Mechanisms of Transcription. School of Life Science Shandong University
|
|
- Oliver Wilkerson
- 6 years ago
- Views:
Transcription
1 Mechanisms of Transcription School of Life Science Shandong University
2 Ch 12: Mechanisms of Transcription 1. RNA polymerase and the transcription cycle 2. The transcription cycle in bacteria 3. Transcription in eukaryotes 4. Transcription by RNA polymerase I and III in eukaryotes
3 Transcription of DNA into RNA
4 1. RNA polymerase and the transcription cycle 1.1 RNA polymerases come in different forms but share many features RNA polymerases performs essentially the same reaction in all cells; Bacteria have only a single RNA polymerase while in eukaryotic cells there are three: RNA Pol I, II and III RNA Pol II is the focus of eukaryotic transcription, because it is responsible for transcribing most genes, essentially all protein-encoding genes
5 RNA Pol I transcribes the large ribosomal RNA precursor gene RNA Pol III transcribes trna gene, some small nuclear RNA genes and the 5S rrna genes
6
7 Comparison of the crystal structures of prokaryotic and eukaryotic RNA polymerases ω β T. aquatics S. cerevisiae
8 1.2 Transcription by RNA polymerase proceeds in steps: initiation, elongation, and termination
9 1.3 Transcription initiation involves three defined steps Formation of a closed complex through binding of RNA polymerase to a promoter The promoter-rna polymerase complex undergoes structural changes and transits to an open complex (transcription bubble with ~14 bp [+3 to -11] separation of DNA) Initial transcription followed by promoter escape: a transcript longer than 10 nt would enable the formation of a stable ternary complex.
10 Elongation: RNA polymerase performs a range of tasks in addition to RNA synthesis: unwinds the DNA in front, re-anneals it behind, and proofreading. Only 8-9 nt remain base-paired with the DNA template Termination: Specific and well-defined DNA sequences may trigger termination
11 2. The transcription cycle in bacteria RNA polymerase holoenzyme in E. coli RNA polymerase core enzyme (α 2 ββ ω) + σ factor = holoenzyme which initiates transcription at promoters in vivo RNA polymerase holoenzyme from Thermus aquaticus
12 2.1 Bacterial promoters have certain defining features Two conserved sequences, each of 6 bp, separated by a nonspecific stretch of bp; The two defined sequences are centered, respectively, at -10 and -35 bp upstream the start site (+1);
13 Features of bacterial σ 70 promoters UP-element, Increase polymerase binding No -35, extended -10 discriminator
14 2.2 The σ factor mediates binding of polymerase to promoter σ factor The -10 and -35 regions are recognized by regions 2 and 4 of σ factor;
15 σ and α subunits recruit RNA polymerase core enzyme to the promoter αctd: C-terminal of α subunit recognize UP-element
16 2.3 Transition to the open complex involves structural changes in RNA polymerase and in the promoter DNA RNA polymerase can initiate a new RNA chain without a primer.
17 2.4 During initial transcription, RNA polymerase remains stationary and pulls downstream DNA into itself Three models for explaining the initial transcription: Kapanidis AN et al. Science 2006
18 2.5 Promoter escape involves breaking polymerasepromoter and polymerase core σ interactions: The transcript with the length of 10 or more nucleotides cannot be accommodated within the region where it hybridizes to the DNA and must start threading into the RNA exit channel. Region 3/4 linker of σ factor mimics RNA lying in the middle of the RNA exit channel, and must be ejected from that location. The ejection probably accounts for the more weak association of σ with the elongating enzyme than it is with the open complex;
19 Scrunching is reversed upon escape, the DNA unwound during scrunching is rewound, with concomitant collapse of the transcription bubble from a size of nt back down to nt; Scrunching is a way to store and mobilize energy enabling polymerase to break free of the promoter and dislodge σ factor Scrunching is reversed upon escape
20 2.6 The elongating polymerase is a processive machine that synthesizes and proofreads RNA DNA enters the polymerase between the pincers; Strand separation in the catalytic cleft; NTP addition; RNA product spooling out (Only 8-9 nt of the growing RNA remain base-paired with the DNA template at any given time) The enzyme adds one nucleotide at a time to the growing RNA transcript. DNA strand annealing in behind
21 The elongating polymerase proofreads RNA Pyrohosphorolytic ( 焦磷酸键解 )editing: RNA polymerase catalyzes the removal of an incorrectly inserted ribonucleotide by reincorporation of ppi; Hydrolytic ( 水解 )editing: the enzyme backtracks ( 后退 ) by one or more nucleotides and removes the errorcontaining sequence. This is stimulated by Gre factor, a elongation stimulation factor.
22 As 1 bp is separated ahead of the processing enzyme, 1 bp is formed behind it. Hydrolytic editing
23 2. 7 Transcription is terminated by signals within the RNA sequences: Terminators trigger the dissociation of the elongating polymerase from the DNA and release the RNA chain it has made. Terminators come in two types in bacteria Rho-dependent and Rho independent;
24 Rho-dependent terminators have ill-defined RNA elements (rut sites: ~40 nt with no secondary structure and rich in C) for Rho to work Rho factor: RNA (rut sites) binding ; ATPase, use the energy derived from ATP hydrolysis to induce termination. fails to bind any transcript being translated
25 Rho-independent termination (intrinsic terminators ): Consist of two sequence elements an inverted repeat (20 nt) followed by a stretch of about A:T base pairs; Function in the RNA rather in the DNA
26 3. Transcription in eukaryotes Comparison with transcription in Prokaryotes: Prokaryotes: one polymerase transcribes all genes Eukaryotes: three polymerases transcribe different class of genes Prokaryotes: σ factors Eukaryotes: general transcription factors (GTFs, 通用转录因子 ) are all that are required for promoter-specific transcription initiation. Additional factors including regulatory proteins, Mediator complex, and chromatin-modifying enzymes are required for in vivo initiation.
27 3.1 RNA polymerase II core promoters are made up of combinations of four different sequence elements Core promoter (40-60 bp) is the minimal set of sequence elements required for accurate transcription initiation by Pol II machinery as measured in vitro. Extending either upstream or downstream from the transcription start site (+1) Typically, a promoter includes some subset of these elements. Pol II core promoter
28 Regulatory sequences are typically upstream of core promoter, and required for efficient transcription in vivo. Can be located tens or even hundreds of kilobases from the core promoter. By binding different regulatory proteins, help (binds activators) or hinder (binds repressors) transcription from the core promoter.
29 3.2 RNA Pol II forms a pre-initiation complex with GTFs at the promoter TBP in TFIID binds to the TATA box TFIIA and TFIIB are recruited with TFIIB binding to the BRE RNA Pol II-TFIIF complex is then recruited TFIIE and TFIIH then bind upstream of Pol II to form the pre-initiation complex Promoter melting using energy from ATP hydrolysis by TFIIH
30 3.3 Promoter escape requires phosphorylation of the polymerase Tail Promoter escapes after the phosphorylation of the CTD tail tail : CTD (carboxy-terminal domain) of pol II Repeats of (Tyr-Ser-Pro-Thr-Ser-Pro-Ser).
31 3.4 Transcription initiation in vivo requires additional proteins Assembly of the pre-initiation complex in presence of Mediator, histone modifiers and nucleosome remodelers, and transcription activators Mediator
32 3.5 A new set of factors stimulate Pol II elongation and RNA proofreading Once polymerase has escaped the promoter and initiated transcription, it shifts into the elongation phase. This transition involves the Pol II enzyme shedding most of its initiation factors for example, the general transcription factors and Mediator. In their place, another set of factors is recruited. Some of these are elongation factors. Others are required for RNA processing. They are recruited to the CTD tail of the large subunit of Pol II. Phosphorylation of the CTD tail leads to an exchange of initiation factor for those factors required for elongation and RNA processing.
33 P-TEFb (a kinase stimulating elongation in 3 separate ways): Phosphorylates the serine residue at position 2 of the CTD repeats Activates hspt5, an elongator Recruits another elongator, TAT-SF1 TFIIS: Stimulates the overall rate of elongation by limiting the time that polymerase pauses; Contributes to proofreading by stimulating an inherent RNase activity in Pol II (hydrolytic editing in prokaryotes)
34 3.6 Elongating polymerase must deal with histones in its path FACT--facilitates chromatin transcription; a heterodimer of two conserved proteins: Spt16 (binds H2A/H2B dimer ) and SSRP1 (binds H3/H4 tetramer )
35 3.7 RNA processing enzymes are recruited by the CTD tail of polymerase
36 The structure and formation of the 5 RNA cap
37 3 polyadenylation CPSF--cleavage and polyadenylation specificity factor; CstF--cleavage stimulation factor
38 3.8 Models of termination: Torpedo and allosteric
39 4. Transcription by RNA polymerase I and III RNA Pol I & III recognize distinct promoters, using distinct sets of transcription factors, but still require TBP; The promoter for the rrna gene comprises a core element and a UCE (upstream control element) Accordingly, two factors, SL1 and UBF, are required for initiation besides Pol I.
40 Most Pol III promoters are found downstream of transcription start site; consisting BoxA and BoxB for trna genes or A and C for 5S rrna genes; TF III B and C are required for trna initiation, while TF III A plus are for 5S rrna
DNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationSIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat
SIBC504: TRANSCRIPTION & RNA PROCESSING Assistant Professor Dr. Chatchawan Srisawat TRANSCRIPTION: AN OVERVIEW Transcription: the synthesis of a single-stranded RNA from a doublestranded DNA template.
More informationEukaryotic & Prokaryotic Transcription. RNA polymerases
Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000
More informationTranscription in Prokaryotes. Jörg Bungert, PhD Phone:
Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating
More informationChromatographic Separation of the three forms of RNA Polymerase II.
Chromatographic Separation of the three forms of RNA Polymerase II. α-amanitin α-amanitin bound to Pol II Function of the three enzymes. Yeast Pol II. RNA Polymerase Subunit Structures 10-7 Subunit structure.
More informationEukaryotic Transcription
Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).
More informationTranscription is the first step of gene expression, in which a particular segment of DNA is copied into RNA by the enzyme, RNA polymerase.
Transcription in Bacteria Transcription in Bacteria Transcription in Bacteria Transcription is the first step of gene expression, in which a particular segment of DNA is copied into RNA by the enzyme,
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationBiochemistry Eukaryotic Transcription
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. Understand and have an overview of eucaryotic transcriptional regulation. 2. Explain
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationRNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm
RNA synthesis/transcription I Biochemistry 302 February 6, 2004 Bob Kelm Overview of RNA classes Messenger RNA (mrna) Encodes protein Relatively short half-life ( 3 min in E. coli, 30 min in eukaryotic
More informationTranscription & post transcriptional modification
Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity
More informationTranscription Regulation And Gene Expression in Eukaryotes FS 2016 Graduate Course G2 P Matthias and RG Clerc Pharmazentrum Hörsaal 2 16h15-18h00
Transcription Regulation And Gene Expression in Eukaryotes FS 2016 Graduate Course G2 P Matthias and RG Clerc Pharmazentrum Hörsaal 2 16h15-18h00 The general problem RG Clerc March 2, 2016 RNA Transcription
More informationDNA Transcription. Visualizing Transcription. The Transcription Process
DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors
More informationCLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS
CLASS 3.5: 03/29/07 EUKARYOTIC TRANSCRIPTION I: PROMOTERS AND ENHANCERS A. Promoters and Polymerases (RNA pols): 1. General characteristics - Initiation of transcription requires a. Transcription factors
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Biological information flow Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors
More informationBiological information flow
BCMB 3100 Chapters 36-38 Transcription & RNA Processing Definition of gene RNA Polymerase Gene coding vs template strand Promoter Transcription in E. coli Transcription factors mrna processing Biological
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationStructure/function relationship in DNA-binding proteins
PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationDNA Topoisomerases relieve the supercoiling stress ahead of the fork
DNA Topoisomerases relieve the supercoiling stress ahead of the fork Tw 1) T w : # of turns around the central axis 2) W r : # of times the double helix crosses itself 3) Linking Number: L k = T w + W
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationClasses of eukaryotic cellular RNAs
Classes of eukaryotic cellular RNAs ribosomal RNA (rrna) 18S (small subunit) 28S (large subunit) 5.8S (large subunit) 5S (large subunit) transfer RNA (trna) messenger RNA (mrna) heterogeneous nuclear RNA
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationRegulatory Dynamics in Engineered Gene Networks
Regulatory Dynamics in Engineered Gene Networks The Physico-chemical Foundation of Transcriptional Regulation with Applications to Systems Biology Mads Kærn Boston University Center for BioDynamics Center
More informationInformation Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationRNA metabolism. DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA.
RNA metabolism DNA dependent synthesis of RNA RNA processing RNA dependent synthesis of RNA and DNA http://www.youtube.com/watch?v=ovc8nxobxmq DNA dependent synthesis of RNA : production of an RNA molecule
More informationAnswers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.
Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish
More informationThe replication forks Summarising what we know:
When does replication occur? MBLG1001 lecture 10 Replication the once in a lifetime event! Full blown replication only occurs once, just before cell division BUT the DNA template is constantly being repaired.
More informationDNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.
DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationROLE OF A18 IN VACCINIA VIRUS POST-REPLICATIVE GENE TRANSCRIPTION TERMINATION
ROLE OF A18 IN VACCINIA VIRUS POST-REPLICATIVE GENE TRANSCRIPTION TERMINATION By APARNA MANOHARAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF
More informationChapter 31. Transcription and RNA processing
Chapter 31 Transcription and RNA processing RNA polymerase (RNAP) E. coli promoters Components of E. coli RNA Polymerase Holoenzyme (α 2 ββ'ωσ) Structure of prokaryotic RNAP The closed and open state of
More informationDifferential Gene Expression
Biology 4361 - Developmental Biology Differential Gene Expression June 18, 2009 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationChromatin and Transcription
Chromatin and Transcription Chromatin Structure Chromatin Represses Transcription Nucleosome Positioning Histone Acetylation Chromatin Remodeling Histone Methylation CHIP Analysis Chromatin and Elongation
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationThe information provided below may be useful in answering some questions.
Molecular Exam 1 More Tutorial at www.dumblittledoctor.com The information provided below may be useful in answering some questions. INFORMATION ON COMPONENTS OF RIBOSOMES I. Prokaryotes (e.g. E. coli)
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationGENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s
GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationWORKING WITH THE FIGURES. 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions?
8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationFig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm
Fig. 16-7a end Hydrogen bond end 1 nm 3.4 nm 0.34 nm (a) Key features of DNA structure end (b) Partial chemical structure end Fig. 16-8 Adenine (A) Thymine (T) Guanine (G) Cytosine (C) Concept 16.2: Many
More informationDNA Replication in Eukaryotes
OpenStax-CNX module: m44517 1 DNA Replication in Eukaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationMolecular Mechanisms of Transcription through Single-Molecule Experiments
This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes. pubs.acs.org/cr Molecular
More informationTranscription, Initiation of
Craig T. Martin and Olga S. Mironova, University of Massachusetts, Amherst, MA doi: 10.1002/9780470048672.wecb606 Initiation of transcription is a complex process, requiring melting of the DNA duplex at
More informationDNA Replication in Prokaryotes and Eukaryotes
DNA Replication in Prokaryotes and Eukaryotes 1. Overall mechanism 2. Roles of Polymerases & other proteins 3. More mechanism: Initiation and Termination 4. Mitochondrial DNA replication DNA replication
More informationThe replication of DNA Kornberg 1957 Meselson and Stahl 1958 Cairns 1963 Okazaki 1968 DNA Replication The driving force for DNA synthesis. The addition of a nucleotide to a growing polynucleotide
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationDNA Replication II Biochemistry 302. January 25, 2006
DNA Replication II Biochemistry 302 January 25, 2006 Following in Dad s footsteps Original A. Kornberg E. coli DNA Pol I is a lousy replicative enzyme. 400 molecules/cell but ~2 replication forks/cell
More informationGene Expression and Heritable Phenotype. CBS520 Eric Nabity
Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More informationInitiation of Replication. This section will begin with a brief discussion of chromosomal DNA sequences that sponsor the initiation of replication.
Initiation of Replication This section will begin with a brief discussion of chromosomal DNA sequences that sponsor the initiation of replication. Replicons and origins of replication The unit of DNA replication
More informationNUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
More information14 Gene Expression: From Gene to Protein
CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information
More informationTranscriptional Regulation in Eukaryotes
Transcriptional Regulation in Eukaryotes Concepts, Strategies, and Techniques Michael Carey Stephen T. Smale COLD SPRING HARBOR LABORATORY PRESS NEW YORK 2000 Cold Spring Harbor Laboratory Press, 0-87969-537-4
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationProblem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.
Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose
More informationDNA REPLICATION & REPAIR
DNA REPLICATION & REPAIR Table of contents 1. DNA Replication Model 2. DNA Replication Mechanism 3. DNA Repair: Proofreading 1. DNA Replication Model Replication in the cell cycle 3 models of DNA replication
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 1 The Nature of Genes Early ideas to explain how genes work came from studying human diseases Archibald Garrod 1902 Recognized that alkaptonuria (black urine disease)
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationStorage and Expression of Genetic Information
Storage and Expression of Genetic Information 29. DNA structure, Replication and Repair ->Ch 25. DNA metabolism 30. RNA Structure, Synthesis and Processing ->Ch 26. RNA metabolism 31. Protein Synthesis
More informationSpring 2006 Biochemistry 302 Exam 2
Name Spring 2006 Biochemistry 302 Exam 2 Directions: This exam has 45 questions/problems totaling 110 points. Check to make sure you have seven pages. Some questions have multiple parts so read each one
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationPART THREE - ANSWERS. ANSWERS to Questions from Part Three
ANSWERS to Questions from Part Three Answers, Chapter 10. Transcription: RNA polymerases 10.1 The sigma factor (σ) causes RNA polymerase to bind to the correct sites on DNA to initiate transcription (i.e.
More informationBIOLOGY. Chapter 15 Genes & Proteins
BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition
More information5 -GAC-3 5 -GTC-3 5 -CAG Which of these are NOT important for RNA Polymerase interacting with DNA?
Name This exam is schedule for 75 minutes and I anticipate it to take the full time allotted. You are free to leave if you finish. The exam is split into two sections. Part 1 is multiple choice select
More information2012 GENERAL [5 points]
GENERAL [5 points] 2012 Mark all processes that are part of the 'standard dogma of molecular' [ ] DNA replication [ ] transcription [ ] translation [ ] reverse transposition [ ] DNA restriction [ ] DNA
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More information* This work was supported by Grant MCB from the National Science Foundation.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 14, pp. 9093 9098, April 3, 2009 2009 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. TATA-binding Protein and
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationReplication. Obaidur Rahman
Replication Obaidur Rahman DIRCTION OF DNA SYNTHESIS How many reactions can a DNA polymerase catalyze? So how many reactions can it catalyze? So 4 is one answer, right, 1 for each nucleotide. But what
More informationAP2013-DNAPacket-II. Use the list of choices below for the following questions:
Class: Date: AP2013-DNAPacket-II Multiple Choice Identify the choice that best completes the statement or answers the question. Use the list of choices below for the following questions: I. helicase II.
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationChapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More information7.1 The lac Operon 7-1
7.1 The lac Operon The lac operon was the first operon discovered It contains 3 genes coding for E. coli proteins that permit the bacteria to use the sugar lactose Galactoside permease (lacy) which transports
More informationDNA Replication II Biochemistry 302. Bob Kelm January 26, 2005
DNA Replication II Biochemistry 302 Bob Kelm January 26, 2005 Following in Dad s footsteps Original A. Kornberg E. coli DNA Pol I is a lousy replicative enzyme. 400 molecules/cell but ~2 replication forks/cell
More informationDivision Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
More information