DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
|
|
- Alberta Bailey
- 6 years ago
- Views:
Transcription
1
2 Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine, adenine, thymine, and cytosine) recorded using the letters G, A, T, and C. Most molecules are double-stranded helices, consisting of two long polymers of simple units called nucleotides, molecules with backbones made of alternating sugars (deoxyribose) and phosphate groups (related to phosphoric acid), with the nucleobases (G, A, T, C) attached to the sugars.
3 is well-suited for biological information storage, since the backbone is resistant to cleavage and the doublestranded structure provides the molecule with a built-in duplicate of the encoded information. The amounts of A = T, G = C, and purines = pyrimidines [Chargaff s Rule]. is a double-stranded helix with antiparallel strands [Watson and Crick]. Nucleotides in each strand are linked by 5-3 phosphodiester bonds Bases on opposite strands are linked by hydrogen bonding: A with T, and G with C
4
5 Transcription Transcription Process by which a sequence is copied to produce a complementary RNA. In other words, it is the transfer of genetic information from into RNA. Like replication, but making RNA. Beginning of the process that ultimately leads to the translation of the genetic code (via mrna) into a protein.
6 Transcription The enzyme used in transcription is RNA polymerase. There are several forms of RNA polymerase. In eukaryotes, most genes are transcribed RNA polymerase types : RNA polymerase I : it synthesizes the precursor of the 28s,18s, and 5.8s r-rna in the nucleolus RNA polymerase II : it synthesizes the precursor of m-rna in addition to srrna RNA polymerase III : it produces the small RNA including trna 5s ribosomal RNA and some snrna
7 Transcription Unlike replication, transcription does not need to build on a primer. Instead, transcription starts at a region of called a promoter. For proteincoding genes, the promoter is located a few bases 5 to (upstream from) the first base that is transcribed into RNA. Promoter sequences are very similar to each other, but not identical. If many promoters are compared, a consensus sequence can be derived. All promoters would be similar to this consensus sequence, but not necessarily identical.
8 Process of Transcription Transcription The process of transcribing a typical gene in an eukaryotic cell is divided into three phases : initiation, elongation and termination. Initiation Eukaryotic RNA polymerase does not directly recognize the core promoter sequences. Instead, a collection of proteins called transcription factors mediate the binding of RNA polymerase and the initiation of transcription. Only after certain transcription factors are attached to the promoter does the RNA polymerase bind to it. The completed assembly of transcription factors and RNA polymerase bind to the promoter, forming a transcription initiation complex. Transcription in the archaea domain is similar to transcription in eukaryotes.
9 Transcription Initiation
10 Transcription Elongation One strand of the, the template strand (or noncoding strand), is used as a template for RNA synthesis. As transcription proceeds, RNA polymerase traverses the template strand and uses base pairing complementarity with the template to create an RNA copy. Although RNA polymerase traverses the template strand from 3' 5', the coding (non-template) strand and newly formed RNA can also be used as reference points, so transcription can be described as occurring 5' 3'. This produces an RNA molecule from 5' 3', an exact copy of the coding strand (except that thymines are replaced with uracils, and the nucleotides are composed of a ribose (5-carbon) sugar where has deoxyribose (one less oxygen atom) in its sugar-phosphate backbone).[citation needed]
11 Transcription Elongation Unlike replication, mrna transcription can involve multiple RNA polymerases on a single template and multiple rounds of transcription (amplification of particular mrna), so many mrna molecules can be rapidly produced from a single copy of a gene.[citation needed] Elongation also involves a proofreading mechanism that can replace incorrectly incorporated bases. In eukaryotes, this may correspond with short pauses during transcription that allow appropriate RNA editing factors to bind. These pauses may be intrinsic to the RNA polymerase or due to chromatin structure
12 Transcription Termination Eukaryotic protein genes contain a poly-a signal located downstream of the last exon. This signal is used to add a series of adenylate residues during RNA processing. Transcription often terminates at kb downstream of the poly-a signal, but the mechanism is unclear.
13 Transcription The role of regulatory transcription factors In eukaryotes, the association between and histones prevents access of the polymerase and general transcription factors to the promoter. Histone acetylation catalyzed by HATs can relieve the binding between and histones. Although a subunit of TFIID (TAF250 in human) has the HAT activity, participation of other HATs can make transcription more efficient. The following rules apply to most (but not all) cases: 1. Binding of activators to the enhancer element recruits HATs to relieve association between histones and, thereby enhancing transcription. 2. Binding of repressors to the silencer element recruits histone deacetylases (denoted by HDs or HDACs) to tighten association between histones and.
14 Transcription Eukaryotic mrna posttranscriptional modification The mrna molecule synthesized in eukaryotic nuclei by RNA polymerase II is a collection of the precursor molecules of mrna called as heterogeneous nuclear RNA (hnrna). The primary transcription are extensively modified in the nucleus after transcription. these modification usually include : 1_5 > capping : this process is the first of the processing reaction for hnrna the cap is a 7-methylguanosine attached ( backward) to the 5 terminl end of the mrna, forming an unusual 5 _5 triphosphate linkage. the creation of the guanosine triphosphate part of the cap requires the nuclear enzyme guanylyltransferase. methylation of this terminal guanine occurs in the cytosol, and is catalyzed by guanine -7- methyltransferase.the presence of this 7-methyl guanosine triphosphate cap is very essential in starting the mrna translation later on ( i.e. protein synthesis )
15 Protein synthesis (Translation) Translation is the RNA-directed synthesis of a polypeptide Translation involves: Messenger RNA (mrna): Carries information specifying amino acid sequences of proteins from lo ribosomes. Ribosomal RNA (rrna): Plays catalytic (ribozyme) rotes and structural roles in ribosomes. Transfer RNA (trna): Serves as adapter molecule in protein synthesis; translates mrna codons into amino acids. Genetic coding codons : Genetic information is encoded as a sequence of nonoverlapping base triplets, or codons
16 This is a molecule of messenger RNA. It was made in the nucleus by transcription from a molecule. A ribosome on the rough endoplasmic reticulum attaches to the mrna molecule
17 Another trna molecule comes into place, bringing a second amino Acid. Another trna molecule brings the next amino acid into place.
18 A peptide bond joins the second and third amino acids to form a Polyoeotide chain The process continues, the poly peptide chain get longer. This continues until termination (stop) codon is reached, the poly peptide is then completed
19 References: World Wide Web ((Internet)) Student Contribution: Zaid Thabit: Collection from references about Transcription. Zubaida Hamza: Collection from references about Translation. Fajer Bashir: Made the PowerPoint presentation.
Transcription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationCHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationWhat Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More information1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationProtein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationDNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationDo you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
More informationComponents of DNA. Components of DNA. Aim: What is the structure of DNA? February 15, DNA_Structure_2011.notebook. Do Now.
Aim: What is the structure of DNA? Do Now: Explain the Hershey Chase experiment and what was its conclusion? Homework Read pp. 298 299 P.299 3,4,6.7 Do Now Paperclip Combos Material: 8 paperclips, 2 each
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationChapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix
Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning
More informationMolecular Biology of the Gene
Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationCHAPTER 22: Nucleic Acids & Protein Synthesis. General, Organic, & Biological Chemistry Janice Gorzynski Smith
CHAPTER 22: Nucleic Acids & Protein Synthesis General, rganic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 22: Nucleic Acids & Protein Synthesis Learning bjectives: q Nucleosides & Nucleo@des:
More informationDNA, RNA and Protein Synthesis
By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude
More informationDNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA 18 Lecture: DNA Structure Worksheet 19 Lecture:
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationReview? - What are the four macromolecules?
Review? - What are the four macromolecules? Lipids Carbohydrates Protein Nucleic Acids What is the monomer of nucleic acids and what do nucleic acids make up? Nucleotides; DNA and RNA 12-1 DNA DNA Stands
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationNUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
More informationFrederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria
Frederick Griffith Live Smooth Bacteria Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S Bacteria Live Smooth Bacteria Frederick Griffith Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S
More informationMolecular Genetics Student Objectives
Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationProtein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
More informationNucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationClick here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
More informationDNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling
Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between
More informationSummary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
More informationRNA Structure and the Versatility of RNA. Mitesh Shrestha
RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationInformation Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
More informationRNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.
The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,
More informationAP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review
AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationTRANSCRIPTION AND TRANSLATION
TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.
More informationBIOCHEMISTRY Nucleic Acids
BIOCHEMISTRY Nucleic Acids BIOB111 CHEMISTRY & BIOCHEMISTRY Session 17 Session Plan Types of Nucleic Acids Nucleosides Nucleotides Primary Structure of Nucleic Acids DNA Double Helix DNA Replication Types
More informationThe Molecul Chapter ar Basis 16: The M of olecular Inheritance Basis of Inheritance Fig. 16-1
he Chapter Molecular 16: he Basis Molecular of Inheritance Basis of Inheritance Fig. 16-1 dditional Evidence hat DN Is the Genetic Material It was known that DN is a polymer of nucleotides, each consisting
More informationDNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA Create Tellegami or 18 Lecture: DNA Structure
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationPre-Lab: Molecular Biology
Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More informationUNIT 4. DNA, RNA, and Gene Expression
UNIT 4 DNA, RNA, and Gene Expression DNA STRUCTURE DNA is the primary material that causes recognizable, inheritable characteristics in related groups of organisms. DNA is the GENETIC MATERIAL Contain
More informationDNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationMicrobiology: The Blueprint of Life, from DNA to protein
Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing
More informationChapter 17 Nucleic Acids and Protein Synthesis
Chapter 17 Nucleic Acids and Protein Synthesis Nucleic Acids Nucleic acids are the components that make up the genetic material DNA (deoxyribonucleic acid). DNA is a macromolecule which contains all the
More informationDNA stands for deoxyribose nucleic acid.
1 DNA stands for deoxyribose nucleic acid. DNA controls the kind of cell which is formed (i.e. muscle, blood, nerve). DNA controls the type of organism which is produced (i.e. buttercup, giraffe, herring,
More informationDNA Structure and Protein synthesis
DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making
More informationThe common structure of a DNA nucleotide. Hewitt
GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided
More informationUnit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
More information4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.
1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More information