Mucosal Immunity induced by VLPs
|
|
- Jason Shepherd
- 6 years ago
- Views:
Transcription
1 Virus-like paticles (VLPs) as vaccines, vectors and adjuvants, Fondation Mérieux, Annecy, 04 Mucosal Immunity induced by VLPs Denise Nardelli-Haefliger Lausanne University Hospital, Switzerland
2 Purified Human Papillomavirus Virus-like particles = VLPs as SUBUNIT Vaccines HPV6 VLPs purified from insect cells infected with a HPV6 L recombinant baculovirus Antibody responses Mice:- mucosal immunization routes - adjuvant - recombinant bacteria Women: - antibody in genital secretions - mucosal routes
3 Induction of mucosal immune responses upon mucosal immunization B cell
4 Induction of mucosal immune responses upon mucosal immunization Compartimentalization pending the route of immunization Oral Nasal Rectal Vaginal
5 Antobody isotypes in different mucosal secretions
6 Immunization routes - Subcutaneous - Rectal - Vaginal - Nasal - Aerosol-like (inhaled) - Oral -Serum -Genital secretions -Saliva -Feces
7 Normalized IgG titers (log 0 ) Normalized IgA titers (log 0 ) IgG Titer (log 0 ) Serum anti-hpv6vlp IgG week 8 5 Mucosal immunization of mice and Anti-VLP antibodies 4 Rectal Vaginal Oral Aerosol Nasal s.c. Genital anti HPV6 VLP IgG 4 week 8 4 Genital anti HPV6 VLP IgA week Rectal Vaginal Oral Aerosol Nasal s.c. Rectal Vaginal Oral Aerosol Nasal s.c. x 5ug VLP weeks 0,,
8 - Nasal - Aerosol-like NALT.. and swallowed (oral) NALT + inhaled and swallowed (oral Efficient VLP presentation in Tracheobronchial Lymph nodes Balmelli et al. J. Virol. 00
9 log 0 titers in U/mg of total IgG log 0 titers in U/mg of total IgA log 0 titers log 0 titers Aerosol and nasal vaccination of mice with HPV6 VLPs and mucosal adjuvants Serum anti-hpv6 VLP IgG titers *** ** CT + HLT + HLT + CpG + CpG Aerosol-like Nasal Aerosol-like Nasal Vaginal anti-hpv6 VLP IgG titers Vaginal anti-hpv6 VLP IgA titers CT : cholera toxin an efficient but toxic mucosal adjuvant 4 *** 4 ** *** HLT : a natural non-toxic E. coli heat labile enterotoxin CpG: a TLR-9 agonist can act as + CT + HLT + HLT + CT + HLT Aerosol-like Nasal Aerosol-like Nasal + HLT systemic and mucosal adjuvant
10 IgG Titer (Log 0 ) Mucosal vaccination of mice with HPV6 VLPs and CT Serum anti-hpv6 VLP IgG titers week CT : cholera toxin an efficient but toxic mucosal adjuvant Rectal Vaginal Oral Aerosol Rectal Vaginal Oral Aerosol
11 Normalized IgG titers (log 0 ) IgG Titer (log 0 ) IgG Titer (log 0 ) Rectal and vaginal vaccination of mice with adjuvanted HPV6 VLPs Rectal immunization Serum anti-hpv6 VLP IgG Vaginal immunization Serum anti-hpv6 VLP IgG 5 CT : cholera toxin an efficient but toxic mucosal 4 4 adjuvant (5mg) IM: Immiquimod a TLR 7 agonist (5%, 500mg) CT IM RS MPL Genital anti-hpv6 VLP 4 IgG IgA CT IM RS MPL N9 4 Genital anti-hpv6 VLP IgG IgA RS: Resiquimod a TLR 7/8 agonist (75mg) MPL: monophosphoryl lipid A (Salmonella) a TLR4 agonist (from GSK, 0mg) N9: nonoxynol-9, a known 0 CT IM RS MPL CT IM RS MPL 0 disrupter of vaginal epithelium (4%)
12 Normalized IgG + IgA titers (log 0 ) Normalized IgG + IgA titers (log 0 ) Induction of anti-hpv6 VLPs in Feces and Saliva FECES anti-hpv6 VLP IgA + IgG SALIVA anti-hpv6 VLP IgG + IgA CT RS CT CT rectal aerosol oral CT RS CT aerosol rectal oral
13 Secreted Alkaline Phosphatase (SEAP) HPV Pseudovirus In Vitro Neutralization Assay Gold Standard for Quantitating Potentially Protective VLP Abs SEAP SV40 Ori Y Neutralizing Antibodies Y SEAP SV40 Ori Infection Genome Amplifies & Transcribes T Ag 9TT Cells in 96-well plate X T Ag No Infection SEAP SEAP SEAP SEAP SEAP Days No SEAP Collect Sups and Assay Alkaline Phosphatase D. Pastrana et al Virol 004; :05-6
14 Neutralizing Titer (log 0 ) HPV6 neutralizing titers in genital secretions Aer+CT R+CT Aer R+RS Vag+N9 x SC
15 Antobody in genital secretions vary along the estrus cycle s.c. immunization on MICE Aerosol like immunization in MICE anti-hpv6 IgG titers genital secretions anti-hpv6 IgG + IgA titers ovulation ovulation
16 Purified Human papillomavirus Virus-like particles = VLPs as SUBUNIT Vaccines HPV6 VLPs purified from insect cells infected with a HPV6 L recombinant baculovirus GMP preparations available for clinical trial through the National Cancer Institute of the NIH, USA Drs. John Schiller and Douglas Lowy
17 Anti-HPV6 VLPs IgG in cervical secretion of women i.m. vaccinated with purified HPV6 VLPs (from NCI/NIH-Novavax) IgG titer IgG titer wo w4 w8 w9 w9.5 w0 w0.5 w w.5 w w.5 w w.5 : sampling of serum and cervical secretions group I : women under oral contraception : 50mg HPV6 VLP group II: ovulating women anti-hpv6 VLPs IgG titers in cervical secretion All women had detectable specific IgG in their cervical secretions Days of contraceptive cycle Days before and after ovulation High variations throughout ovulating cycles (9-fold decrease during ovulation) Nardelli Haefliger et al. J.Natl. Cancer Inst. 00
18 Anti-HPV6 VLPs IgG in cervical secretion of women i.m. vaccinated with purified HPV6 VLPs (NCI/NIH-Novavax) Women under oral contraception Women during ovulation p= Specific IgG titers in cervical secretions represent - 0 % of the serum titers (women under contraception). During ovulation, specific IgG are lower than those in women under oral contraception However very low Antibody levels are sufficient to afford protection i.e. full protection since 8.5 years.
19 In a PsV Vaginal Challenge Assay: sera with undetectable neutralizing antibodies provided protection Gardasil Intramuscular Sera: 4hours 0, 4, 8 wks Luciferase Intravaginal HPV6PsV luc 48 hours Ivag Luciferin Control Protected mice Longet et al, 0
20 Needle free administration in female volunteers? - Nasal - Aerosol-like NALT.. and swallowed (oral) NALT + inhaled and swallowed (oral Efficient VLP presentation in Tracheobronchial Lymph nodes Balmelli et al. J. Virol. 00
21 Nasal and aerosol immunization in female volunteers wo w w.5 w6 w8 Safety and immunogenicity of nasal spray or aerosol vaccination with purified HPV6 VLP (NCI/NIH-Novavax) was examined : group I= mg HPV6 VLP group II = 50mg HPV6 VLP group III = 50mg HPV6 VLP nasal spray (De Vilbis) aerosol (Nebulizer) Nardelli -Haefliger et al. Vaccine 005
22 Anti-HPV6 VLPIgs in U/mg of total Igs Anti-HPV6 VLP IgG and IgA in cervical secretions 000 IgG 000 IgA Nasal Aerosol Nasal Aerosol Nardelli -Haefliger et al. Vaccine 005 aerosol vaccination may represent an alternative to i.m. injections. Need further optimalization Raise security concerns (inflammation, allergies..?)
23 SALMONELLA/HPV6 VLP prophylactic vaccine Vaccination HPV DNA L gene Salmonella Plasmid
24 VLP assembly in the bacteria? HPV6 VLP in attenuated Salmonella PhoPc HPV6 VLP subunits/capsomeres) in vaccine strain Tya Nardelli-Haefliger et al nm Fraillery et al. 007
25 Combined Vaccines HPV6/8/typhoïde Pre-clinical results in a murine model: HPV6 neutralizing Ab in genital secretions HPV8 neutralizing Ab in genital secretions Tya/ HPV6 Vaccin VLP 6 x injections i.m Tya/ HPV8 Phase I trial with oral doses (d0, d, d4 with TyHPV6 + Ty HPV8) under preparation in India (Indian immunological ltd)
26 Conclusion In MICE: - HPV VLPs alone are highly immunogenic by aerosol immunization - efficient antibody responses in genital and oral secretions - CT/HLT but not CpG are efficient adjuvant for nasal/aerosol immunization - Rectal immunization can be adjuvanted by TLR7/8 agonist - Vaginal immunization used with 4% N9 lead to efficient antibody responses - HPV VLP can assemble/expose neutralizing immunogenic epitopes in Salmonella for oral vaccine - In HUMAN - Aerosol immunization is effective - Systemic immunization lead to transudating IgG in genital secretions that vary along the estrus cycle
27 Dr. Schiller J. Dr. Lowy D. National Cancer Inst.-NIH Washington USA Dr. J. Benyacoub Dr. C. Balmelli Dr. D. Baud Dr. D. Fraillery Dr. V. Revaz Dr. D. Wirthner Dr. F. Lurati Dr. F. Spertini Dr. P. DeGrandi ONCOSUISSE
A Live-Attenuated HSV-2 ICP0 2 Virus Elicits 10 to 100 Times Greater Protection against Genital Herpes than a Glycoprotein D Subunit Vaccine
A Live-Attenuated HSV-2 ICP0 2 Virus Elicits 10 to 100 Times Greater Protection against Genital Herpes than a Glycoprotein D Subunit Vaccine William P. Halford*, Ringo Püschel, Edward Gershburg, Andrew
More informationTransgenic plants: A new biopharmaceutical manufacturing platform
Transgenic plants: A new biopharmaceutical manufacturing platform Rachel K. Chikwamba 1, Hugh S. Mason 1, Richard Mahoney 2 and Charles J. Arntzen 1 1 - Center for Infectious Disease and 2 - Vaccinology
More information1 R01 AI IHD HALFORD, W
1 R01 AI108635-01 2 IHD 1R01AI108635-01 ILLIAM DESCRIPTION (provided by applicant): More than 20 years have been invested into the testing of herpes simplex virus 2 (HSV-2) subunit vaccines that contain
More informationCustom Antibodies Services. GeneCust Europe. GeneCust Europe
GeneCust Europe Laboratoire de Biotechnologie du Luxembourg S.A. 2 route de Remich L-5690 Ellange Luxembourg Tél. : +352 27620411 Fax : +352 27620412 Email : info@genecust.com Web : www.genecust.com Custom
More informationRecommendations to assure the quality, safety and efficacy of recombinant human papillomavirus virus-like particle vaccines
ENGLISH ONLY EXPERT COMMITTEE ON BIOLOGICAL STANDARDIZATION Geneva, 12 to 16 October 2015 Recommendations to assure the quality, safety and efficacy of recombinant human papillomavirus virus-like particle
More informationDeveloping a MAPS vaccine against Salmonella Typhi and Paratyphi
Developing a MAPS vaccine against Salmonella Typhi and Paratyphi 10th International Conference on Typhoid and Other Invasive Salmonelloses April 6, 2017 Kampala, Uganda Yingjie Lu, PhD Rick Malley, MD
More informationThe World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.
The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration
More informationHSV-2 therapeutic vaccine program. Subunit vaccine candidates
HSV-2 therapeutic vaccine program Subunit vaccine candidates Our HSV-2 vaccine program Therapeutic subunit vaccine T-cell-based Aim: Best-in-class antigens by engineering Excellent standing (Sept 2017):
More informationModulation of Immune Response in Lambs
Modulation of Immune Response in Lambs A.S. Leaflet R1473 Jose O. Lopez Virella, graduate research assistant, M. L. Kaeberle, professor, veterinary microbiology Mamadou Niang, graduate research assistant.
More informationThe current status of vaccine development for control of Salmonella Paratyphi A
The current status of vaccine development for control of Salmonella Paratyphi A Rodney Carbis (Head Vaccine Development, IVI) 9 th International Conference on Typhoid and Invasive NTS Disease Bali Indonesia
More informationCOMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE
The European Agency for the Evaluation of Medicinal Products Evaluation of Medicines for Veterinary Use CVMP/IWP/07/98-FINAL COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES
More informationIssues in production of viral gene transfer vectors. Stefan Kochanek Department of Gene Therapy Ulm University
Issues in production of viral gene transfer vectors Stefan Kochanek Department of Gene Therapy Ulm University Only few positive results in gene therapy so far - many early phase, few late phase clinical
More informationBiosafety and the NIH Guidelines
Biosafety and the NIH Guidelines This section will explore: Why the NIH Guidelines are important The definition of recombinant or synthetic nucleic acid research Content of the NIH Guidelines Section III
More informationHow can innovation in regulatory science inform the regulatory process to facilitate the development of new vaccines?
How can innovation in regulatory science inform the regulatory process to facilitate the development of new vaccines? Marion F. Gruber, Ph.D. Office of Vaccines Research and Review CBER/FDA Global Vaccine
More informationPassive vaccination as a global strategy for preventing RSV disease in infants. Filip Dubovsky MD MPH FAAP MedImmune March 2016
Passive vaccination as a global strategy for preventing RSV disease in infants Filip Dubovsky MD MPH FAAP MedImmune March 2016 Outline for Presentation Rationale for passive immunization for RSV prophylaxis
More informationIdentification of Human Papillomavirus Type 16 L1 Surface Loops Required for Neutralization by Human Sera
JOURNAL OF VIROLOGY, May 2006, p. 4664 4672 Vol. 80, No. 10 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.10.4664 4672.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Identification
More informationPan-HSV-2 IgG Antibody in Vaccinated Mice and Guinea Pigs Correlates with Protection against Herpes Simplex Virus 2
Pan-HSV-2 IgG Antibody in Vaccinated Mice and Guinea Pigs Correlates with Protection against Herpes Simplex Virus 2 William P. Halford*, Joshua Geltz, Edward Gershburg Department of Microbiology and Immunology,
More informationLichenase fusions improve immunological properties of antigens
Lichenase fusions improve immunological properties of antigens Konstantin Musiychuk Center for Molecular Biotechnology, Fraunhofer USA 03/27/2012 Lichenase Hydrolysis site of β-glycans Structure of the
More informationIBC protocol Risk Assessment and Determination of NIH Guidelines
IBC protocol Risk Assessment and Determination of NIH Guidelines The following are points to consider when reviewing all protocols for risk, recommended containment conditions, and determine applicable
More informationOmniAb. Naturally optimized human antibodies
OmniAb Naturally optimized human antibodies Transgenic animals for hmab discovery Only company to offer three platforms Patented technology with freedom to operate V L V H C C H 1 hinge C H 2 C H 3 2 28
More informationBL-7040: Oligonucleotide for Inflammatory Bowel Disease
BL-7040: Oligonucleotide for Inflammatory Bowel Disease December 2012 Forward Looking Statements This presentation contains "forward-looking statements." These statements include words like "may," "expects,"
More informationGene Therapy for Cystic Fibrosis Lung Disease MTERMS 2012
Gene Therapy for Cystic Fibrosis Lung Disease MTERMS 2012 Gene Medicine Group: Oxford University Deborah Gill Steve Hyde UK Cystic Fibrosis Gene Therapy Consortium Edinburgh University To develop a clinical
More informationBiomarkers, Early Prediction of Vaccine Efficacy and Safety
Biomarkers, Early Prediction of Vaccine Efficacy and Safety Giuseppe Pantaleo, M.D. Professor of Medicine Head, Division of Immunology and Allergy Executive Director, Swiss Vaccine Research Institute Lausanne
More informationNew generation typhoid conjugate vaccine for preventing typhoid disease TEAM BHARAT
(Typhoid Vi Capsular Polysaccharide-Tetanus Toxoid Conjugate Vaccine) New generation typhoid conjugate vaccine for preventing typhoid disease TEAM BHARAT Introduction This disease is common in many developing
More informationCriteria For Choosing a Virus-Like Display Platform
Criteria For Choosing a Virus-Like Display Platform Immunogenicity Potential Antigen Display Potential Production Potential Intellectual Property Issues Immunogenicity Potential Particulate - uptake by
More informationMicrobial Biotechnology agustin krisna wardani
Microbial Biotechnology agustin krisna wardani 1. The Structure of Microbes Microbes (microorganisms) are tiny organisms that are too small to be seen individually by the naked eye and must be viewed with
More informationQuality Control in Biotechnology. Andrew Lees, Ph.D. Scientific Director Fina BioSolutions LLC.
Quality Control in Biotechnology Andrew Lees, Ph.D. Scientific Director Fina BioSolutions LLC www.finabio.com Fina Chemical drugs vs Biologicals Chemical drugs can be precisely defined Physical chemical
More informationPassive Immunization Trials to Inform Vaccine Design
Passive Immunization Trials to Inform Vaccine Design Points for Consideration from deliberations held at the August 8, 2014 workshop Contents I. Introduction... 2 II. Types of trials... 2 1. Therapeutic
More informationChapter 2. Antibodies
Chapter 2. Antibodies An iddy-biddy antibody Just nanometers long Saved the butt of a sumo man Hundreds of kilos strong Anonymous The main elements of the immune system are firstly antibodies, secondly
More informationReceived 17 July 2001/Returned for modification 15 October 2001/Accepted 6 November 2001
INFECTION AND IMMUNITY, Mar. 2002, p. 1056 1068 Vol. 70, No. 3 0019-9567/02/$04.00 0 DOI: 10.1128/IAI.70.3.1056 1068.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Transcutaneous
More informationGuideline on immunogenicity assessment of monoclonal antibodies intended for in vivo clinical use.
1 2 3 18 November 2010 EMA/CHMP/BMWP/86289/2010 Committee for Medicinal Products for Human Use (CHMP) 4 5 6 Guideline on immunogenicity assessment of monoclonal antibodies intended for in vivo clinical
More informationNeutralization of Bovine Papillomavirus by Antibodies
JOURNAL OF VIROLOGY, Nov. 1994, P. 7570-7574 0022-538X/94/$04.00+0 Copyright 1994, American Society for Microbiology Vol. 68, No. 11 Neutralization of Bovine Papillomavirus by Antibodies to Li and L2 Capsid
More informationProtein homology. Antigens & Antibodies I. Administrative issues:
Administrative issues: Recommended text: Goldsby/Kuby Immunology, 6th edition (Note that Innate Immunity is not adequately covered in the 5th edition.) Text book reading assignments are to supplement the
More informationRecombinant Antibody Production in Therapeutic Antibody Projects. Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016
Recombinant Antibody Production in Therapeutic Antibody Projects Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016 Presentation Outline 1 2 3 4 5 Introduction Recombinant Ab Production
More informationStrategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
More informationFDA Perspectives On Viral & Vector Shedding Studies. Daniel Takefman, Ph.D. Chief, Gene Therapy Branch FDA/CBER ICH Workshop: October 31, 2007
FDA Perspectives On Viral & Vector Shedding Studies Daniel Takefman, Ph.D. Chief, Gene Therapy Branch FDA/CBER ICH Workshop: October 31, 2007 Overview Define shedding studies Outline basis for need of
More informationBasic Antibody Structure. Multiple myeloma = cancerous plasma cells Monomer = 150,000. Chapter 4. Immunoglobulin Structure and Function
Chapter 4. Immunoglobulin Structure and Function. Functional Regions. Types of chains. Constant & Variable regions 4. Glycoprotein * * * Heavy chain= 446 aa Light chain= 4aa Each heavy and light chain
More informationPPTA Regulatory Workshop June 13, 2016
PPTA Regulatory Workshop June 13, 2016 DOROTY SCOTT Dr. Dorothy Scott is the Branch Chief for the Laboratory of Plasma Derivatives, in the Office of Blood Research and Review, CBER. Her group is responsible
More informationAntibodies and Antigens in the Blood Bank 9/7/2015 NAHLA BAKHAMIS 1
Antibodies and Antigens in the Blood Bank NAHLA BAKHAMIS 9/7/2015 NAHLA BAKHAMIS 1 Outline Antibodies structure, classes and functions Most important Abs in the blood bank effective roles of Abs Zeta potential
More informationSerum Immunoglobulin A Cross-Strain Blockade of Human Noroviruses
MAJOR ARTICLE Serum Immunoglobulin A Cross-Strain Blockade of Human Noroviruses Lisa C. Lindesmith, 1 Martina Beltramello, 2 Jesica Swanstrom, 1 Taylor A. Jones, 1 Davide Corti, 2,3 Antonio Lanzavecchia,
More informationAntibody Structure. Antibodies
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationAntibody Structure supports Function
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationAssays and Strategies for Immunogenicity Assessment. Steven J Swanson, Ph.D. Executive Director, Medical Sciences Clinical Immunology, Amgen
Assays and Strategies for Immunogenicity Assessment Steven J Swanson, Ph.D. Executive Director, Medical Sciences Clinical Immunology, Amgen General Antibody Assay Strategy Correlation of clinical findings
More informationSingle and combination HSV-2 glycoprotein vaccines adjuvanted with. CPG or MPL exhibit differential immunity in animal models, but this is
CVI Accepts, published online ahead of print on 18 August 2011 Clin. Vaccine Immunol. doi:10.1128/cvi.05071-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions.
More information2008 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
[Human Vaccines 4:2, 134-142; March/April 2008]; 2008 Landes Bioscience Research Paper Evolution of type-specific immunoassays to evaluate the functional immune response to Gardasil A vaccine for human
More informationANTIBODY IMMUNOGENICITY
ANTIBODY IMMUNOGENICITY Tolerance Classical Immunity To aggegated Antibody Chiller and Weigle, PNAS, 65:551, 1970; Benjamin and Waldmann, et al, J Exp Med, 163:1539, 1986) THE IMMUNOGENICITY PROBLEM WITH
More informationCHAPTER 7 CELLULAR BASIS OF ANTIBODY DIVERSITY: CLONAL SELECTION
CHAPTER 7 CELLULAR BASIS OF ANTIBODY DIVERSITY: CLONAL SELECTION The specificity of humoral immune responses relies on the huge DIVERSITY of antigen combining sites present in antibodies, diversity which
More informationAdeno-Associated Virus titer and aggregation characterization
Adeno-Associated Virus titer and aggregation characterization Characterization of gold-labeled Adeno-Associated Virus (AAV) and other small viruses by Nanoparticle Tracking Analysis (NTA) PARTICLE CONCENTRATION
More informationAssays for Immunogenicity: Are We There Yet?
Assays for Immunogenicity: Are We There Yet? Mark Wener, MD Department of Laboratory Medicine & Rheumatology Division Department of Medicine University of Washington Seattle, WA 98195 wener@uw.edu Goals:
More informationMake Your Immunology Research Easy. Kun YIN Associate Director of Marketing Division, GenScript
Make Your Immunology Research Easy Kun YIN Associate Director of Marketing Division, GenScript GenScript Overview Branch Office Amsterdam, Netherlands Branch Office Tokyo, Japan Headquarter, New Jersey,
More informationForeign serum-induced bile duct lesion (BDL) in athymic BALBIc nude mice
Histol Histopathol (2000) 15: 463-467 http://www.ehu.es/histol-histopathol Histology and Histopathology Cellular and Molecular Biology Foreign serum-induced bile duct lesion (BDL) in athymic BALBIc nude
More informationOverview of Biologics Testing and Evaluation: Regulatory Requirements and Expectations. Audrey Chang, PhD, Senior Director Development Services
Overview of Biologics Testing and Evaluation: Regulatory Requirements and Expectations Audrey Chang, PhD, Senior Director Development Services Definition of Biologics: PHS Act, section 351 Virus, therapeutic
More informationGlobal Leader in Viral Vector Technologies
Global Leader in Viral Vector Technologies Gene Therapy Vaccines - Discovery 1 SIRION BIOTECH ANY GENE TO ANY CELL Expert for viral vectors Competitive proprietary viral vector platforms High-end enabling
More informationBiosafety Level Host Range Propagation Comments
Guidelines BSL for Commonly used Viral Vectors Version 1.0 Office of Animal Care and Institutional Biosafety (OACIB) 1737 West Polk Street (MC 672) 206 Administrative Office Building Chicago, IL 60612
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland Approved for public release; distribution unlimited
AD Award Number: W81XWH-7-1-345 TITLE: Second-Generation Therapeutic DNA Lymphoma Vaccines PRINCIPAL INVESTIGATOR: Larry W. Kwak, MD, PhD CONTRACTING ORGANIZATION: The University of Texas M. D. Anderson
More informationParticulate delivery systems for vaccination against bioterrorism agents and emerging infectious pathogens
Particulate delivery systems for vaccination against bioterrorism agents and emerging infectious pathogens Yuchen Fan 1,2 and James J. Moon 1,2,3 Bioterrorism agents that can be easily transmitted with
More informationConvoy TM Transfection Reagent
Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections
More informationAllergy Therapeutics. Preliminary results for the year ending 30 June Delivering on our strategy three areas for growth
Allergy Therapeutics Preliminary results for the year ending 30 June 2017 Delivering on our strategy three areas for growth September 2017 Disclaimer The information contained in this presentation ( Presentation
More informationLECTURE: 26 SIMPLE SEROLOGICAL LABORATORY TECHNIQUES LEARNING OBJECTIVES:
LECTURE: 26 Title SIMPLE SEROLOGICAL LABORATORY TECHNIQUES LEARNING OBJECTIVES: The student should be able to: Define the term "simple serological techniques". Describe the benefit of the use of serological
More informationDNA VACCINES FOR BIODEFENSE
DNA VACCINES FOR BIODEFENSE Lesley Dupuy, Ph.D. Principal Investigator-Contractor Molecular Virology Department Virology Division ATTRIBUTES OF DNA VACCINES Advantages Over Conventional Methods Easily
More informationCloning and Expression of Recombinant Helicobacter pylori Urease A and B Subunits as a Putative Vaccine
Cloning and Expression of Recombinant Helicobacter pylori Urease A and B Subunits as a Putative Vaccine Mohsen Karimi and Marjan Mohammadi * Dept. of Biotechnology, Pasteur Institute of Iran, Tehran, Iran
More informationZIKAVAX PARTNERSHIP. Dr Odile LEROY DCVMN Seoul 26 th September 2017
ZIKAVAX PARTNERSHIP Dr Odile LEROY DCVMN Seoul 26 th September 2017 1 Product Development Partnership THE EUROPEAN VACCINE INITIATIVE IS A PRODUC T DEVELOPMENT PARTNERSHIP WHICH AIMS TO ACCELERATE THE
More informationGuidance for Industry
Reprinted from FDA s website by EAS Consulting Group, LLC Guidance for Industry Design and Analysis of Shedding Studies for Virus or Bacteria-Based Gene Therapy and Oncolytic Products DRAFT GUIDANCE This
More informationThe presenter declare no conflict of interest This work was partly supported by Selecta Bioscience
Modulation of AAV vector dosing and avoidance of capsid immune responses via repeated co-administration of vector with rapamycin tolerogenic nanoparticles Amine Meliani The presenter declare no conflict
More informationThe past decade in malaria synthetic peptide vaccine clinical trials
Human Vaccines ISSN: 1554-8600 (Print) 1554-8619 (Online) Journal homepage: http://www.tandfonline.com/loi/khvi19 The past decade in malaria synthetic peptide vaccine clinical trials Elizabeth Nardin To
More informationCase Studies of POROS Chromatography for Use in Vaccine and Large Biomolecule Purification
Case Studies of POROS Chromatography for Use in Vaccine and Large Biomolecule Purification Rev 1 (Life Tech template) Shelly Cote Parra April 2011 Topics Introduction to POROS Chromatography Products Principles,
More informationINTERIM RESULTS AS OF MARCH 31, 2017
INTERIM RESULTS AS OF MARCH 31, 2017 1 FORWARD-LOOKING STATEMENTS This presentation includes forward-looking statements that involve risks, uncertainties and other factors, many of which are outside of
More informationSupplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
More informationTRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES. Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec.
TRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec. 15, 2013 Outline Overview of transfection TransfeX Primary/hTERT
More informationDiscovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A
Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets
More informationBaek, Kyung-min. Recombinant Protein Products Division. Ministry of Food and Drug Safety
Baek, Kyung-min Recombinant Protein Products Division Ministry of Food and Drug Safety About Ministry of Food and Drug Safety Regulation for Biosimilar Principle of Biosimilar Approach Status of Biosimilar
More informationSynAbs S.A. Driving mab innovation for the IVD & BioPharma R&D markets
SynAbs S.A. Driving mab innovation for the IVD & BioPharma R&D markets February 20, 2016 SynAbs in a nutshell (1/2) Rat monoclonal antibodies, service and catalog Innovative guinea pig monoclonals! Mouse
More informationGaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453
More informationA Level. A Level Biology. DNA Technology Questions. AQA, OCR, Edexcel. Name: Total Marks: Page 1
AQA, OCR, Edexcel A Level A Level Biology DNA Technology Questions Name: Total Marks: Page 1 Q1.(a) (i) A mutation of a tumour suppressor gene can result in the formation of a tumour. Explain how.........(2)
More informationDe-risking Vaccine Formulation Design
De-risking Vaccine Formulation Design Drug Delivery & Formulation Summit and Expo San Diego 13 June 2016 Roger H Brookes Overview Introduction TB vaccine Proof-of-Concept for antigen (H4) specific immunomodulation
More informationI mmunization is the most successful strategy to combat infectious diseases. The creation of an effective
OPEN SUBJECT AREAS: LIVE ATTENUATED VACCINES VACCINES Received 27 March 2014 Accepted 4 August 2014 Published 21 August 2014 Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances
More informationHuman Papillomavirus 52 and 52b
Techne qpcr test Human Papillomavirus 52 and 52b E6 gene 150 tests For general laboratory and research use only 1 Introduction to Human Papillomavirus 52 and 52b Papillomaviruses are a diverse group of
More information.CONCLUSIONS. There is currently no
.CONCLUSIONS There is currently no - Ideal (alternative) antimicrobial preservative (AP) for vaccines - AP gold standard for vaccines - R&D pipeline for vaccine AP Lack of selective affinity tough AET
More informationAntibody-Drug Conjugate Bioanalytical Assay Development:
Antibody-Drug Conjugate Bioanalytical Assay Development: Immunogenicity Challenges November 16, 2016 Presented by Corinna Fiorotti, Ph.D. Presentation Overview ADC Overview ADC Assays ADC Immunogenicity
More informationAdvanced Microbial Protein Expression
Advanced Microbial Protein Expression Partners for Life Advancing tomorrow s medicines w A Biologics and Vaccines CDMO partner for your complete clinical journey Good science, experience and a quality
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationImmunoglobulins. Biological Properties
Immunoglobulins Biological Properties Introduction Many important biological properties are attributed to antibodies that differ depending on isotype These include; - Neutralization of toxins - Immobilization
More informationScience & Technology Directorate
Science & Technology Directorate National Center for Zoonotic & Animal Disease Defense (ZADD) - CEEZAD COE S&T Review October 2013 Dr. Juergen Richt CEEZAD Director Washington, D.C. ZADD Overview COE Description
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationCervical Antibody Responses to a Herpes Simplex Virus Type 2 Glycoprotein Subunit Vaccine
1 Cervical Antibody Responses to a Herpes Simplex Virus Type 2 Glycoprotein Subunit Vaccine Rhoda L. Ashley, Flor-Mari Crisostomo, Michael Doss, Rose E. Sekulovich, Rae Lyn Burke, Mary Shaughnessy, Lawrence
More informationBrief Definitive Reports
Brief Definitive Reports SEROLOGIC EVIDENCE FOR ANTIGENS CONTROLLED BY THE Ir REGION IN MICE* BY D. GOTZE,:~ R. A. REISFELD, ANn J. KLEIN (From the Department of Experimental Pathology, Scripps Clinic
More informationManagement s Report on Financial Position and Operating Results. For the three months ended March 31, 2014
Management s Report on Financial Position and Operating Results For the three months ended March 31, 2014 LETTER TO SHAREHOLDERS Dear Fellow Shareholder, 2014 is off to a promising start for Immunovaccine
More informationNucleic Acid Transfection. Genomics. TransIT Transfection Tools. Technical tip D.103
The nucleic acids delivery specialists design our transfection reagents. Our formulations provide superior transfection efficiency and cell viability. This complete range includes TransIT reagents, based
More informationpfb and pfb-neo Retroviral Vectors
pfb and pfb-neo Retroviral Vectors INSTRUCTION MANUAL Catalog #217563 (pfb Retroviral Vector) and #217561 (pfb-neo Retroviral Vector) Revision A For In Vitro Use Only 217561-12 LIMITED PRODUCT WARRANTY
More informationComprehensive T cell antigen discovery using a genomic approach
Engineering Conferences International ECI Digital Archives Vaccine Technology IV Proceedings Spring 5-21-2014 Comprehensive T cell antigen discovery using a genomic approach Jessica Baker Genocea Biosciences
More informationApplications involving the ViroCyt Virus Counter in the production of various recombinant proteins
Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins Chris Kemp Kempbio, Inc. Frederick, MD USA chris.kemp@kempbioinc.com Presentation Summary Kempbio, Inc.
More informationProtein Purification Products. Complete Solutions for All of Your Protein Purification Applications
Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to
More informationMice Orally Immunized with a Transgenic Plant Expressing the Glycoprotein of Crimean-Congo Hemorrhagic Fever Virus
CLINICAL AND VACCINE IMMUNOLOGY, Dec. 2011, p. 2031 2037 Vol. 18, No. 12 1556-6811/11/$12.00 doi:10.1128/cvi.05352-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Mice Orally
More informationSerology as a Diagnostic Technique
Serology as a Diagnostic Technique Characteristics of Any Diagnostic Techniques Any useful detection strategy must be: Specific: yield a positive response for only the target organism or molecule. Sensitive:
More informationDevelopment of Multiplex Sensitive Anti-Drug Antibody Assays for CRISPR/Cas9 Gene Therapies
Development of Multiplex Sensitive Anti-Drug Antibody Assays for CRISPR/Cas9 Gene Therapies September 27, 2017 Junxia Wang editasmedicine.com 1 Overview of the presentation Immunogenicity Introduction
More informationELISA IMMUNOASSAY FOR HUMAN
Unit 6/ Module 1 /Version A pg. 1 California Lutheran University s Enriched Science (Clues) and California State University Program for Education and Research in Biotechnology (C-SUPERB) ELISA IMMUNOASSAY
More informationHPV16 E7 Oncoprotein ELISA Kit
Product Manual HPV16 E7 Oncoprotein ELISA Kit Catalog Numbers VPK- 5045 VPK- 5045-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Human papillomavirus
More information2017 Well Characterized Biological Products
2017 Well Characterized Biological Products Gene Therapy Treatments for Hemophilia A & B Process Validation Considerations in the Manufacturing of Gene Therapy Products Robert Baffi, Ph.D., MBA Executive
More informationNational Institute of Immunology, New Delhi
National Institute of Immunology, New Delhi QUOTATION INVITATION NOTICE For Website Ref: NII/AKS/GPL/2013 Date: 25/12/2013 Quotations are invited from technical firms specializing in either both or one
More information