Gene-silencing oligonucleotides: Innovative design of oligonucleotides with enhanced efficacy and RNAilike mechanism of action
|
|
- Baldwin Whitehead
- 6 years ago
- Views:
Transcription
1 Gene-silencing oligonucleotides: Innovative design of oligonucleotides with enhanced efficacy and RNAilike mechanism of action Nicola La Monica, Ekambar R. Kandimalla, Sudhir Agrawal Idera Pharmaceuticals, Inc. 167 Sidney Street, Cambridge MA 2139 USA EuroTIDES 211 Berlin, November 211
2 Nucleic Acids Therapeutics: Over Three Decades of research 2
3 Gene Silencing Approaches Antisense (1978) sirna (1992) Synthetic RNA or DNA Synthetic RNA No length-dependent activity Backbone modifications permissible Naked delivery mer optimal for activity Limited modifications permissible Lipid-based delivery RNase H mediated Ago/Dicer mediated Immune activation and off- target effects Immune activation and off- target effects 3
4 Gene Silencing Approaches Antisense (1978) sirna (1992) Synthetic RNA or DNA Synthetic RNA No length-dependent activity Backbone modifications permissible Naked delivery mer optimal for activity Limited modifications permissible Lipid-based delivery RNase H mediated Ago/Dicer mediated Immune activation and off- target effects Immune activation and off- target effects 4
5 Design of Gene-Silencing Oligo (GSO) Synthetic DNA or RNA TLRmediated immune response is mitigated due to 5 end inaccessibility Phosphorothioate modification provides stability Systemic delivery without lipid formulation 19 and 21-mer show optimal gene-silencing activity 5
6 Chemistry of GSO GSO Structure Linker Synthetic DNA or RNA PO or PS backbone O - S O OH S - P O O P O O 6
7 GSO has Optimal Activity with 19-mer Arms Antisense 5 GSO MyD88 RNA (R.Q.).8.4 MyD88 RNA (R.Q.).8.4. PBS 15 - mer 17 - mer 19 - mer 21 - mer 23 - mer 25 - mer Length of Oligo. PBS 15-mer 17-mer 19-mer 21-mer 23-mer 25-mer Length of Oligo J774 cell culture, 48 hr incubation 7
8 5 RLM-RACE Analysis: Comparison of sirna and GSO cleavage products 5 RLM-RACE Assay Harvest RNA 48hr post transfection Predicted sirna cleavage site Perform RNA-Linker-Mediated Rapid Amplification of cdna ends (RLM-RACE) 5 GSO or sirna RNA linker RNA ligation Sequence amplified cleavage products 5 cdna synthesis 1 st PCR 2 nd PCR 8
9 sirna and RNA GSO have similar cleavage products MyD88 Target sequence 5 -GCAGGCTGCTA GAGCTGCTGGCCTT..- Expected Cleavage Site Target sequence sirna cleavage product 5 -GCAGGCTGCTA GAGCTGCTGGCCTT AGTAGAAA GAGCTGCTGGCCTT..- RNA GSO cleavage product 2 -O-Me GSO 5 - AGTAGAAA GAGCTGCTGGCCTT..- No Cleavage Product AGTAGAAA - Linker 9
10 DNA GSOs induce cleavage of target mrna at multiple sites MyD88 Target sequence 5 -GCAGGCTGCTA GAGCTGCTGGCCTT..- Expected Cleavage Site Target sequence 19-mer sirna 5 -GCAGGCTGCTA GAGCTGCTGGCCTT AGTAGAAA GAGCTGCTGGCCTT AGTAGAAA GGAGTACTGGCCTT mer DNA GSO Control DNA with --linkage 5 - GTAGAAA AGAGCTGCTGGCCTT GGAAGAAAGAAGGAGTAAAGGCCTT..- No Cleavage Product AGTAGAAA - Linker GGA - Unmatched/ambiguous sequence 1
11 Insights into Structure-Activity Relationship Studies of GSOs Progress to Date: Comparative Activity of GSO and Antisense Affinity of GSO and Antisense to the target RNA Requirement of 19-mer arms of GSOs Effect of mis-matches in each arm of GSO Do the 19-mer arms need to be the same Effect of presence of 5 -phosphate on the activity of GSO Effect of linker on the activity of GSO 11
12 GSO has greater gene silencing activity than Antisense Oligonucleotide (ASO) GSO GSO ASO 5 Antisense oligonucleotide (ASO) % Inhibition of MyD88 RNA µg/ml 1 µg/ml J774 cell culture, 48 hr incubation 12
13 GSO and ASO have similar affinity to target mrna 7 T m, o C 6 5 GSO ASO 4 15-mer 17-mer 19-mer 21-mer 23-mer 25-mer Length of Oligo T m with target RNA 13
14 GSOs require Two 19mer Arms for Optimal Activity mer mer mer mer mer % Inhibition of Protein mer J774 cell culture, 3 µg/ml, 48 hr incubation 14
15 Requirement of 19-mer arms of GSOs in vivo mer mer % Inhibition of induced IL mer mer mer mer GSO, s.c. 24 hr 2 hr TLR Agonist, s.c. Serum IL-12 Analysis 15
16 Mismatches in GSO sequence result in loss of activity 25 GSO 1XmmGSO 2XmmGSO GSO X X X X X 1Xmm GSO % Inhibition of Protein X X X X X X X X X X 2Xmm GSO -1 MyD88 p38 PBS GSO 1Xmm 2Xmm GSO GSO X = mismatch nucleotide J774 cells: 1 µg/ml, 48 hr incubation 16
17 Effect of Presence of 5 -phosphate on the Activity of GSO One phosphate One phosphate Two phosphate Two phosphates % Inhibition of MyD88 RNA µg/ml 1 µg/ml J774 cell culture, 48 hr incubation 17
18 Do the 19-mer Arms Need to Be the Same DNA/DNA GSO DNA/DNA GSO RNA/DNA GSO 2'-OMe RNA/ 2'-OMe RNA GSO RNA/DNA GSO DNA RNA DNA % Inhibition of MyD88 RNA OMe RNA/2 -OMe RNA GSO 2 -OMe RNA -1 1 µg/ml J774 cell culture, 48 hr incubation 18
19 Length Dependent In Vivo Activity of GSO Length of MyD88 GSO 17-mer 19-mer 21-mer 23-mer 25-mer % Inhibition of IL-12 induction
20 GSO has greater activity than ASO in Vivo 12 % Inhibition of IL-12 induction Dose, mg/kg 24 hr 2 hr Serum IL-12 Analysis GSO, s.c. TLR Agonist, s.c. 2
21 Comparative Duration of Activity of GSO and ASO in vivo 12 % Inhibition of IL-12 induction Post Administration, Days 24 hr 2 hr Serum IL-12 Analysis GSO, s.c. TLR Agonist, s.c. 21
22 GSOs Mitigate Immune Responses Examples of Sequences Evaluated Bcl2 antisense GSO 5 -TCTCCCAGCGTGCGCCAT- -TACCGCGTGCGACCCTCT-X-TCTCCCAGCGTGCGCCAT- H-ras antisense 5 -TCCGTCATCGCTCCTCAGG- C-raf antisense 5 -TCCCGCCTGTGACATGCAT- PKC-a antisense 5 -GTTCTCGCTGGTGAGTTTC- Jahrsdorfer B et al. 22. J. Leuk. Biol. 72: 83 ; Cunnigham, C.C et al. 21. Cancer, 92: 1265 O Dawyer, P.J. et al. Clin. Cancer Res. 5: 3977; Nemunaitis, J. et al. 1999, J. Clin. Oncol. 17:
23 GSOs Mitigate Immune Responses Cytokine/Chemokine, pg/ml Cytokine/chemokine, pg/ml bcl2 PBS Antisense GSO C-raf Cytokine/chemokine, pg/ml Cytokine/chemokine, pg/ml H-ras PBS Antisense GSO PKC-α IL-1α IL-1β IL-2 IL-4 IL-5 IL-6 IL-12 IP-1 KC MCP-1 MIG MIP-1α TNF-α PBS Antisense GSO PBS Antisense GSO Serum Cytokine Analysis 2 hr 1 mg/kg GSO or Antisense, s.c. 23
24 GSOs Targeted to ApoB GSO 7.5 and 15 mg/kg, BIW, s.c Day Collect blood for plasma cholesterol assessment Sacrifice mice for liver mrna and protein levels, and blood for plasma cholesterol Collect blood for plasma cholesterol recovery assessment LDL-c 24
25 GSOs Targeted to ApoB Suppression of ApoB mrna Suppression of ApoB Protein % Change in liver mrna expression compared to PBS control GSO, mg/kg % 7% P <.5 vs PBS % Reduction of ApoB 1 protein ApoB 1 p38 GSO, mg/kg PBS PBS GSO 7.5 mg/kg 15 mg/kg 25
26 GSO Targeted to ApoB Reduction of Cholesterol PBS 7.5 mg/kg 15 mg/kg Serum TC, mg/dl Normal level of cholesterol Animals on high fat diet Dosing period Day P <.5 vs PBS 26
27 GSO is Specific for ApoB mrna At day 22 % Change in mrna expression compared to PBS control ApoB ABCA1 ABCG1 LXR 7% 15 mg/kg dose group 27
28 Anti-miR-21 GSO specifically silences target micro RNA µg/ml Anti-miR-21 GSO Mismatched GSO RNA GSO 2'-OMe-RNA GSO 2'-OMe-RNA AS % change in mir-21 RNA levels % Inhibition of mir HCT-116 cells 28
29 Design of Gene-Silencing Oligo (GSO) Synthetic DNA or RNA TLRmediated immune response is mitigated due to 5 end inaccessibility Phosphorothioate modification provides stability 19 and 21-mer show optimal gene-silencing activity Similar cleavage product as sirna Systemic delivery without lipid formulation 29
30 Gene Silencing Technologies Antisense GSO sirna Synthetic RNA or DNA Synthetic RNA or DNA Synthetic RNA No length-dependent activity Modification of backbone permissible Lipid carrier not required for delivery RNase H mediated Immune activation/ offtarget effect mer optimal for activity Modification of backbone permissible Lipid carrier not required for delivery Ago/Dicer and RNase H mediated No TLR9-mediated Immune Activation mer optimal for activity Limited modifications permissible Lipid-based delivery Ago/Dicer mediated Immune activation/ offtarget effect 3
31 Acknowledgements Lakshmi Bhagat Daqing Wang Michael J. Reardon Victoria Philbin Melissa Precopio Fugang Zhu Dong Yu Mallik Putta Tao Lan Irek Nowak The Idera Team 31
Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing
Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing Mark Behlke MD, PhD Chief Scientific Officer February 24, 2016 1 Implementing CRISPR/Cas9 gene editing 2 To focus on RNA
More informationTIDES 2014 GalNAc-siRNA with Enhanced Stabilization Chemistry: ESC-GalNAc-siRNA. May 14, 2014 Muthiah Manoharan
TIDES 2014 GalNAc-siRNA with Enhanced Stabilization Chemistry: ESC-GalNAc-siRNA May 14, 2014 Muthiah Manoharan Agenda sirna-galnac Conjugates: Background Standard Template Chemistry (STC)» Human POC of
More informationTopical sirna for management of androgenic alopecia and oily skin Quark Pharmaceuticals, Inc.
Topical sirna for management of androgenic alopecia and oily skin 1 2017 Quark Pharmaceuticals, Inc. About Quark Founded in 1993; privately held Late stage pharmaceutical company with 2 Phase 3 programs,
More informationOLIGONUCLEOTIDE ANALOGUES: FROM SUPRAMOLECULAR PRINCIPLES TO BIOLOGICAL PROPERTIES
PL1 Oligonucleotide Analogues 21 OLIGONUCLEOTIDE ANALOGUES: FROM SUPRAMOLECULAR PRINCIPLES TO BIOLOGICAL PROPERTIES Damian ITTIG, Dorte RENNEBERG, David VONLANTHEN, Samuel LUISIER and Christian J. LEUMANN*
More informationStrategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationExon Skipping. Wendy Erler Patient Advocacy Wave Life Sciences
Exon Skipping Wendy Erler Patient Advocacy Wave Life Sciences Forward Looking Statements This document contains forward-looking statements. All statements other than statements of historical facts contained
More informationTherapeutic RNA delivery
Therapeutic RNA delivery 05/02/2017 TIDES Dr. Adrien Weingärtner Head of Technology Development Forward looking statements THE INFORMATION CONTAINED IN THIS PRESENTATION IS BEING SUPPLIED AND COMMUNICATED
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationSafety Assessment of Oligonucleotide Constructs. Scott P. Henry, VP, Preclinical Development, Isis Pharmaceuticals, Inc., USA
Safety Assessment of ligonucleotide Constructs Scott P. Henry, VP, Preclinical Development, Isis Pharmaceuticals, Inc., USA Drug Development of 2 ME AS Platform Technology 2 Platform technologies offer
More informationArtificial Nucleic Acids -Their Developments and Recent Applications
Artificial Nucleic Acids -Their Developments and Recent Applications Bioorganic Chemistry Laboratory D2 Kenichiro Ito Organic Seminar 2012/5/7 1 Nucleic acids play central roles in life Replication Transcription
More informationUse of Antisense Oligonucleotides for the Treatment of Inheritable Rare Disorders. C. Frank Bennett Isis Pharmaceuticals
Use of Antisense ligonucleotides for the Treatment of Inheritable Rare Disorders C. Frank Bennett Isis Pharmaceuticals Agenda Review different antisense strategies Delivery of oligonucleotides to the skin,
More informationCell type-specific delivery of sirnas with aptamer-sirna chimeras
Cell type-specific delivery of sirnas with aptamer-sirna chimeras Sullenger, B. A. et al Duke Center for Translational Research, Duke University Nature Biotechnology, 2006, 24, 1005 Julia Vargas November
More informationBL-7040: Oligonucleotide for Inflammatory Bowel Disease
BL-7040: Oligonucleotide for Inflammatory Bowel Disease December 2012 Forward Looking Statements This presentation contains "forward-looking statements." These statements include words like "may," "expects,"
More informationConfirming the RNAi-mediated mechanism of action of sirna-based cancer therapeutics in mice
Related Commentary, page 438 Technical advance Confirming the RNAi-mediated mechanism of action of sirna-based cancer therapeutics in mice Adam D. Judge, Marjorie Robbins, Iran Tavakoli, Jasna Levi, Lina
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationmir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
More informationsirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
More informationConvoy TM Transfection Reagent
Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections
More informationApplication of RNA Interference to Anti-Doping. Matthew Fedoruk, Ph.D. Gene & Cell Doping Symposium 2013, Beijing, China
Application of RNA Interference to Anti-Doping Matthew Fedoruk, Ph.D. Gene & Cell Doping Symposium 2013, Beijing, China From Plants to Worms to Humans: Discovery and Mechanism of RNAi Alnylam Pharmaceuticals
More informationWelcome to R&D Day! Christine Lindenboom VP, Investor Relations & Corporate Communications
Welcome to R&D Day! Christine Lindenboom VP, Investor Relations & Corporate Communications 1 Alnylam Forward Looking Statements This presentation contains forward-looking statements, within the meaning
More informationGalina Gabriely, Ph.D. BWH/HMS
Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered
More informationalphagen Co., Ltd. Akimitsu Hirai President & CEO
alphagen Co., Ltd. Akimitsu Hirai President & CEO www.alphagen.jp 1 Company Profile Name of Company: alphagen Co., Ltd. Foundation: February, 2004 Head Office: Management: Technologies: Company Capitalization:
More informationRNA Interference (RNAi) (see also sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.) April 3, 2007 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by anti-sense
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationCustom RNAi Services. GeneCust Europe. GeneCust Europe
GeneCust Europe Laboratoire de Biotechnologie du Luxembourg S.A. 2 route de Remich L-5690 Ellange Luxembourg Tél. : +352 27620411 Fax : +352 27620412 Email : info@genecust.com Web : www.genecust.com Custom
More informationOptimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University
Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University my background Undergraduate Degree computer systems engineer (ASU
More informationAssay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
More informationDrug Metabolism and Pharmacokinetic (DMPK) Properties of sirna-galnac Conjugates
Drug Metabolism and Pharmacokinetic (DMPK) Properties of sirna-galnac Conjugates Anshul Gupta, Lead Scientist DSM, Alnylam Pharmaceuticals, Cambridge, MA DIA/FDA Oligonucleotide Based Therapeutic Conference,
More informationRNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.) April 8, 2008 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationCRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
More informationRNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation
RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss
More informationin vivo-jetpei DNA & sirna delivery reagent
in vivo-jetpei DNA & sirna Delivery Protocol Company Information... 2 Product Information... 3 In vivo Delivery Protocol... 5 1. Reagents required... 5 2. Recommended amount of nucleic acid and injection
More informationNanotechnology: A Brief History and Its Convergence with Medicine. Weston Daniel, PhD Director of Program Management
Nanotechnology: A Brief History and Its Convergence with Medicine Weston Daniel, PhD Director of Program Management Outline Introduction The Nanoscale Applications Realization of a Vision There s Plenty
More informationDesign of Noninflammatory Synthetic sirna Mediating Potent Gene Silencing in Vivo
ARTICLE doi:10.1016/j.ymthe.2005.11.002 Design of Noninflammatory Synthetic sirna Mediating Potent Gene Silencing in Vivo Adam D. Judge, Gurneet Bola, Amy C.H. Lee, Ian MacLachlan,* Protiva Biotherapeutics,
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationSilencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna
Catalog #: Various Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna General Product Details and User Information Refer to page
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationREGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes
REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationsirna delivery systems: lipoplexes vs. polyplexes
sirna delivery systems: lipoplexes vs. polyplexes Preeti Yadava College of Pharmacy, University of Florida, Gainesville, Florida GPEN 2006 What is RNA interference? RNAi is the natural process of sequencespecific,
More informationsirna Transfection Reagent
Description RiboJuice 0.3 ml 71115-3 1.0 ml 71115-4 Description RiboJuice efficiently delivers small interfering RNA (sirna) into a wide range of mammalian cell lines for targeted gene suppression (1).
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationTherapeutic RNA editing by Axiomer editing oligonucleotides
Therapeutic RN editing by xiomer editing oligonucleotides Forward looking statements This presentation contains forward-looking statements that involve substantial risks and uncertainties. ll statements,
More informationSupplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
More informationGene Therapy for Cystic Fibrosis Lung Disease MTERMS 2012
Gene Therapy for Cystic Fibrosis Lung Disease MTERMS 2012 Gene Medicine Group: Oxford University Deborah Gill Steve Hyde UK Cystic Fibrosis Gene Therapy Consortium Edinburgh University To develop a clinical
More informationWhat s the difference? Challenges in pre-clinical development of biologics
Biologics vs Small MW NCEs What s the difference? Challenges in pre-clinical development of biologics Peter Lloyd Joint Conference of EU Human Pharmacological Societies and 20 th Anniversary of AGAH 31
More informationLearning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
More informationTumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene
More informationRNA Interference and the World of Small RNAs
RNA Interference and the World of Small RNAs O, I die, Horatio; The potent poison quite o'er-crows my spirit: I cannot live to hear the news from England; But I do prophesy the election lights On Fortinbras:
More informationAlt-R CRISPR-Cas9 system:
Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research
More informationSupplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer
Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer containing 10% serum The data error bars indicate means
More informationUpdates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines)
Updates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) Jacqueline Corrigan-Curay, J.D. M.D. Acting Director Office of Biotechnology Activities National Institute
More informationEnable New Experimental Possibilities with Custom RNA Synthesis
Custom RNA Synthesis Enable New Experimental Possibilities with Custom RNA Synthesis Dharmacon custom RNA synthesis enables additional experimental abilities and scientific discoveries through unique chemistry,
More informationDNA Hybridization and Detection
Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................
More informationTechnical tips Session 5
Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation
More informationSelection of Well-Tolerated GalNAc-siRNAs by Screening for RNAi-Mediated Off-Target Effects in Rodent Toxicity Studies Maja Janas, PhD, DABT
Selection of Well-Tolerated GalNAc-siRNAs by Screening for RNAi-Mediated Off-Target Effects in Rodent Toxicity Studies Maja Janas, PhD, DABT Senior Scientist, Investigative Toxicology TIDES, May 2 nd 2017
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationAntisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression
Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia
More informationProduct: Arrest-In TM Transfection Reagent for RNAi
Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationSilencing TNF-α in macrophages and dentritic cells for arthritis treatment. Chunting Ye
Silencing TNF-α in macrophages and dentritic cells for arthritis treatment Chunting Ye Biomedical Sciences Department Paul L. Foster School of Medicine Texas Tech University Health Sciences Center Targeting
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationOSWG s Role in Shaping the Regulatory Development of Oligos - A Potential Model for Moving Forward -
OSWG s Role in Shaping the Regulatory Development of Oligos - A Potential Model for Moving Forward - David H. Schubert VP, Regulatory and Quality Outline What? Background and History Who? How? OSWG Committees
More informationSupplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More information2. Sample dilution: Tissue lysate and cell lysate sample should be diluted at least 5-fold with 1x Sample Diluent Buffer.
Mouse IL-6 (Lysate) ELISA Kit Catalog No: CKM054 Size: 1 x 96 tests I. Introduction The Cell Sciences Mouse IL-6 ELISA (Enzyme-Linked Immunosorbent Assay) kit is an in vitro enzyme-linked immunosorbent
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationTranscriptional Regulation in Eukaryotes
Transcriptional Regulation in Eukaryotes Concepts, Strategies, and Techniques Michael Carey Stephen T. Smale COLD SPRING HARBOR LABORATORY PRESS NEW YORK 2000 Cold Spring Harbor Laboratory Press, 0-87969-537-4
More informationSupporting Information
Supporting Information Horie et al. 10.1073/pnas.1008499107 SI Materials and Methods ell ulture and Reagents. THP-1 cells were obtained from the American Type ell ollection. THP-1 cells were transformed
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
Brought American Society of Cytopathology Core Curriculum in Molecular Biology Brought American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationNori Feline IL-10 ELISA Kit DataSheet
IL-10, also known as human cytokine synthesis inhibitory factor (CSIF), is an anti-inflammatory cytokine that is produced by T cells, NK cells, mast cells and macrophages (1,2,3). It is capable of inhibiting
More informationImmunomodulatory oligonucleotides containing a cytosine-phosphate-2 -deoxy-7-deazaguanosine motif as potent Toll-like receptor 9 agonists
Immunomodulatory oligonucleotides containing a cytosine-phosphate-2 -deoxy-7-deazaguanosine motif as potent Toll-like receptor 9 agonists Ekambar R. Kandimalla*, Lakshmi Bhagat*, Yukui Li*, Dong Yu*, Daqing
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationSupplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to
Supplement Figure 1. Characterization of the 312.8 moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to platelets. The black line represents the 312.8 moab
More informationHCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
More informationSupplementary Data. Santiago Grijalvo and Ramón Eritja *
Supplementary Data Synthesis and in vitro Inhibition Properties of Oligonucleotide Conjugates Carrying Amphipathic Proline-rich Peptide Derivatives of the Sweet Arrow Peptide (SAP) Santiago Grijalvo and
More informationBLOCK-iT Transfection Optimization Kit
BLOCK-iT Transfection Optimization Kit Catalog no. 13750-047 Version B 27 June 2007 25-0718 User Manual ii Table of Contents Table of Contents...iii Kit Contents and Storage... v Accessory Products...vi
More informationjetcrispr RNP transfection reagent PROTOCOL
jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More informationHuman IL-10 ELISA MAX Set Deluxe
Human IL-10 ELISA MAX Set Deluxe Cat. No. 430604 (5 plates) 430605 (10 plates) 430606 (20 plates) ELISA Set for Accurate Cytokine Quantification from Cell Culture Supernatant, Serum, Plasma or Other Body
More informationMicroarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6
Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...
More informationAn improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues
An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani
More informationHuman IL-6 ELISA Kit. User Manual (Revised Dec 16, 2009) Human IL-6 ELISA Kit Protocol. (Cat#: RAY-ELH-IL6-001)
Li StarFish S.r.l. Via Cavour, 35-20063 Cernusco S/N (MI), Italy Tel. +39-02-92150794 - Fax. +39-02-92157285 info@listarfish.it -www.listarfish.it Human IL-6 ELISA Kit User Manual (Revised Dec 16, 2009)
More informationGSI Equine IL-10 ELISA Kit- Cell Lysate DataSheet
IL-10, also known as human cytokine synthesis inhibitory factor (CSIF), is an antiinflammatory cytokine that is produced by T cells, NK cells, mast cells and macrophages (1,2,3). It is capable of inhibiting
More informationSmall Interfering RNA s Molecular biology and use in therapy
Small Interfering RNA s Molecular biology and use in therapy Dr Stuart Hamilton - NHMRC Early Career Fellow Serology and Virology Division, SEALS Microbiology, Prince of Wales Hospital; School of Women
More informationMouse EGF ELISA Kit. Instruction Manual
Mouse EGF ELISA Kit 2 3 Contents Introduction 3 Reagents 3 Storage 4 Additional Materials Required 4 Reagent Preparation 4 Assay Procedure 6 Assay Procedure Summary 7 Calculation of Results 8 Specificity
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationpdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationBIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205
BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit
More information