Genetics and Genomics in Clinical Research
|
|
- Preston Griffin
- 6 years ago
- Views:
Transcription
1 Genetics and Genomics in Clinical Research An Immersion Course for Clinical Investigators at UAB Introduction and Overview Bruce R. Korf, MD, PhD
2 Goals Describe approaches to study of the genomic contributions to rare and common disorders Recognize ethical, legal, and social issues involved in design of a genomics research protocol. Describe major bioinformatic approaches used in the analysis of genomic data. Recognize opportunities to explore genomic aspects of medical problems and the resources available at UAB.
3 Schedule Monday Tuesday Wednesday Thursday Friday 7:30-8:00 Breakfast Breakfast Breakfast Breakfast Breakfast 8:00-9:00 Introduction Dr. Bruce Korf Genotyping Technologies and Copy Number Variation Analysis Dr. Fady Mikhail Dr. Greg Cooper Analysis of exome/genome sequence data Approaches to Bioinformatic Data Analysis Dr. David Crossman Genetic Linkage Analysis Dr. Hemant Tiwari 9:15-10:15 Approaches to Gene Discovery Dr. Bruce Korf Next-Generation Sequencing Dr. Mike Crowley Dr. Greg Barsh Clinical annotation of genomic data Bioinformatic Pathway and Ontology Analysis Dr. David Crossman Human Population Genetics Dr. Bruce Korf 10:30-11:30 Case Studies/ Translational Genomics Dr. Bruce Korf Lab Visit Heflin Center Core Lab Ms. Kelly East Genetic counseling based on genomic sequencing Use of Bioinformatic Databases Dr. David Crossman Genetics in Medicine Dr. Bruce Korf
4 Genetics
5 Genomics "For the newly developing discipline of mapping/sequencing (including analysis of the information) we have adopted the term GENOMICS. We are indebted to T. H. Roderick of the Jackson Laboratory, Bar Harbor, Maine, for suggesting the term. The new discipline is born from a marriage of molecular and cell biology with classical genetics and is fostered by computational science." (Victor A. McKusick and Frank H. Ruddle. A new discipline, a new name, a new journal [editorial]. Genomics 1987 Sep;1:1-2.)
6 Human Phenome Single Gene Multifactorial Pharmacogenetic Cancer
7 Genomic Approaches Level Population Family Individual Tissue/Cell Organism Approaches Case-control association study Genetic linkage study Genome sequencing Gene expression analysis, epigenetics, genome sequencing Microbiome analysis
8 Approach to Genetic Disorders
9 Hutchinson-Gilford Progeria
10 Age-related Macular Degeneration
11 Pharmacogenetics
12 Cancer Genomes Normal Tumor Sequence Difference = cancer-specific genetic changes
13 Functional Genomics
14 Microbiome
15 Autosomal Recessive
16 Metabolic Pathways gene a gene b gene c gene d enzyme a enzyme b enzyme c enzyme d A B C D E accumulation of A, B, C deficiency of D, E
17 Recessive Mechanisms
18 Autosomal Dominant
19 Penetrance
20 Age-Dependent Penetrance
21 Expressivity different modes or degrees of expression of trait in population dermal neurofibromas in NF1
22 Dominant Mechanisms
23 Mosaicism
24 X-linked Recessive
25 X-linked Dominant male transmits to all daughters, no sons
26 X-linked Dominant, Male Lethal
27 X-chromosome Inactivation
28 Genetic Heterogeneity
29 Genetic Heterogeneity
30 Allelic Heterogeneity
31 Sex-Limited Expression male pattern baldness
32 Epistasis
33 Digenic Inheritance retinitis pigmentosa heterozygosity for two genes required for phenotype neither alone is sufficient to produce phenotype encode proteins that interact with one another
34 Anticipation increasing severity from one generation to next commonly seen in triplet repeat disorders myotonic dystrophy
35 Triplet Repeat Expansion Friedreich ataxia CGG fragile X syndrome GAA CAG Huntington disease spinocerebellar ataxia GTG myotonic dystrophy CTGCTGCTG myotonic dystrophy CTGCTGCTGCTGCTGCTGCTGCTG
36 Genomic Imprinting maternal copy expressed paternal copy not expressed Imprinting: differential expression of maternal and paternal copy of a gene
37 Epigenetics
38 Maternal Inheritance
39 Mitochondrial Genetics 16 kb circular double-stranded DNA multiple copies per mitochondrion 13 subunits of mitochondrial proteins, trna s, rrna s most mitochondrial proteins encoded in nucleus fertilization heteroplasmy
40 Energy Metabolism
41 Gene Mutation
42 Copy Number Variation
43 Color Blindness
44 Gene Rearrangement
45 Philadelphia Chromosome
46 Gene Mutation
47 Point Mutations TCC CAA ATC GTC CCT CGA GTT ser gln ile val pro arg val TCC CAG ATC GTC CCT CGA GTT ser gln ile val pro arg val TCC CAA ATC CTC CCT CGA GTT ser gln ile leu pro arg val TCC CAA ATC GTC GCT CGA GTT ser gln ile val ala arg val TCC CAA ATC GTC CCT TGA GTT ser gln ile val pro stop TCC CAG AAT CGT CCC TCG AGT T ser gln asn arg pro ser ser wild type sequence silent mutation conservative mutation non-conservative mutation stop mutation frameshift mutation
48 RNA Splicing
49 Splicing Mutation
50 Mutation Rate
51 Paternal Age Effect Kong et al. Nature 2012;488:41.
52 Polymorphism vs. Variant
53 Genetic Modifiers
54 Multifactorial Inheritance Tendency to recur in families Does not follow Mendelian genetics Combination of multiple genes and/or environmental factors Contribution to wide range of common disorders
55 UAB and HudsonAlpha comprehensive academic medical center 1300 faculty genetic testing and diagnosis expertise in health care and disease biology biotech research and development 10 faculty high-throughput next generation sequencing expertise in genomics and bioinformatics
56
Gene mutation and DNA polymorphism
Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes
More informationINTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE
The Making of the The Fittest: Making of the Fittest Natural Selection Natural and Adaptation Selection and Adaptation Educator Materials TEACHER MATERIALS INTRODUCTION TO THE MOLECULAR GENETICS OF THE
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationThr Gly Tyr. Gly Lys Asn
Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human
More informationBasic Concepts of Human Genetics
Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes
More informationG+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction
More informationHuether and McCance: Understanding Pathophysiology, 5 th Edition
Huether and McCance: Understanding Pathophysiology, 5 th Edition Chapter 02: Genes and Genetic Diseases Test Bank MULTIPLE CHOICE 1. A nurse recalls the basic components of DNA are: a. Pentose sugars and
More informationFundamentals of Clinical Genomics
Fundamentals of Clinical Genomics Wellcome Genome Campus Hinxton, Cambridge, UK 17-19 January 2018 Lectures and Workshops to be held in the Rosalind Franklin Pavilion Lunch and Dinner to be held in the
More informationCodon Bias with PRISM. 2IM24/25, Fall 2007
Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationPROTEIN SYNTHESIS Study Guide
PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the
More informationNON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH
NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28
More informationMutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity.
Mutagenesis 1. Classification of mutation 2. Base Substitution 3. Insertion Deletion 4. s 5. Chromosomal Aberration 6. Repair Mechanisms Classification of mutation 1. Definition heritable change in DNA
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationGen e e n t e i t c c V a V ri r abi b li l ty Biolo l gy g Lec e tur u e e 9 : 9 Gen e et e ic I n I her e itan a ce
Genetic Variability Biology 102 Lecture 9: Genetic Inheritance Asexual reproduction = daughter cells genetically identical to parent (clones) Sexual reproduction = offspring are genetic hybrids Tendency
More informationLezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza Lezione 10: Sintesi proteica Synthesis of proteins
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationBio 311 Learning Objectives
Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,
More informationGENETICS. I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide chains wrap around each other to form a
GENETICS I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide 1. 2. 3. chains wrap around each other to form a Chains run in opposite direction known as Type of bond between the
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationBA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available
More informationSAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
More informationBiomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
More informationName_BS50 Exam 3 Key (Fall 2005) Page 2 of 5
Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table
More informationBasic Concepts of Human Genetics
Basic oncepts of Human enetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. ne pair is called sex chromosomes
More informationDNA segment: T A C T G T G G C A A A
DNA Structure, Replication, Protein Synthesis & Name Period Genetics Study Guide Chapter 12 and 13 Structure of DNA and Protein Synthesis 1. What macromolecule is coded for by genes located on DNA? Provide
More informationBeyond Mendel s Laws of Inheritance
Chapter 14. Beyond Mendel s Laws of Inheritance 1 Extending Mendelian genetics Mendel worked with a simple system peas are genetically simple most traits are controlled by a single gene each gene has only
More informationUSER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat) uthors: Klaas J. Wierenga, MD & Zhijie Jiang, P PhD
USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat)) Authors: Klaas J. Wierenga, MD & Zhijie Jiang, PhD First edition, May 2013 0 Introduction The Human Genome Clinical Annotation
More informationDISEASE DISEASE FUNCTION MAP FUNCTION MAP GENE GENE. Figure 9.15 TD Gelehrter, FS Collins, D Ginsburg. Principles of Medical Genetics
DISEASE DISEASE MAP FUNCTION MAP FUNCTION GENE GENE FUNCTIONAL CLONING POSITIONAL CLONING Figure 9.15 TD Gelehrter, FS Collins, D Ginsburg. Principles of Medical Genetics. 1997. 1 Figure 9.31 TD Gelehrter,
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationProtein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
More informationCS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
More informationRapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not
More informationTable S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationWorksheet: Mutations Practice
Worksheet: Mutations Practice There are three ways that DNA can be altered when a mutation (change in DNA sequence) occurs. 1. Substitution one base-pairs is replaced by another: Example: G to C or A to
More informationTriplet Expansion Diseases Modes of Gene<c Inheritance Sex Linkage Color Blindness Discuss Katherine Moser, WSJ aracle, on facing HunAngton Disease.
9/8/17 Week 3 Genetic Disease Detection Reviewing Gene Expression Triplet Expansion Diseases Modes of Gene
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationObserving Patterns in Inherited Traits. Chapter 11
Observing Patterns in Inherited Traits Chapter 11 Impacts, Issues: The Color of Skin Like most human traits, skin color has a genetic basis; more than 100 gene products affect the synthesis and deposition
More informationch03 Student: If a phenotype is controlled by the genotypes at two different loci the interaction of these genes is called
ch03 Student: 1. Which of the following is not a phenotypic description of allele interactions affecting the expression of traits? incomplete dominance codominance polymorphic multifactorial E. pleiotrophic
More informationDNA & DNA Replication
DNA & DNA Replication DNA Structure How did Watson and Crick contribute to our understanding of genetics? Watson and Crick developed the double helix model for DNA DNA Structure What is a double helix?
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More informationDNA Begins the Process
Biology I D N A DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells DNA Begins the Process
More informationPopulation Genetics (Learning Objectives)
Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain
More informationPhenotypic Expression & Multi-Factorial Traits (Learning Objectives)
Phenotypic Expression & Multi-Factorial Traits (Learning Objectives) Understand and explain the factors affecting the phenotypic expression of Mendelian inheritance and provide examples for each: a) Lethal
More informationProtein Synthesis. Application Based Questions
Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html
More informationThe University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Catalog Addendum
The University of Texas MD Anderson Cancer Center UTHealth 2016-2018 Catalog Addendum GSBS 2016-18 Catalog Addendum Table of Contents School Name Change... 1 Areas of Research Concentration Changes...
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationEOC Review Reporting Category 2 Mechanisms of Genetics
EOC Review Reporting Category 2 Mechanisms of Genetics The student will demonstrate an understanding of the mechanisms of genetics. Langham Creek High School 2012-2013 By PresenterMedia.com TEK 6A Identify
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationGenomic Research: Issues to Consider. IRB Brown Bag August 28, 2014 Sharon Aufox, MS, LGC
Genomic Research: Issues to Consider IRB Brown Bag August 28, 2014 Sharon Aufox, MS, LGC Outline Key genomic terms and concepts Issues in genomic research Consent models Types of findings Returning results
More informationDNA & Protein Synthesis #21
Name: Period: Date: Living Environment Lab DNA & Protein Synthesis #21 Introduction Of all the molecules that is in the body, DNA is perhaps the most important. DNA or dioxiribosenucleic acid is important
More informationPrions Other molecules besides organelle DNA are inherited in non-mendelian patterns.
Prions Other molecules besides organelle DNA are inherited in non-mendelian patterns. Examples of non-mendelian patterns of inheritance extend beyond the inheritance of organelle DNA. Certain DNA and RNA
More informationYesterday s Picture UNIT 3D
Warm-Up Predict the results of a dihybrid cross between QqHh and QqHh parents if the Q and H genes are very close together on the same chromosome. (LO 3.15) (LO 3.17) Yesterday s Picture Mitochondria
More informationDNA/RNA. Transcription and Translation
DNA/RNA Transcription and Translation Review DNA is responsible for controlling the production of proteins in the cell, which is essential to life DNA RNA Proteins Chromosomes contain several thousand
More informationProblem set questions from Exam 1 Unit Basic Genetic Tests, Setting up and Analyzing Crosses, and Genetic Mapping
Problem set questions from Exam 1 Unit Basic Genetic Tests, Setting up and Analyzing Crosses, and Genetic Mapping Basic genetic tests for complementation and/or dominance 1. You have isolated 20 new mutant
More informationPELLISSIPPI STATE COMMUNITY COLLEGE MASTER SYLLABUS
PELLISSIPPI STATE COMMUNITY COLLEGE MASTER SYLLABUS GENERAL GENETICS BIOL 2120 Class Hours: 3.0 Credit Hours: 4.0 Laboratory Hours: 3.0 Revised Spring 2017 Catalog Course Description Prerequisites Corequisites
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationClinical Genomics and NGS Bertinoro (Italy), April 29 May 4, st Course jointly organized by ESGM, ESHG AND CEUB
Clinical Genomics and NGS Bertinoro (Italy), April 29 May 4, 2018 31 st Course jointly organized by ESGM, ESHG AND CEUB Target Audience: This course is for those young professionals in Clinical and Medical
More informationIntroduction to Basic Human Genetics. Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland
Introduction to Basic Human Genetics Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Training Course in Sexual and Reproductive Health Research Geneva
More informationBiology 40S: Course Outline Monday-Friday Slot 1, 8:45 AM 9:45 AM Room 311 Teacher: John Howden Phone:
The course is designed to help students develop and demonstrate an understanding of the biological concepts of genetics and biodiversity through scientific inquiry, problem solving, personal reflection
More informationChapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome
Chapter 14 Control of Eukaryotic Genome How many genes? Genes only ~3% of human genome protein-coding sequences 1% of human genome non-protein coding genes 2% of human genome trna ribosomal RNAs sirnas
More informationMolecular Biology Primer. CptS 580, Computational Genomics, Spring 09
Molecular Biology Primer pts 580, omputational enomics, Spring 09 Starting 19 th century What do we know of cellular biology? ell as a fundamental building block 1850s+: ``DNA was discovered by Friedrich
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationAGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1
AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the
More informationBS 50 Genetics and Genomics Week of Nov 29
BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated
More informationIntroduction. Thomas Hunt Morgan. Chromosomes and Inheritance. Drosophila melanogaster
Chromosomes and Inheritance 1 4 Fig. 12-10, p. 244 Introduction It was not until 1900 that biology finally caught up with Gregor Mendel. Independently, Karl Correns, Erich von Tschermak, and Hugo de Vries
More informationDNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA 18 Lecture: DNA Structure Worksheet 19 Lecture:
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationWhat is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
More informationGENETICS: BIOLOGY HSA REVIEW
GENETICS: BIOLOGY HSA REVIEW HSA Review A. Matching: On the lines provided, write the letter of the definition of each term. a. genetics f. gamete b. trait g. probability c. hybrid h. Punnett square d.
More information4.1. Genetics as a Tool in Anthropology
4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of
More informationAn introduction to genetics and molecular biology
An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular
More informationConifer Translational Genomics Network Coordinated Agricultural Project
Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 2 Genes, Genomes, and Mendel Nicholas Wheeler & David Harry
More informationIntroduction to Pharmacogenetics Competency
Introduction to Pharmacogenetics Competency Updated on 6/2015 Pre-test Question # 1 Pharmacogenetics is the study of how genetic variations affect drug response a) True b) False Pre-test Question # 2 Pharmacogenetic
More informationReview. 0 Genotype: alleles that are present 0 Phenotype: physical appearance. 0 If Red is dominant to white, what is the phenotype of the above?
Review 0 Genotype: alleles that are present 0 Phenotype: physical appearance 0 Rr 0 RR 0 rr 0 If Red is dominant to white, what is the phenotype of the above? 2 Vocab to Remember! 0 Allele 0 Gene 0 Trait
More informationCodon bias and gene expression of mitochondrial ND2 gene in chordates
www.bioinformation.net Hypothesis Volume 11(8) Codon bias and gene expression of mitochondrial ND2 gene in chordates Arif Uddin, Tarikul Huda Mazumder, Monisha Nath Choudhury & Supriyo Chakraborty* Department
More information6. Which nucleotide part(s) make up the rungs of the DNA ladder? Sugar Phosphate Base
DNA Unit Review Worksheet KEY Directions: Correct your worksheet using a non blue or black pen so your corrections can be clearly seen. DNA Basics 1. Label EVERY sugar (S), phosphate (P), and nitrogen
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More informationChapter 14: Genes in Action
Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate
More informationProblem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.
Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationFigure 1: Testing the CIT: T.H. Morgan s Fruit Fly Mating Experiments
I. Chromosomal Theory of Inheritance As early cytologists worked out the mechanism of cell division in the late 1800 s, they began to notice similarities in the behavior of BOTH chromosomes & Mendel s
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationLecture Outline 9/8/05. Question: Male-pattern baldness. Finish pedigrees for X-linked traits. Chromosomal basis of inheritance
Lecture Outline 9/8/05 Pedigree of Queen Victoria (III-2) and her descendants, showing the X-linked recessive inheritance of hemophilia Finish pedigrees for X-linked traits Several more example problems
More informationPHYSICIAN RESOURCES MAPPED TO GENOMICS COMPETENCIES AND GAPS IDENTIFIED WITH CURRENT EDUCATIONAL RESOURCES AVAILABLE 06/04/14
PHYSICIAN RESOURCES MAPPED TO GENOMICS COMPETENCIES AND GAPS IDENTIFIED WITH CURRENT EDUCATIONAL RESOURCES AVAILABLE 06/04/14 Submitted resources from physician organization representatives were mapped
More informationName Date Class. In the space at the left, write the letter of the term or phrase that best completes each statement or answers each question.
Chapter Test A CHAPTER 11 Complex Inheritance and Human Heredity Part A: Multiple Choice In the space at the left, write the letter of the term or phrase that best completes each statement or answers each
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationThis is the knowledge that you should understand upon completing this section:
DN 11 Syllabus hecklist This is the knowledge that you should understand upon completing this section: 11.1 DN DN occurs bound to proteins in chromosomes in the nucs and as unbound DN in the mitochondria.
More information