Genetics and Genomics in Clinical Research

Size: px
Start display at page:

Download "Genetics and Genomics in Clinical Research"

Transcription

1 Genetics and Genomics in Clinical Research An Immersion Course for Clinical Investigators at UAB Introduction and Overview Bruce R. Korf, MD, PhD

2 Goals Describe approaches to study of the genomic contributions to rare and common disorders Recognize ethical, legal, and social issues involved in design of a genomics research protocol. Describe major bioinformatic approaches used in the analysis of genomic data. Recognize opportunities to explore genomic aspects of medical problems and the resources available at UAB.

3 Schedule Monday Tuesday Wednesday Thursday Friday 7:30-8:00 Breakfast Breakfast Breakfast Breakfast Breakfast 8:00-9:00 Introduction Dr. Bruce Korf Genotyping Technologies and Copy Number Variation Analysis Dr. Fady Mikhail Dr. Greg Cooper Analysis of exome/genome sequence data Approaches to Bioinformatic Data Analysis Dr. David Crossman Genetic Linkage Analysis Dr. Hemant Tiwari 9:15-10:15 Approaches to Gene Discovery Dr. Bruce Korf Next-Generation Sequencing Dr. Mike Crowley Dr. Greg Barsh Clinical annotation of genomic data Bioinformatic Pathway and Ontology Analysis Dr. David Crossman Human Population Genetics Dr. Bruce Korf 10:30-11:30 Case Studies/ Translational Genomics Dr. Bruce Korf Lab Visit Heflin Center Core Lab Ms. Kelly East Genetic counseling based on genomic sequencing Use of Bioinformatic Databases Dr. David Crossman Genetics in Medicine Dr. Bruce Korf

4 Genetics

5 Genomics "For the newly developing discipline of mapping/sequencing (including analysis of the information) we have adopted the term GENOMICS. We are indebted to T. H. Roderick of the Jackson Laboratory, Bar Harbor, Maine, for suggesting the term. The new discipline is born from a marriage of molecular and cell biology with classical genetics and is fostered by computational science." (Victor A. McKusick and Frank H. Ruddle. A new discipline, a new name, a new journal [editorial]. Genomics 1987 Sep;1:1-2.)

6 Human Phenome Single Gene Multifactorial Pharmacogenetic Cancer

7 Genomic Approaches Level Population Family Individual Tissue/Cell Organism Approaches Case-control association study Genetic linkage study Genome sequencing Gene expression analysis, epigenetics, genome sequencing Microbiome analysis

8 Approach to Genetic Disorders

9 Hutchinson-Gilford Progeria

10 Age-related Macular Degeneration

11 Pharmacogenetics

12 Cancer Genomes Normal Tumor Sequence Difference = cancer-specific genetic changes

13 Functional Genomics

14 Microbiome

15 Autosomal Recessive

16 Metabolic Pathways gene a gene b gene c gene d enzyme a enzyme b enzyme c enzyme d A B C D E accumulation of A, B, C deficiency of D, E

17 Recessive Mechanisms

18 Autosomal Dominant

19 Penetrance

20 Age-Dependent Penetrance

21 Expressivity different modes or degrees of expression of trait in population dermal neurofibromas in NF1

22 Dominant Mechanisms

23 Mosaicism

24 X-linked Recessive

25 X-linked Dominant male transmits to all daughters, no sons

26 X-linked Dominant, Male Lethal

27 X-chromosome Inactivation

28 Genetic Heterogeneity

29 Genetic Heterogeneity

30 Allelic Heterogeneity

31 Sex-Limited Expression male pattern baldness

32 Epistasis

33 Digenic Inheritance retinitis pigmentosa heterozygosity for two genes required for phenotype neither alone is sufficient to produce phenotype encode proteins that interact with one another

34 Anticipation increasing severity from one generation to next commonly seen in triplet repeat disorders myotonic dystrophy

35 Triplet Repeat Expansion Friedreich ataxia CGG fragile X syndrome GAA CAG Huntington disease spinocerebellar ataxia GTG myotonic dystrophy CTGCTGCTG myotonic dystrophy CTGCTGCTGCTGCTGCTGCTGCTG

36 Genomic Imprinting maternal copy expressed paternal copy not expressed Imprinting: differential expression of maternal and paternal copy of a gene

37 Epigenetics

38 Maternal Inheritance

39 Mitochondrial Genetics 16 kb circular double-stranded DNA multiple copies per mitochondrion 13 subunits of mitochondrial proteins, trna s, rrna s most mitochondrial proteins encoded in nucleus fertilization heteroplasmy

40 Energy Metabolism

41 Gene Mutation

42 Copy Number Variation

43 Color Blindness

44 Gene Rearrangement

45 Philadelphia Chromosome

46 Gene Mutation

47 Point Mutations TCC CAA ATC GTC CCT CGA GTT ser gln ile val pro arg val TCC CAG ATC GTC CCT CGA GTT ser gln ile val pro arg val TCC CAA ATC CTC CCT CGA GTT ser gln ile leu pro arg val TCC CAA ATC GTC GCT CGA GTT ser gln ile val ala arg val TCC CAA ATC GTC CCT TGA GTT ser gln ile val pro stop TCC CAG AAT CGT CCC TCG AGT T ser gln asn arg pro ser ser wild type sequence silent mutation conservative mutation non-conservative mutation stop mutation frameshift mutation

48 RNA Splicing

49 Splicing Mutation

50 Mutation Rate

51 Paternal Age Effect Kong et al. Nature 2012;488:41.

52 Polymorphism vs. Variant

53 Genetic Modifiers

54 Multifactorial Inheritance Tendency to recur in families Does not follow Mendelian genetics Combination of multiple genes and/or environmental factors Contribution to wide range of common disorders

55 UAB and HudsonAlpha comprehensive academic medical center 1300 faculty genetic testing and diagnosis expertise in health care and disease biology biotech research and development 10 faculty high-throughput next generation sequencing expertise in genomics and bioinformatics

56

Gene mutation and DNA polymorphism

Gene mutation and DNA polymorphism Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes

More information

INTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE

INTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE The Making of the The Fittest: Making of the Fittest Natural Selection Natural and Adaptation Selection and Adaptation Educator Materials TEACHER MATERIALS INTRODUCTION TO THE MOLECULAR GENETICS OF THE

More information

Lecture 11: Gene Prediction

Lecture 11: Gene Prediction Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are

More information

Thr Gly Tyr. Gly Lys Asn

Thr Gly Tyr. Gly Lys Asn Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human

More information

Basic Concepts of Human Genetics

Basic Concepts of Human Genetics Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes

More information

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores. 1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction

More information

Huether and McCance: Understanding Pathophysiology, 5 th Edition

Huether and McCance: Understanding Pathophysiology, 5 th Edition Huether and McCance: Understanding Pathophysiology, 5 th Edition Chapter 02: Genes and Genetic Diseases Test Bank MULTIPLE CHOICE 1. A nurse recalls the basic components of DNA are: a. Pentose sugars and

More information

Fundamentals of Clinical Genomics

Fundamentals of Clinical Genomics Fundamentals of Clinical Genomics Wellcome Genome Campus Hinxton, Cambridge, UK 17-19 January 2018 Lectures and Workshops to be held in the Rosalind Franklin Pavilion Lunch and Dinner to be held in the

More information

Codon Bias with PRISM. 2IM24/25, Fall 2007

Codon Bias with PRISM. 2IM24/25, Fall 2007 Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

PROTEIN SYNTHESIS Study Guide

PROTEIN SYNTHESIS Study Guide PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the

More information

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28

More information

Mutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity.

Mutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity. Mutagenesis 1. Classification of mutation 2. Base Substitution 3. Insertion Deletion 4. s 5. Chromosomal Aberration 6. Repair Mechanisms Classification of mutation 1. Definition heritable change in DNA

More information

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis 1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons

More information

Gen e e n t e i t c c V a V ri r abi b li l ty Biolo l gy g Lec e tur u e e 9 : 9 Gen e et e ic I n I her e itan a ce

Gen e e n t e i t c c V a V ri r abi b li l ty Biolo l gy g Lec e tur u e e 9 : 9 Gen e et e ic I n I her e itan a ce Genetic Variability Biology 102 Lecture 9: Genetic Inheritance Asexual reproduction = daughter cells genetically identical to parent (clones) Sexual reproduction = offspring are genetic hybrids Tendency

More information

Lezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi

Lezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza Lezione 10: Sintesi proteica Synthesis of proteins

More information

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction

More information

Bio 311 Learning Objectives

Bio 311 Learning Objectives Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,

More information

GENETICS. I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide chains wrap around each other to form a

GENETICS. I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide chains wrap around each other to form a GENETICS I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide 1. 2. 3. chains wrap around each other to form a Chains run in opposite direction known as Type of bond between the

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane

More information

BA, BSc, and MSc Degree Examinations

BA, BSc, and MSc Degree Examinations Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available

More information

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves

More information

Biomolecules: lecture 6

Biomolecules: lecture 6 Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized

More information

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table

More information

Basic Concepts of Human Genetics

Basic Concepts of Human Genetics Basic oncepts of Human enetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. ne pair is called sex chromosomes

More information

DNA segment: T A C T G T G G C A A A

DNA segment: T A C T G T G G C A A A DNA Structure, Replication, Protein Synthesis & Name Period Genetics Study Guide Chapter 12 and 13 Structure of DNA and Protein Synthesis 1. What macromolecule is coded for by genes located on DNA? Provide

More information

Beyond Mendel s Laws of Inheritance

Beyond Mendel s Laws of Inheritance Chapter 14. Beyond Mendel s Laws of Inheritance 1 Extending Mendelian genetics Mendel worked with a simple system peas are genetically simple most traits are controlled by a single gene each gene has only

More information

USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat) uthors: Klaas J. Wierenga, MD & Zhijie Jiang, P PhD

USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat) uthors: Klaas J. Wierenga, MD & Zhijie Jiang, P PhD USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat)) Authors: Klaas J. Wierenga, MD & Zhijie Jiang, PhD First edition, May 2013 0 Introduction The Human Genome Clinical Annotation

More information

DISEASE DISEASE FUNCTION MAP FUNCTION MAP GENE GENE. Figure 9.15 TD Gelehrter, FS Collins, D Ginsburg. Principles of Medical Genetics

DISEASE DISEASE FUNCTION MAP FUNCTION MAP GENE GENE. Figure 9.15 TD Gelehrter, FS Collins, D Ginsburg. Principles of Medical Genetics DISEASE DISEASE MAP FUNCTION MAP FUNCTION GENE GENE FUNCTIONAL CLONING POSITIONAL CLONING Figure 9.15 TD Gelehrter, FS Collins, D Ginsburg. Principles of Medical Genetics. 1997. 1 Figure 9.31 TD Gelehrter,

More information

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

Supplementary Information. Construction of Lasso Peptide Fusion Proteins Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Protein Synthesis Making Proteins

Protein Synthesis Making Proteins Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not

More information

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

Table S1. Bacterial strains (Related to Results and Experimental Procedures) Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)

More information

II 0.95 DM2 (RPP1) DM3 (At3g61540) b

II 0.95 DM2 (RPP1) DM3 (At3g61540) b Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111

More information

Worksheet: Mutations Practice

Worksheet: Mutations Practice Worksheet: Mutations Practice There are three ways that DNA can be altered when a mutation (change in DNA sequence) occurs. 1. Substitution one base-pairs is replaced by another: Example: G to C or A to

More information

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Observing Patterns in Inherited Traits. Chapter 11

Observing Patterns in Inherited Traits. Chapter 11 Observing Patterns in Inherited Traits Chapter 11 Impacts, Issues: The Color of Skin Like most human traits, skin color has a genetic basis; more than 100 gene products affect the synthesis and deposition

More information

ch03 Student: If a phenotype is controlled by the genotypes at two different loci the interaction of these genes is called

ch03 Student: If a phenotype is controlled by the genotypes at two different loci the interaction of these genes is called ch03 Student: 1. Which of the following is not a phenotypic description of allele interactions affecting the expression of traits? incomplete dominance codominance polymorphic multifactorial E. pleiotrophic

More information

DNA & DNA Replication

DNA & DNA Replication DNA & DNA Replication DNA Structure How did Watson and Crick contribute to our understanding of genetics? Watson and Crick developed the double helix model for DNA DNA Structure What is a double helix?

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum

More information

DNA Begins the Process

DNA Begins the Process Biology I D N A DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells DNA Begins the Process

More information

Population Genetics (Learning Objectives)

Population Genetics (Learning Objectives) Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain

More information

Phenotypic Expression & Multi-Factorial Traits (Learning Objectives)

Phenotypic Expression & Multi-Factorial Traits (Learning Objectives) Phenotypic Expression & Multi-Factorial Traits (Learning Objectives) Understand and explain the factors affecting the phenotypic expression of Mendelian inheritance and provide examples for each: a) Lethal

More information

Protein Synthesis. Application Based Questions

Protein Synthesis. Application Based Questions Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html

More information

The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Catalog Addendum

The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Catalog Addendum The University of Texas MD Anderson Cancer Center UTHealth 2016-2018 Catalog Addendum GSBS 2016-18 Catalog Addendum Table of Contents School Name Change... 1 Areas of Research Concentration Changes...

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

EOC Review Reporting Category 2 Mechanisms of Genetics

EOC Review Reporting Category 2 Mechanisms of Genetics EOC Review Reporting Category 2 Mechanisms of Genetics The student will demonstrate an understanding of the mechanisms of genetics. Langham Creek High School 2012-2013 By PresenterMedia.com TEK 6A Identify

More information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC

More information

Genomic Research: Issues to Consider. IRB Brown Bag August 28, 2014 Sharon Aufox, MS, LGC

Genomic Research: Issues to Consider. IRB Brown Bag August 28, 2014 Sharon Aufox, MS, LGC Genomic Research: Issues to Consider IRB Brown Bag August 28, 2014 Sharon Aufox, MS, LGC Outline Key genomic terms and concepts Issues in genomic research Consent models Types of findings Returning results

More information

DNA & Protein Synthesis #21

DNA & Protein Synthesis #21 Name: Period: Date: Living Environment Lab DNA & Protein Synthesis #21 Introduction Of all the molecules that is in the body, DNA is perhaps the most important. DNA or dioxiribosenucleic acid is important

More information

Prions Other molecules besides organelle DNA are inherited in non-mendelian patterns.

Prions Other molecules besides organelle DNA are inherited in non-mendelian patterns. Prions Other molecules besides organelle DNA are inherited in non-mendelian patterns. Examples of non-mendelian patterns of inheritance extend beyond the inheritance of organelle DNA. Certain DNA and RNA

More information

Yesterday s Picture UNIT 3D

Yesterday s Picture UNIT 3D Warm-Up Predict the results of a dihybrid cross between QqHh and QqHh parents if the Q and H genes are very close together on the same chromosome. (LO 3.15) (LO 3.17) Yesterday s Picture Mitochondria

More information

DNA/RNA. Transcription and Translation

DNA/RNA. Transcription and Translation DNA/RNA Transcription and Translation Review DNA is responsible for controlling the production of proteins in the cell, which is essential to life DNA RNA Proteins Chromosomes contain several thousand

More information

Problem set questions from Exam 1 Unit Basic Genetic Tests, Setting up and Analyzing Crosses, and Genetic Mapping

Problem set questions from Exam 1 Unit Basic Genetic Tests, Setting up and Analyzing Crosses, and Genetic Mapping Problem set questions from Exam 1 Unit Basic Genetic Tests, Setting up and Analyzing Crosses, and Genetic Mapping Basic genetic tests for complementation and/or dominance 1. You have isolated 20 new mutant

More information

PELLISSIPPI STATE COMMUNITY COLLEGE MASTER SYLLABUS

PELLISSIPPI STATE COMMUNITY COLLEGE MASTER SYLLABUS PELLISSIPPI STATE COMMUNITY COLLEGE MASTER SYLLABUS GENERAL GENETICS BIOL 2120 Class Hours: 3.0 Credit Hours: 4.0 Laboratory Hours: 3.0 Revised Spring 2017 Catalog Course Description Prerequisites Corequisites

More information

RNA and PROTEIN SYNTHESIS. Chapter 13

RNA and PROTEIN SYNTHESIS. Chapter 13 RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from

More information

Clinical Genomics and NGS Bertinoro (Italy), April 29 May 4, st Course jointly organized by ESGM, ESHG AND CEUB

Clinical Genomics and NGS Bertinoro (Italy), April 29 May 4, st Course jointly organized by ESGM, ESHG AND CEUB Clinical Genomics and NGS Bertinoro (Italy), April 29 May 4, 2018 31 st Course jointly organized by ESGM, ESHG AND CEUB Target Audience: This course is for those young professionals in Clinical and Medical

More information

Introduction to Basic Human Genetics. Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland

Introduction to Basic Human Genetics. Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Introduction to Basic Human Genetics Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Training Course in Sexual and Reproductive Health Research Geneva

More information

Biology 40S: Course Outline Monday-Friday Slot 1, 8:45 AM 9:45 AM Room 311 Teacher: John Howden Phone:

Biology 40S: Course Outline Monday-Friday Slot 1, 8:45 AM 9:45 AM Room 311 Teacher: John Howden   Phone: The course is designed to help students develop and demonstrate an understanding of the biological concepts of genetics and biodiversity through scientific inquiry, problem solving, personal reflection

More information

Chapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome

Chapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome Chapter 14 Control of Eukaryotic Genome How many genes? Genes only ~3% of human genome protein-coding sequences 1% of human genome non-protein coding genes 2% of human genome trna ribosomal RNAs sirnas

More information

Molecular Biology Primer. CptS 580, Computational Genomics, Spring 09

Molecular Biology Primer. CptS 580, Computational Genomics, Spring 09 Molecular Biology Primer pts 580, omputational enomics, Spring 09 Starting 19 th century What do we know of cellular biology? ell as a fundamental building block 1850s+: ``DNA was discovered by Friedrich

More information

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain

More information

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the

More information

BS 50 Genetics and Genomics Week of Nov 29

BS 50 Genetics and Genomics Week of Nov 29 BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated

More information

Introduction. Thomas Hunt Morgan. Chromosomes and Inheritance. Drosophila melanogaster

Introduction. Thomas Hunt Morgan. Chromosomes and Inheritance. Drosophila melanogaster Chromosomes and Inheritance 1 4 Fig. 12-10, p. 244 Introduction It was not until 1900 that biology finally caught up with Gregor Mendel. Independently, Karl Correns, Erich von Tschermak, and Hugo de Vries

More information

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA 18 Lecture: DNA Structure Worksheet 19 Lecture:

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function

What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen

More information

GENETICS: BIOLOGY HSA REVIEW

GENETICS: BIOLOGY HSA REVIEW GENETICS: BIOLOGY HSA REVIEW HSA Review A. Matching: On the lines provided, write the letter of the definition of each term. a. genetics f. gamete b. trait g. probability c. hybrid h. Punnett square d.

More information

4.1. Genetics as a Tool in Anthropology

4.1. Genetics as a Tool in Anthropology 4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of

More information

An introduction to genetics and molecular biology

An introduction to genetics and molecular biology An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular

More information

Conifer Translational Genomics Network Coordinated Agricultural Project

Conifer Translational Genomics Network Coordinated Agricultural Project Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 2 Genes, Genomes, and Mendel Nicholas Wheeler & David Harry

More information

Introduction to Pharmacogenetics Competency

Introduction to Pharmacogenetics Competency Introduction to Pharmacogenetics Competency Updated on 6/2015 Pre-test Question # 1 Pharmacogenetics is the study of how genetic variations affect drug response a) True b) False Pre-test Question # 2 Pharmacogenetic

More information

Review. 0 Genotype: alleles that are present 0 Phenotype: physical appearance. 0 If Red is dominant to white, what is the phenotype of the above?

Review. 0 Genotype: alleles that are present 0 Phenotype: physical appearance. 0 If Red is dominant to white, what is the phenotype of the above? Review 0 Genotype: alleles that are present 0 Phenotype: physical appearance 0 Rr 0 RR 0 rr 0 If Red is dominant to white, what is the phenotype of the above? 2 Vocab to Remember! 0 Allele 0 Gene 0 Trait

More information

Codon bias and gene expression of mitochondrial ND2 gene in chordates

Codon bias and gene expression of mitochondrial ND2 gene in chordates www.bioinformation.net Hypothesis Volume 11(8) Codon bias and gene expression of mitochondrial ND2 gene in chordates Arif Uddin, Tarikul Huda Mazumder, Monisha Nath Choudhury & Supriyo Chakraborty* Department

More information

6. Which nucleotide part(s) make up the rungs of the DNA ladder? Sugar Phosphate Base

6. Which nucleotide part(s) make up the rungs of the DNA ladder? Sugar Phosphate Base DNA Unit Review Worksheet KEY Directions: Correct your worksheet using a non blue or black pen so your corrections can be clearly seen. DNA Basics 1. Label EVERY sugar (S), phosphate (P), and nitrogen

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon

More information

Chapter 14: Genes in Action

Chapter 14: Genes in Action Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate

More information

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below. Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Figure 1: Testing the CIT: T.H. Morgan s Fruit Fly Mating Experiments

Figure 1: Testing the CIT: T.H. Morgan s Fruit Fly Mating Experiments I. Chromosomal Theory of Inheritance As early cytologists worked out the mechanism of cell division in the late 1800 s, they began to notice similarities in the behavior of BOTH chromosomes & Mendel s

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Lecture Outline 9/8/05. Question: Male-pattern baldness. Finish pedigrees for X-linked traits. Chromosomal basis of inheritance

Lecture Outline 9/8/05. Question: Male-pattern baldness. Finish pedigrees for X-linked traits. Chromosomal basis of inheritance Lecture Outline 9/8/05 Pedigree of Queen Victoria (III-2) and her descendants, showing the X-linked recessive inheritance of hemophilia Finish pedigrees for X-linked traits Several more example problems

More information

PHYSICIAN RESOURCES MAPPED TO GENOMICS COMPETENCIES AND GAPS IDENTIFIED WITH CURRENT EDUCATIONAL RESOURCES AVAILABLE 06/04/14

PHYSICIAN RESOURCES MAPPED TO GENOMICS COMPETENCIES AND GAPS IDENTIFIED WITH CURRENT EDUCATIONAL RESOURCES AVAILABLE 06/04/14 PHYSICIAN RESOURCES MAPPED TO GENOMICS COMPETENCIES AND GAPS IDENTIFIED WITH CURRENT EDUCATIONAL RESOURCES AVAILABLE 06/04/14 Submitted resources from physician organization representatives were mapped

More information

Name Date Class. In the space at the left, write the letter of the term or phrase that best completes each statement or answers each question.

Name Date Class. In the space at the left, write the letter of the term or phrase that best completes each statement or answers each question. Chapter Test A CHAPTER 11 Complex Inheritance and Human Heredity Part A: Multiple Choice In the space at the left, write the letter of the term or phrase that best completes each statement or answers each

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

This is the knowledge that you should understand upon completing this section:

This is the knowledge that you should understand upon completing this section: DN 11 Syllabus hecklist This is the knowledge that you should understand upon completing this section: 11.1 DN DN occurs bound to proteins in chromosomes in the nucs and as unbound DN in the mitochondria.

More information