT-1-Encap-C in vivo. Equivalent amount of OT-1 peptide as OT-1- Encap-C were pulsed with Encaps in 37 C for 2 hours. PBS, OVA protein, OT-1 peptide pulsed Encaps and OT-1-Encap-C were primarily immunized to naïve C57Bl/6 mice. Mice were intravenously injected with CFSE-labeled syngeneic splenocytes pulsed with (CFSE hi ) or without (CFSE low ) OT-1 peptide seven days later. Next day, cytotoxicity of OT-1 specific CD8 + T cell was measured by flow cytometry. 9

10 Figure S9. OT-1 peptides delivered to DCs by OT-1-Encap-C efficiently generate functional OT-1 peptide specific CD8 + T cells. (A) Naïve C57BL/6 mice were primed and boosted subcutaneously either with PBS, OVA protein, Encap or OT-1-Encap-C in the presence of poly (I:C) as an adjuvant. CD8 + T cells were isolated from whole splenocytes and subsequently treated with PE conjugated SIINFEKL-MHC I tetramers for 30 minutes. The population of OT-1 peptide specific CD8 + T cells was analyzed by flow cytometry. (B) Bar graph represents % of total cells, which were positive to PE conjugated SIINFEKL-MHC I tetramers. OVA protein or OT-1-Encap-C immunized mice exhibited increased populations of OT-1 peptide specific CD8 + T cells compared to those of PBS, Encap, or OT-1 peptide immunized mice. 10

11 Figure S10. Prophylactic vaccination with OT-1-Encap-C cannot suppressed B16-F10, OT-1 peptide nonexpressing melanoma, tumor growth. (A) Mice were primed intraperitoneally either with PBS, OVA protein, Encap or OT-1-Encap-C in the presence of poly (I:C) as an adjuvant and boosted with the same antigens 14 days later. At day 21, of B16-F10 melanoma cells were subcutaneously injected onto the right flank. After 10 day of tumor challenge, tumor bearing mice were intravenously injected with CFSE-labeled syngeneic splenocytes pulsed with (CFSE hi ) or without (CFSE low ) OT-1 peptide. OVA-specific CD8 + T cell cytotoxicity was measured by flow cytometry. (B) Tumor sizes were measured afterwards with a caliper every two or three days (n=7). (C) Mice were sacrificed at day 23 after tumor challenges and tumor masses were isolated presented. 11

12 Figure S11. Isolation of tumor-infiltrating lymphocytes (TILs) and the CD8/CD4 cell ratio in TILs. (A) Mice were primed intraperitoneally either with PBS, OVA protein, Encap or OT-1-Encap-C in the presence of poly (I:C) as an adjuvant and boosted with the same antigens 14 days later. At day 21, of B16- OVA melanoma cells were subcutaneously injected on right flank. Mice were sacrificed at day 21 after tumor challenges and tumor masses were isolated. (B) The populations of CD8 and CD4 cells were analyzed by flow cytometry and CD8/CD4 cell ratios in TILs isolated from each group were plotted. (C) Isolated TILs were stimulated again with 1 μm of OT-1 peptides and total IFN-γ productions of each group determined by cytometric beads assay (CBA). 12

13 Figure S12. Therapeutic vaccination with OT-1-Encap-C cannot suppressed B16-F10, OT-1 peptide nonexpressing melanoma, tumor growth. (A) Mice were subcutaneously injected with of B16-F10 melanoma onto the right flank. 7 days later, the mice were therapeutically treated with either with PBS, OVA protein, Encap or OT-1-Encap-C in the presence of poly (I:C) as an adjuvant intraperitoneally. Tumor sizes were measured afterwards with a caliper every two or three days for 23 days (n=7). (B) Mice were sacrificed at day 23 after tumor challenges and tumor masses were isolated presented. (C) Mice were subcutaneously injected with of B16-F10 melanoma onto the right flank. 10 days of therapeutic vaccination, tumor bearing mice were intravenously injected with CFSE-labeled syngeneic splenocytes pulsed with (CFSE hi ) or without (CFSE low ) OT-1 peptide. OVA-specific CD8 + T cell cytotoxicity was measured by flow cytometry. 13

HSV-2 therapeutic vaccine program. Subunit vaccine candidates

HSV-2 therapeutic vaccine program. Subunit vaccine candidates HSV-2 therapeutic vaccine program Subunit vaccine candidates Our HSV-2 vaccine program Therapeutic subunit vaccine T-cell-based Aim: Best-in-class antigens by engineering Excellent standing (Sept 2017):

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland Approved for public release; distribution unlimited

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland Approved for public release; distribution unlimited AD Award Number: W81XWH-7-1-345 TITLE: Second-Generation Therapeutic DNA Lymphoma Vaccines PRINCIPAL INVESTIGATOR: Larry W. Kwak, MD, PhD CONTRACTING ORGANIZATION: The University of Texas M. D. Anderson

More information

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter

More information

Lichenase fusions improve immunological properties of antigens

Lichenase fusions improve immunological properties of antigens Lichenase fusions improve immunological properties of antigens Konstantin Musiychuk Center for Molecular Biotechnology, Fraunhofer USA 03/27/2012 Lichenase Hydrolysis site of β-glycans Structure of the

More information

Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry

Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry Kristie M. Grebe and Terry A. Potter* (Published 10 September

More information

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro

More information

Supporting Information

Supporting Information Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the

More information

Direct Cell Counting Assays for Immuno Therapy

Direct Cell Counting Assays for Immuno Therapy Direct Cell Counting Assays for Immuno Therapy Cytotoxicity assays play a central role in studying the function of immune effector cells such as cytolytic T lymphocytes (CTL) and natural killer (NK) cells.

More information

Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis

Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined Hyperthermia for Enhanced Cancer Cell Apoptosis Birju P. Shah a, Nicholas Pasquale a, Gejing De b, Tao Tan b, Jianjie

More information

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)

More information

Supplemental Information Inventory

Supplemental Information Inventory Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.

More information

Flow Cytometry - The Essentials

Flow Cytometry - The Essentials Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.

More information

Cellometer Vision CBA

Cellometer Vision CBA Features of the Vision CBA Image Cytometry System All-in-One System Basic cell counting, primary cell viability, and cellbased assays. See for Yourself Why the Top Ten Pharmaceutical Companies Trust Cellometer

More information

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

More information

FLOW CYTOMETRY. CyAn ADP. Analyzer

FLOW CYTOMETRY. CyAn ADP. Analyzer FLOW CYTOMETRY CyAn ADP Analyzer Experience the Power of the CyAn ADP and its optimal performance The Power of Detection The Power of Speed The Power of Ease The CyAn ADP Analyzer is the next step in Advanced

More information

Antibody opsonization of tumor cell membranes using hapten-peg-lipid conjugates

Antibody opsonization of tumor cell membranes using hapten-peg-lipid conjugates ORIGINAL ARTICLES Antibody opsonization of tumor cell membranes using hapten-peg-lipid conjugates Tosihiko Sugiura 1, Koichi Kato 1 1, 2, 3, Teruyuki Nagamune 1. Department of Chemistry and Biotechnology,

More information

Identification of red and white blood cells from whole blood samples using the Agilent 2100 bioanalyzer. Application Note

Identification of red and white blood cells from whole blood samples using the Agilent 2100 bioanalyzer. Application Note Identification of red and white blood cells from whole blood samples using the Agilent 2100 bioanalyzer Application Note Sylvie Veriac Valérie Perrone Madeleine Avon Abstract Agilent Equipment: 2100 bioanalyzer

More information

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,

More information

No-wash, no-lyse detection of phagocytic cells via a phrodo BioParticles functional assay in human whole blood on the

No-wash, no-lyse detection of phagocytic cells via a phrodo BioParticles functional assay in human whole blood on the APPLICATION NOTE Attune NxT Flow Cytometer No-wash, no-lyse detection of phagocytic cells via a phrodo BioParticles functional assay in human whole blood on the Attune NxT Flow Cytometer Introduction Analysis

More information

GSK-3β inhibition enhances dendritic cell based cancer vaccine potency via suppression of IFN-γ induced IDO expression

GSK-3β inhibition enhances dendritic cell based cancer vaccine potency via suppression of IFN-γ induced IDO expression JBC Papers in Press. Published on March 26, 2015 as Manuscript M114.628578 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.m114.628578 GSK-3β inhibition enhances dendritic cell based cancer

More information

Cytomics in Action: Cytokine Network Cytometry

Cytomics in Action: Cytokine Network Cytometry Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University

More information

Flow Cytometry SOP: 14 color flow for immune activation, senescence, and exhaustion

Flow Cytometry SOP: 14 color flow for immune activation, senescence, and exhaustion Flow Cytometry SOP: 14 color flow for immune activation, senescence, and exhaustion Purpose This SOP standardizes the procedure for measuring immune cells using flow cytometry in ACTG Immunology Laboratories.

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

EdU Flow Cytometry Kit. User Manual

EdU Flow Cytometry Kit. User Manual User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg

More information

ProImmune REVEAL & ProVE Rapid Epitope Discovery System and Cellular Analysis Services

ProImmune REVEAL & ProVE Rapid Epitope Discovery System and Cellular Analysis Services ProImmune REVEAL & ProVE Rapid Epitope Discovery System and Cellular Analysis Services Overview of ProImmune REVEAL & ProVE Rapid Epitope Discovery System 2-4 Applications 4 Service in Detail 5-9 Module

More information

OmniAb. Naturally optimized human antibodies

OmniAb. Naturally optimized human antibodies OmniAb Naturally optimized human antibodies Transgenic animals for hmab discovery Only company to offer three platforms Patented technology with freedom to operate V L V H C C H 1 hinge C H 2 C H 3 2 28

More information

Return to Web Version

Return to Web Version Return to Web Version PKH Linker Kits BioFiles 2007, 2.5, 22. PKH Linker Kits for Fluorescent Cell Labeling Features Achieve stable, uniform, intense, and reproducible fluorescent labeling of live cells

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2774 Figure S1 TRF2 dosage modulates the tumorigenicity of mouse and human tumor cells. (a) Left: immunoblotting with antibodies directed against the Myc tag of the transduced TRF2 forms

More information

Supplemental information

Supplemental information Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry

More information

NovoCyte Flow Cytometer

NovoCyte Flow Cytometer NovoCyte Flow Cytometer The Flow Cytometer for Everyone 2 Experience the NovoCyte Advantage Focus on advancing your research. Let the flow cytometer do the rest. NovoCyte Flow Cytometer High Performance

More information

Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge

Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement

More information

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van

More information

Detecting individual extracellular vesicles using a multicolor in situ proximity

Detecting individual extracellular vesicles using a multicolor in situ proximity Supplementary data Detecting individual extracellular vesicles using a multicolor in situ proximity ligation assay with flow cytometric readout Liza Löf a, Tonge Ebai a, Louise Dubois b, Lotta Wik a, K.

More information

In vitro cultures of bone marrow stromal cells and progenitor B cells can accurately recapitulate the normal steps of B cell development.

In vitro cultures of bone marrow stromal cells and progenitor B cells can accurately recapitulate the normal steps of B cell development. Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused

More information

B cell development The stages of B cell development

B cell development The stages of B cell development Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused

More information

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating

More information

Immunogenicity of Therapeutic Fusion proteins: Contributory Factors and Clinical Experience

Immunogenicity of Therapeutic Fusion proteins: Contributory Factors and Clinical Experience University of Rhode Island DigitalCommons@URI Institute for Immunology and Informatics Faculty Publications Institute for Immunology and Informatics (icubed) 2013 Immunogenicity of Therapeutic Fusion proteins:

More information

Transferrin Conjugates

Transferrin Conjugates Transferrin Conjugates Table 1 Contents and storage Material Formulation Storage Stability Transferrin conjugates* lyophilized powder containing transferrin conjugate, lyophilized in phosphate-buffered

More information

Immune assay harmonization and external quality assurance: Results of the ongoing Proficiency Panel Program of the Cancer Vaccine Consortium

Immune assay harmonization and external quality assurance: Results of the ongoing Proficiency Panel Program of the Cancer Vaccine Consortium Immune assay harmonization and external quality assurance: Results of the ongoing Proficiency Panel Program of the Cancer Vaccine Consortium Sylvia Janetzki MD Sylvia Janetzki, M.D. ZellNet Consulting,

More information

COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE

COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE The European Agency for the Evaluation of Medicinal Products Evaluation of Medicines for Veterinary Use CVMP/IWP/07/98-FINAL COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES

More information

Many different studies, in both preclinical and clinical

Many different studies, in both preclinical and clinical Killing of Normal Melanocytes, Combined with Heat Shock Protein 70 and CD40L Expression, Cures Large Established Melanomas Luis Sanchez-Perez, 2 * Timothy Kottke, 2 * Gregory A. Daniels,* Rosa Maria Diaz,*

More information

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * Division of Hematology-Oncology, Department of Medicine, Medical University of South Carolina, Charleston,

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means

More information

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

Modulation of Immune Response in Lambs

Modulation of Immune Response in Lambs Modulation of Immune Response in Lambs A.S. Leaflet R1473 Jose O. Lopez Virella, graduate research assistant, M. L. Kaeberle, professor, veterinary microbiology Mamadou Niang, graduate research assistant.

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting. Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice

More information

Celigo Assays.

Celigo Assays. Celigo Assays April 2017 www.nexcelom.com/celigo Nexcelom's team of Field Applications Scientists, R&D Specialists and Product Managers are in frequent contact with researchers in the field, developing

More information

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets

More information

EAE Induction by Active Immunization in C57BL/6 Mice

EAE Induction by Active Immunization in C57BL/6 Mice Recommended protocol for use with Hooke Kit MOG 35-55/CFA Emulsion PTX (EK-0110, EK-0112, EK-0113, EK-0114, or EK-0115). Summary C57BL/6 mice develop chronic paralysis after immunization with MOG 35-55

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo

Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453

More information

BD Pharmingen. Apoptosis, DNA Damage and Cell Proliferation Kit. Technical Data Sheet. Product Information. Description

BD Pharmingen. Apoptosis, DNA Damage and Cell Proliferation Kit. Technical Data Sheet. Product Information. Description Technical Data Sheet Apoptosis, DNA Damage and Cell Proliferation Kit Product Information Material Number: Size: Component: Description: 562253 50 Tests 51-9007685AK Apoptosis, DNA Damage and Cell Proliferation

More information

Electronic Supplementary Material (ESI) for Journal of Materials Chemistry This journal is The Royal Society of Chemistry 2011.

Electronic Supplementary Material (ESI) for Journal of Materials Chemistry This journal is The Royal Society of Chemistry 2011. Experimental: MTT assay: To determine cell viability the colorimetric MTT metabolic activity assay was used. Hela cells (1 10 4 cells/well) were cultured in a 96-well plate at 37 C, and exposed to varying

More information

Supplementary Figure 1. Images of agarose gel electrophoresis verifying the circularization of template for Stat3 shrna.

Supplementary Figure 1. Images of agarose gel electrophoresis verifying the circularization of template for Stat3 shrna. Supplementary Figure 1. Images of agarose gel electrophoresis verifying the circularization of template for Stat3 shrna. 1 Supplementary Figure 2. Characterization of DNA-RNA MFs. (a) An SEM image showing

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Detecting human circulating endothelial cells using the Attune Acoustic Focusing Cytometer

Detecting human circulating endothelial cells using the Attune Acoustic Focusing Cytometer APPLICATION NOTE Attune Acoustic Focusing Cytometer Detecting human circulating endothelial cells using the Attune Acoustic Focusing Cytometer Circulating endothelial cells (CECs) are mature cells shed

More information

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2 Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,

More information

Received 15 December 2003/Accepted 19 April 2004

Received 15 December 2003/Accepted 19 April 2004 JOURNAL OF VIROLOGY, Sept. 2004, p. 9093 9104 Vol. 78, No. 17 0022-538X/04/$08.00 0 DOI: 10.1128/JVI.78.17.9093 9104.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Adjuvant

More information

ph-responsive gold nanoparticles-in-liposome hybrid nanostructures for

ph-responsive gold nanoparticles-in-liposome hybrid nanostructures for Electronic Supplementary Information ph-responsive gold nanoparticles-in-liposome hybrid nanostructures for enhanced systemic tumor delivery Jutaek Nam, a Yeong Su Ha, b Sekyu Hwang, a Woonghee Lee, b

More information

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc. The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration

More information

Biomarkers, Early Prediction of Vaccine Efficacy and Safety

Biomarkers, Early Prediction of Vaccine Efficacy and Safety Biomarkers, Early Prediction of Vaccine Efficacy and Safety Giuseppe Pantaleo, M.D. Professor of Medicine Head, Division of Immunology and Allergy Executive Director, Swiss Vaccine Research Institute Lausanne

More information

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

More information

Biochemical Binding ADCC Assays Utilizing AlphaLISA Toolbox Reagents for the Characterization of higgs and FcγR1A

Biochemical Binding ADCC Assays Utilizing AlphaLISA Toolbox Reagents for the Characterization of higgs and FcγR1A APPLICATION NOTE AlphaLISA Technology Authors: Daniel Cardillo Stephen Hurt PerkinElmer, Inc. Hopkinton, MA Biochemical Binding ADCC Assays Utilizing AlphaLISA Toolbox Reagents for the Characterization

More information

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent Nicola Bevan, Tim Dale, Del Trezise Essen BioScience Welwyn Garden City, Hertfordshire, UK Introduction Monoclonal antibodies are now widely used as anti-cancer, antiinflammatory and anti-viral therapeutic

More information

Application Note. Assay Portability on the BD FACSVerse System. Summary. Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar

Application Note. Assay Portability on the BD FACSVerse System. Summary. Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar September Assay Portability on the BD FACSVerse System Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar Contents Summary Introduction 3 Objective 4 Methods 6 Results Discussion Conclusions

More information

Combined CD137 (4-1BB) and adjuvant therapy generates a developing pool of peptide-specific CD8 memory T cells

Combined CD137 (4-1BB) and adjuvant therapy generates a developing pool of peptide-specific CD8 memory T cells International Immunology, Vol. 18, No. 2, pp. 325 333 doi:10.1093/intimm/dxh371 ª The Japanese Society for Immunology. 2005. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

More information

Supplementary Figure Legend

Supplementary Figure Legend Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Supplementary Figure 1 Activated B cells are subdivided into three groups

Supplementary Figure 1 Activated B cells are subdivided into three groups Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation

More information

Phagocytosis Assay Kit (IgG FITC)

Phagocytosis Assay Kit (IgG FITC) Phagocytosis Assay Kit (IgG FITC) Item No. 500290 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 4 Precautions

More information

Get to your high-value clones faster with a complete hybridoma media solution

Get to your high-value clones faster with a complete hybridoma media solution Get to your high-value clones faster with a complete hybridoma media solution ENEFITS Complete solution from hybridoma fusion to expansion Simultaneous cloning and selection of hybridomas Optimized for

More information

alamarblue Technical Datasheet

alamarblue Technical Datasheet alamarblue Technical Datasheet Bio-Rad Laboratories Endeavour House, Langford Lane, Kidlington, Oxford, OXON OX5 1GE, UK antibody_sales_uk@bio-radcom Tel: +44 () 1865 8527 Copyright Bio-Rad Laboratories,

More information

The presenter declare no conflict of interest This work was partly supported by Selecta Bioscience

The presenter declare no conflict of interest This work was partly supported by Selecta Bioscience Modulation of AAV vector dosing and avoidance of capsid immune responses via repeated co-administration of vector with rapamycin tolerogenic nanoparticles Amine Meliani The presenter declare no conflict

More information

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells

Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Titration of Fluorochrome-Conjugated Antibodies for Labeling Cell Surface Markers on Live Cells Ruud Hulspas 1 UNIT 6.29 1 Cytonome/ST, Boston, Massachusetts ABSTRACT Nonspecific antibody binding is best

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Updated April 27, PRODUCT INSERT

Updated April 27, PRODUCT INSERT Updated April 27, 2009 1 PRODUCT INSERT Hypoxyprobe, Inc. 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Gemini Kit Kit Contents: Solid pimonidazole HCl (Hypoxyprobe -1)

More information

APPLICATION NOTE Rev. 7/2017, v4.0 Fluorescent Nanodiamonds: Bio-applications. Physical and Fluorescence Properties

APPLICATION NOTE Rev. 7/2017, v4.0 Fluorescent Nanodiamonds: Bio-applications. Physical and Fluorescence Properties APPLICATION NOTE Rev. 7/2017, v4.0 Fluorescent Nanodiamonds: Bio-applications Fluorescent nanodiamonds (FNDs) offer a unique alternative to currently existing fluorescent biomarkers. With exceptional photo

More information

(51) Int Cl.: A61K 39/00 ( ) C12N 5/0783 ( ) A61P 37/00 ( )

(51) Int Cl.: A61K 39/00 ( ) C12N 5/0783 ( ) A61P 37/00 ( ) (19) TEPZZ 4 Z9B_T (11) EP 2 334 9 B1 (12) EUROPEAN PATENT SPECIFICATION (4) Date of publication and mention of the grant of the patent: 31.0.17 Bulletin 17/22 (21) Application number: 0981849. (22) Date

More information

Flow Cytometry Support Reagents

Flow Cytometry Support Reagents Excite and inspire Flow Cytometry Support Reagents Introduction Miltenyi Biotec is a leading supplier of flow cytometry products, offering one of the broadest ranges of antibodies, kits, assays, and support

More information

PURPOSE: To delineate the subsets of human lymphocytes based on the expression profiles of different phenotypic markers by FACS analysis

PURPOSE: To delineate the subsets of human lymphocytes based on the expression profiles of different phenotypic markers by FACS analysis LABORATORY PROCEDURE: IMMUNOPHENOTYPING: Lymphocyte Staining for FACS Analysis Date: April 29 2014 Authors: Jennifer Hossler PURPOSE: To delineate the subsets of human lymphocytes based on the expression

More information

by Alexander Y. Rudensky (Sloan-Kettering Institute, New York). LSL-TβRI CA (TGFβR-

by Alexander Y. Rudensky (Sloan-Kettering Institute, New York). LSL-TβRI CA (TGFβR- Materials and Methods Mice. Tgfbr2 fl/fl CD4-Cre (TGFβR-KO) mice were previously reported (3). Cre negative littermates were used as wild-type controls. DN-TGFβRII (TGFβR-DN) mice were provided by Ronald

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

EAE Induction by Active Immunization in C57BL/6 Mice

EAE Induction by Active Immunization in C57BL/6 Mice Recommended protocol for use with: Hooke Kit MOG 35-55/CFA Emulsion PTX (EK-0110, EK-0112, EK-0113, EK- 0114, or EK-0115), or, Hooke Kit MOG 1-125/CFA Emulsion PTX (EK-0162 or EK-0164) Summary C57BL/6

More information

IGRA: Diagnosing TB in the Twenty-First Century with. Peter Barnes, MD

IGRA: Diagnosing TB in the Twenty-First Century with. Peter Barnes, MD TB Intensive Tyler, Texas June 2-4, 2010 IGRA: Diagnosing TB in the Twenty-First Century with Case Studies Peter Barnes, MD June 4, 2010 Interferon Gamma Releasing Assays: Diagnosing TB in the Twenty-First

More information

Supplemental Movie Legend.

Supplemental Movie Legend. Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,

More information

Rat IGF-1 ELISA Kit (rigf-1-elisa)

Rat IGF-1 ELISA Kit (rigf-1-elisa) Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar

More information

Custom Antibodies Services. GeneCust Europe. GeneCust Europe

Custom Antibodies Services. GeneCust Europe. GeneCust Europe GeneCust Europe Laboratoire de Biotechnologie du Luxembourg S.A. 2 route de Remich L-5690 Ellange Luxembourg Tél. : +352 27620411 Fax : +352 27620412 Email : info@genecust.com Web : www.genecust.com Custom

More information

TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by

TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was

More information

Supporting Information

Supporting Information Supporting Information Fukaya et al. 10.1073/pnas.1202208109 SI Materials and Methods Generation of Cd205 dtr/dtr Mice. The targeting vector for Cd205 dtr/dtr mice was constructed in the pbluescript vector

More information

The dendritic cell (DC)

The dendritic cell (DC) Opposing Signals from Pathogen-Associated Molecular Patterns and IL-10 Are Critical for Optimal Dendritic Cell Induction of In Vivo Humoral Immunity to Streptococcus pneumoniae 1 Jesus Colino and Clifford

More information

Creation of a Merkel cell polyomavirus small T antigen-expressing murine tumor model and a DNA vaccine targeting small T antigen

Creation of a Merkel cell polyomavirus small T antigen-expressing murine tumor model and a DNA vaccine targeting small T antigen Gomez et al. Cell & Bioscience 2013, 3:29 Cell & Bioscience RESEARCH Open Access Creation of a Merkel cell polyomavirus small T antigen-expressing murine tumor model and a DNA vaccine targeting small T

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Assessment of quaternary structure of soluble RSV F proteins. Soluble variants of F proteins from A2 and B1 RSV strains were expressed in HEK293 cells. The cell culture supernatants

More information