Genomics and Gene Recognition Genes and Blue Genes

Size: px
Start display at page:

Download "Genomics and Gene Recognition Genes and Blue Genes"

Transcription

1 Genomics and Gene Recognition Genes and Blue Genes November 3, 2004

2 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles a variety of chemical environments can exist within a cell each cell type typically has a distinct pattern of gene expression (even though the same DNA) there is a significant portion of introns and intergenic space whose role is mostly unknown eukaryotic cells (nuclei) almost always contain two copies of chromosomes animal cell

3 Chromosome Structure a very long, continuous piece of DNA contains many genes, regulatory elements and other intervening nucleotide sequences the uncondensed DNA exists in a quasiordered structure inside the nucleus it wraps around histones (structural proteins) this composite material is called chromatin sheer size and diversity of regulation and functions make eukaryotic DNA very hard to annotate (1) Chromatid (2) Centromere (3) Short arm (4) Long arm.

4 Eukaryotic Genomes

5 Transcription in Eukaryotes much more complex than in prokaryotes a typical mammalian cell has 1,500 times as much DNA than the cell of E. Coli DNA wrapped around histones which limits access of transcription regulatory proteins to promoters eukaryotic transcription requires factors that can recognize the chromatin so that the transcription machinery can access promoters

6 What is Transcription Factor? transcription factor is a complex of about 10 proteins transcriptional regulation coordinates metabolic activity, cell division, embryonic development transcription start is enabled by promoters enhancers response elements

7 Promoters promoters of eukaryotic genes that encode proteins are defined by modules of short conserved sequences (e.g. TATA box, CAAT box, GC box) CAAT box is usually located around position 80 GC box usually contains sequence GGGCGG or its complement GC box is usually found upstream of housekeeping genes genes that encode proteins commonly present in all cells and essential to normal function (they are expressed at relatively stable level in all cells) sets of various sequence modules are embedded in the upstream region of genes they collectively define the promoter every (almost) eukaryotic gene has its own promoter RNA polymerase II is responsible for the transcription of the protein coding genes

8 Promoters

9 Enhancers also called upstream activation sequences, or UASs enhancers are additional regulatory sequences and they assist transcription initiation differ from promoters location of enhancers is not fixed they may be several thousand nucleotides away from the promoter sometimes downstream from the gene bidirectional sequences function in either orientation can be removed and then reinserted in a different orientation without loss of function enhancers are also evolutionarily conserved enhancers are promiscuous stimulate transcription from any nearby promoter enhancer recognition depends on transcription factors

10 Promoters and Enhancers

11 Promoter Consensus Sequences

12 Response Elements response elements are promoter modules in genes responsive to common regulation found in the promoter regions of genes whose transcription is activated in response to a sudden increase in environment temperature -> heat shock proteins toxic heavy metals -> metal response elements heat shock element sequences are recognized by a specific transcription factor (HSTF) located at about +15 from the transcription start site of genes whose expression is dramatically enhanced consensus sequence for HSE is about 14bp long and it can be in introns too

13 Regulatory Influences many genes are subject to a multiplicity of regulatory influences this is achieved via an array of regulatory elements

14 RNA Polymerases there are 3 RNA polymerases in eukaryotic proteins RNA polymerases I and II are involved in transcribing RNA molecules RNA polymerase II transcribes protein coding genes RNA polymerase II DOES NOT directly recognize promoters this task is carried out by transcription factors (e.g. TATA-binding proteins) there are at least 12 TATA associated factors that bind to the nucleotide sequence in specific order transcription initiation site starts with an initiator sequence typically about 6 nucleotides long subtle differences in transcription factors are known to exist among different cell types

15 RNA Polymerases

16 Transcription Factors majority of transcription factors are sequencespecific DNA-binding proteins recognize consensus sequences, e.g. TATA box recognize enhancers

17 DNA Looping because transcription must respond to a variety of regulatory signals, multiple proteins are essential for appropriate regulation of gene expression these regulatory proteins are the sensors of cellular circumstances how do they work? they communicate this information by binding at specific nucleotide sequences DNA is a linear molecule so there is little space for all these proteins to bind all these sites are near transcription initiation site DNA looping enables additional proteins to interact with RNA polymerase II initiation complex DNA loping expands the repertoire of transcriptional regulation mechanism

18 DNA Looping

19 Post-Transcriptional Modification of mrna transcription and translation are separated in eukaryotes transcription occurs on DNA in the nucleus translation occurs on ribosomes in the cytoplasm transcript must move from nucleus into cytoplasm on its way, pre-mrna undergoes processing this primary transcript (hnrna) is converted into mature mrna each mrna encodes ONLY ONE protein (monocistronic RNAs) in prokaryotes, some are polycistronic

20 Post-Transcriptional Processing of mrna prior to processing hnrnas are capped and poly-adenylated Capping a set of chemical alterations at the 5 end of all hnrnas Poly-adenylation the process of replacing the 3 end of an hnrna with approximately 250 A s that are NOT spelled out in the nucleotide sequence of a gene exception: histones lack poly-a tail Splicing removal of often large segments from the interior of hnrna

21 Introns and Exons most genes in higher eukaryotes are split into coding and noncoding regions coding regions exons non-coding regions introns introns are removed from the primary transcript in the process called splicing trna and rrna also get spliced!!! Example: yeast actin gene has only one intron 309bp long, after the 3 rd amino acid chicken ovalbumin gene has 8 exons and 7 introns

22 Introns and Exons mosaic molecules consisting of sequences complementary to several non-contiguous segments of the viral genome Quote from: Adenovirus amazes at Cold Spring Harbor (1977) Nature 268: The notion of the cistron, the genetic unit of function that one thought corresponded to a polypeptide chain, now must be replaced by that of a transcription unit containing regions which will be lost from the mature messenger -- which I suggest we call introns (for intragenic regions) -- alternating with regions which will be expressed -- exons. The gene is a mosaic: expressed sequences held in a matrix of silent DNA, an intronic matrix. Gilbert, W. (1978) Why genes in pieces? Nature 271: 501

23 Open Reading Frames (ORFs) predicting genes is more difficult than in prokaryotes splice sites are hard to predict detecting sufficiently long ORFs is not enough to detect a gene alternative splicing even further complicates the issue ORFs would be useful in eukaryotes ONLY if we had algorithms that could accurately predict splice sites splice sites are very hard to predict, they are tissue specific there are at least 8 different splice signals GU-AG rule is the most common introns are at least 60bp long (to be able to accommodate splicing) introns can be tens of thousands of nucleotides long exons vary in length between about 100 and 2,000bp

24 Introns and Exons

25 Introns and Exons

26 Alternative Splicing majority of eukaryotic genes appear to be processed into a single mrna, but % of human genes give rise to to more than one mrna sequence how? via alternative splicing alternative splicing depends on a cell type and environmental circumstances splicing apparatus itself is made from a variety of snrnas and several proteins variations in splice junctions may reflect specific recognition

27 Alternative Splicing

28 GC Content in Eukaryotic Genomes overall, GC content does not vary as widely as in prokaryotes however, there is a large-scale variation of GC content within eukaryotic genomes it is very important for gene recognition algorithms eukaryotic ORFs are much harder to recognize there is a useful correlation between genes, upstream promoter regions, codon choices, gene length, gene density and GC regions are involved GC rich regions are termed CpG islands and they are very underrepresented as compared to other dinucleotides within DNA sequences CpG islands occur frequently at the 5 ends of genes (-1,500 to +500) with the level of GC content as predicted by chance

29 CpG Islands

30 CpG Islands

31 CpG Islands analysis shows ~45,000 of CpG islands about half of these islands are housekeeping genes many remaining CpG islands are associated with promoters of tissue specific genes CpG islands are rarely found in gene-free regions the reasons are chemical modifications of CpG s into CpA s and TpG s transcription requires un-methylated DNA methylation and acetylation of histones help process of transcription histones lose affinity to bind DNA and thus the chromatin becomes less tightly packed the areas become more accessible to RNA polymerases

32 Codon Usage Bias every organism prefers to use some triplets over others (to code for the same amino acid) Example in yeast Arg is frequently encoded by AGA (48%) although there are four other codons (CGC, CGA, CGG, AGG) fruit flies use CGA in 33% of the cases How do they occur consequence of the abundance of trnas within the organism consequence of the avoiding of stop codons

33 Transposons insertion sequences; jumping genes mobile genetic material that can be moved from one location of a gene and be inserted at another the movement occurs due to the presence of an enzyme which is encoded within transposon itself transposase enzyme coded by one or two genes it catalyses its transposition from one part of the genome to another the enzyme genes are surrounded by repeat segments transposition conservative the number of copies of the repeat does not change replicative copy number increases transposons are more common in bacteria, but are known to exist in eukaryotes as well (~1,000 transposons in human genome)

34 Repetitive Elements many DNA regions contain repetitive sequences typically, large repetitive chunks are divided into tandemly repeated DNA repeats that are interspersed throughout the genome tandemly repeated DNA satellites minisatellites and/or microsatellites Example: 5 CTCTCTCTCT 3 sequence in which the repeat unit is CT 5 ATTCGATTCGATTCG 3 sequence; the repeat unit is ATTCG

35 Tandem Repeats Satellite DNA long, simple sequences (up to 10mbp) with skewed nucleotide compositions repeating fragments of up to 2,000bp Minisatellite DNA not so long as satellites (up to 20kbp) copies of sequences of up to 25bp Microsatellite DNA shorter than minisatellites (up to 150bp) up to 100 copies of sequences of up to 5bp (typically 2-3) TAGTAGTAGTAGTAGTAGTAG..." Example: humans, CA repeats occur once every 10,000bp make 0.5% of human genome

36 Interspersed Repeats scattered randomly throughout genomes propagated by the synthesis of an RNA intermediate - process called retrotransposition there are three steps in retrotransposition an RNA copy of the transposon is transcribed by RNA polymerase (regular transcription step) RNA copy is converted into a DNA molecule by reverse transcriptase reverse transcriptase inserts the DNA copy somewhere else in the genome reverse transcriptase may be acquired through viral infections

37 Eukaryotic Gene Density very small in the human genome: 3% of DNA codes for genes 27% of DNA are promoters, introns, and pseudogenes 70% of DNA??? often called junk DNA unique sequences repetitive sequences genes are far apart the average distance between genes is about 65,000bp in E. Coli the average distance between genes is about 120bp

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Eukaryotic Gene Structure

Eukaryotic Gene Structure Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

RNA and PROTEIN SYNTHESIS. Chapter 13

RNA and PROTEIN SYNTHESIS. Chapter 13 RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from

More information

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a true nucleus. Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

Genomes summary. Bacterial genome sizes

Genomes summary. Bacterial genome sizes Genomes summary 1. >930 bacterial genomes sequenced. 2. Circular. Genes densely packed. 3. 2-10 Mbases, 470-7,000 genes 4. Genomes of >200 eukaryotes (45 higher ) sequenced. 5. Linear chromosomes 6. On

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Chapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome

Chapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome Chapter 14 Control of Eukaryotic Genome How many genes? Genes only ~3% of human genome protein-coding sequences 1% of human genome non-protein coding genes 2% of human genome trna ribosomal RNAs sirnas

More information

CHAPTER 13 LECTURE SLIDES

CHAPTER 13 LECTURE SLIDES CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

Protein Synthesis. OpenStax College

Protein Synthesis. OpenStax College OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will

More information

CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS

CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS A. Promoters and Polymerases (RNA pols): 1. General characteristics - Initiation of transcription requires a. Transcription factors

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

Molecular Genetics Student Objectives

Molecular Genetics Student Objectives Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Name Class Date. Practice Test

Name Class Date. Practice Test Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.

More information

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

More information

Chapter 24: Promoters and Enhancers

Chapter 24: Promoters and Enhancers Chapter 24: Promoters and Enhancers A typical gene transcribed by RNA polymerase II has a promoter that usually extends upstream from the site where transcription is initiated the (#1) of transcription

More information

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin NUCLEUS Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion. Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents some linear molecules

More information

Transcription & post transcriptional modification

Transcription & post transcriptional modification Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity

More information

TRANSCRIPTION AND TRANSLATION

TRANSCRIPTION AND TRANSLATION TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.

More information

Information Readout: Transcription and Post-transcriptional Processing Translation

Information Readout: Transcription and Post-transcriptional Processing Translation Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase

More information

Gene Expression Transcription

Gene Expression Transcription Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

I. Prokaryotic Gene Regulation. Figure 1: Operon. Operon:

I. Prokaryotic Gene Regulation. Figure 1: Operon. Operon: I. Prokaryotic Gene Regulation Figure 1: Operon Operon: a) Regulatory Elements consist of an Operator that serves as the on-off switch for the genes of the operon. Also contains a promoter for the Structural

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Chapter 14: Gene Expression: From Gene to Protein

Chapter 14: Gene Expression: From Gene to Protein Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect

More information

Regulation of Gene Expression

Regulation of Gene Expression Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

RNA: Transcription and Triplet Code

RNA: Transcription and Triplet Code RNA: Transcription and Triplet Code There are Five Kinds of RNA, All of Which are Templated from DNA. The first type of RNA is trna. The "t" stands for "transfer". This RNA is the RNA that transfers amino

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Modeling of Protein Production Process by Finite Automata (FA)

Modeling of Protein Production Process by Finite Automata (FA) Modeling of Protein Production Process by Finite Automata (FA) ISSAC BARJIS 1, JOE W. YEOL 2, YEONG SOON RYU 3 Physics and Biomedical Sciences 1, Mechanical Engineering Technology 3 City University of

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome

More information

Chapter 14 Active Reading Guide From Gene to Protein

Chapter 14 Active Reading Guide From Gene to Protein Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class

More information

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora

More information

DNA Transcription. Visualizing Transcription. The Transcription Process

DNA Transcription. Visualizing Transcription. The Transcription Process DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

Matakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung. Priyambodo, M.Sc. staff.unila.ac.id/priyambodo

Matakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung. Priyambodo, M.Sc. staff.unila.ac.id/priyambodo Matakuliah Genetika (BIO612206) Jurusan Biologi FMIPA Universitas Lampung Priyambodo, M.Sc. staff.unila.ac.id/priyambodo Prokariotik Eukariotik staff.unila.ac.id/priyambodo Regulasi ekspresi gen pada

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

Click here to read the case study about protein synthesis.

Click here to read the case study about protein synthesis. Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics

More information

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

GENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

RNA metabolism. DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA.

RNA metabolism. DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA. RNA metabolism DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA http://www.youtube.com/watch?v=ovc8nxobxmq DNA dependent synthesis of RNA : production of an RNA molecule

More information

SSA Signal Search Analysis II

SSA Signal Search Analysis II SSA Signal Search Analysis II SSA other applications - translation In contrast to translation initiation in bacteria, translation initiation in eukaryotes is not guided by a Shine-Dalgarno like motif.

More information

1. Mitosis = growth, repair, asexual reproduc4on

1. Mitosis = growth, repair, asexual reproduc4on Places Muta4ons get passed on: Cell Reproduc4on: 2 types of cell reproduc4on: 1. Mitosis = growth, repair, asexual reproduc4on Photocopy machine Growth/Repair Passed on in the same body 2. Meiosis = sexual

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your

More information