2100 Bioanalyzer. Overview & News. Ralph Beneke Dec 2010
|
|
- Jade Palmer
- 6 years ago
- Views:
Transcription
1 2100 Bioanalyzer Overview & News Ralph Beneke Dec 2010
2 RNA QC in Gene Expression Workflows Cited in over 10,000 peer-reviewed papers RIN is the industry standard for RNA QC For any size and at low sample input
3 RNA QC Key Target Aplications RNA QC is key for multiple gene expression applications and workflows Cost- or labor intensive downstream experiments require reliable integrity assessment of RNA starting material RNA QC Microarray qrt-pcr RNA-Seq
4 RNA QC in RNA-Seq workflow Quality control of total & fragmented RNA Illumina sequencing: It is very important to use high-quality RNA as the starting material..illumina recommends that you check total RNA integrity following isolation using an Agilent Technologies 2100 Bioanalyzer with an RNA Integrity Number (RIN) value greater than 8. SOLiD sequencing Illumina mrna Sequencing Sample Preparation Guide 454 sequencing append/supp/cms_ pdf Roche - cdna Rapid Library Preparation Method Manual GS FLX Titanium Series, October 2009
5 trna mirna Region Quality Control of small RNA libraries Quality Control of small RNA extractions allows to identify mirna content and trna contaminations Quality Control of small RNA libraries allows to identify adaptors, primer dimers and trna contaminations Small RNA Region Small RNA library Adaptors trna
6 RNA QC prior to qpcr Leverage the MIQE guidelines Bustin et al.: The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem Apr;55(4): Epub 2009 Feb 26:. It is also essential to document the quality assessment of RNA templates.key information to report includes data on RNA quantity, integrity, and the absence of reverse transcription or PCR inhibitors Q4/Q1 - PLAX SU Direct marketing campaign: RNA QC Webinar with Mikael Kubista from TATAA Biocenter e-push (AFO, EMEA), sponsored e-newsletters Landing Page, Flyer Combined Wave 1 and Wave 2 generated > 5000 landing page views and ~ 300 inquiries (CD & Quote requests)
7 RNA quality control in mirna expression analysis - qpcr NEW mirna QC App Note: EN RNA quality control in mirna expression analysis Aplication Area: mirna analysis, qrt-pcr Co-Author: Michael W. Pfaffl qpcr opinion leader Key statements: Proposed workflow: mirna expression analysis - qpcr RNA Nano QC A fast and reliable analysis of total RNA integrity can be performed with the lab-on-a-chip technology of the Agilent 2100 Bioanalyzer using automated capillary electrophoresis. This is the current gold standard for standardized RNA integrity assessment. The performance of RT-qPCR is impaired by decreasing RNA quality for mirna similar to mrna, but to a lower magnitude. The use of biological samples showing a RIN higher than 5, and primers producing short PCR product are recommended. It is recommended to consider mirna in combination with the total RNA. Small RNA QC qpcr
8 RNA QC in Gene Expression workflows Sales tools and References RNA Integrity/QPCR CD-ROM, NGS instrument provider protocols, Publications and References Customer Publications/Citations Discover the RNA QC reference site: RNA QC flyer: EN Examples: 1. Jahn et al.: Evaluation of isolation methods and RNA integrity for bacterial RNA quantitation, Journal of Microbiological Methods: The assessment of RNA integrity using the Agilent 2100 BioAnalyzer was critical for obtaining meaningful gene expression data. 2. Ibberson et al: RNA degradation compromises the reliability of microrna expression profi ing. BMC Biotechnology 2009, 9:102: MicroRNA expression cannot be reliably profiled in degraded total RNA. For the profiling of micrornas we recommend use of RNA samples with a RNA integrity number equal to or above seven.
9 Bioanalyzer in the NGS library prep workflow
10 Bioanalyzer Key Information The Bioanalyzer with its RNA/DNA kit portfolio enables to: assess integrity of total RNA starting material monitor mirna content in small RNA extractions monitor the size distribution after DNA or RNA fragmentation quantify NGS libraries qpcr can be additionally used as orthogonal quantification method identify and quantify library preparation artifacts such as adapters, primer dimers, PCR artifacts
11 Unique High Sensitivity DNA Kit Bioanalyzer 10-Chip kit for sizing and quantification of ds-dna fragments and ds-dna smears of bp in size and down to pg/µl in concentration. By increasing the sensitivity of the Bioanalyzer DNA Assays: Low concentrated samples can be quantified and sized. ChIP-Seq The number of PCR cycles for library amplification can be significantly reduced. NoPCR libraries, SureSelect workflow Agilent High Sensitivity DNA Kit ( ) High Sensitivity DNA Reagents ( )
12 Protein Application News Western Blotting Immuno precipitation Superior protein QC with unsurpassed speed, sensitivity, reproducibility
13 Bioanalyzer Protein Applications in the NBE Workflows in Biopharma research & production Product Characterization Cell Culture Stability Studies P80 P230 Purity Identity Clone Selection -Pack HSP-250 Monitoring Batch Consistency CFR 21 Part 11 Impurity Detection & Identification
14 Protein Kit Portfolio P80 P230 HSP EN: Protein analysis with the Agilent 2100 Bioanalyzer - An overview of the protein kit portfolio
15 Gene Expression Analysis: Immune precipitation Wenz & Rüfer, Electrophoresis 2009, 30, Wenz, et. al., Electrophoresis 2010, 31, Appliction Notes: EN EN EN EN EN
16 Western Blot with PTEN-GST Fusion in E. coli Background Western Blot kda IP/HSP kda : 1 % PTEN 2: 0.1 % PTEN 3: 0.01 % PTEN 4: % PTEN 5: % PTEN 6: E. coli only 7: PTEN only Advantages of the IP/HSP-250 Method: LM - Sensitivity - Specificity - Time-to-result: 3 hours - Cost: less primary & no secondary antibodies More application work ongoing
17 Bioanalyzer: Main Advantages Largest installed base Experience since 1999 in commercial Microfluidics More than 6500 instruments installed More than citations Dominant posititon in RNA QC with RIN Industry standard proven technology Sample volume 1 µl Largest Assay portfolio: unique assays... Cells, picorna,small RNA, HSP-250, HS-DNA Unique in NGS (sensitivity, resolution, reproducibility) Highest sensitivity and linear dynamic range HS-DNA, HSP-250 Easy Handling & Maintenance Easy standard procedure, fast, reproducible digital data Quick assay-change Replaceable cartridge Service
18 Application Compendium DNA applications: bp to bp Genotyping by DNA restriction digest, multiplex-pcr (GMO, Food, MDx, Forensics) (5% size resolution) Copy number analysis DNA library sizing & quantification, impurity detection & quantification (20% absolute accuracy) Quantify from low DNA amounts (11 samples) RNA applications: 50 pg to 500 ng cdna multiplex gene expression regulation analysis (PCR standards, response curves) RNA integrity analysis, sub-population distinction, DNA-contamination, quantification Quantify small RNAs (mirna from 10ng total RNA, size resolution 5bp/100bp) Quantify from low RNA amounts (200pg total RNA, <10% CV)
19 Application Compendium Protein analysis: 5-80 kda or kda Protein expression from 10 cell lysates/ 30 min Purification: enrichment/depletion analysis from fractions Low protein amounts can be quantified (>1pg) QA/QC of antibody production, sizing resolution & quantification (3-4 logs) Food analysis (milk, wheat,...) Glycoprotein sizing Cell analysis: Flow cell module Batch of 6 samples/ 30 min Cell counting & sub-population quantification from >500 cells (low cost consumption) Survival vs. death, specific target (surface or intracell.) staining: 20,000 cells/10 microliter Transfection efficiency analysis
Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer
Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Technical Note 10 Measured conc. [ng/µl] 1 Y intercept = 0.09 r 2 = 0.993 0.1 0.1 1 10 Reference concentration
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationSOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow
More informationApplication Note. Genomics. Abstract. Authors. Kirill Gromadski Ruediger Salowsky Susanne Glueck Agilent Technologies Waldbronn, Germany
Improving sample quality for target enrichment and next-gen sequencing with the Agilent High Sensitivity DNA Kit and the Agilent SureSelect Target Enrichment Platform Application Note Genomics Authors
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationAgilent Bioanalyzer and TapeStation Systems. systems, consumables and supplies
Agilent Bioanalyzer and TapeStation Systems systems, consumables and supplies Table of Contents Agilent 2100 Bioanalyzer System... 3 Agilent 2100 Bioanalyzer System... 4 Agilent 2100 Expert Software...
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
More informationAxygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand
Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
More informationGene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
More informationApplications for DNA, RNA, and Protein Analysis
Agilent 21 Bioanalyzer System Agilent 42 TapeStation System Applications for DNA, RNA, and Protein Analysis Application Compendium 2 Agilent 21 Bioanalyzer System Agilent 42 TapeStation System Applications
More informationElectrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008
Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationGetting the Most from Your DNA Analysis from Purification to Downstream Analysis. Eric B. Vincent, Ph.D. February 2013
Getting the Most from Your DNA Analysis from Purification to Downstream Analysis Eric B. Vincent, Ph.D. February 2013 1 Presentation Outline Genomic Analysis Purification Quantitation Qualification Analysis
More informationAutomated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep
Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION &
More information10 Reasons to Switch from SDS-PAGE to the Agilent 2100 Bioanalyzer
Welcome to our E-Seminar: 10 Reasons to Switch from SDS-PAGE to the Agilent 2100 Bioanalyzer Presenter: Dr. Tanja Wulff Agilent Technologies 10 Reasons to Switch from SDS-PAGE to the Agilent 2100 Bioanalyzer
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationUser Manual. NGS Library qpcr Quantification Kit (Illumina compatible)
NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationComparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques
Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Application Note Author Deborah Vitale Agilent Technologies, Inc. Palo Alto, CA, USA Abstract This Application
More informationGene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
More informationCancer Genetics Solutions
Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationGlobin Block Modules for QuantSeq Instruction Manual
Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for
More informationReliable and sensitive RT-qPCR analysis of whole-blood RNA samples
APPLICATION NOTE SuperScript IV Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples Introduction Most commercially available reverse transcription products do not perform well with difficult
More informationPrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
More informationAssay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationMicroarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
More informationOne platform, endless possibilities
One platform, endless possibilities The Agilent 2100 Bioanalyzer is an indispensable tool for food chemists and biologists. Now you can have a multi-purpose platform that streamlines your workflows from
More informationPCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System
PCR SYSTEMS a new era in high-productivity qpcr Applied Biosystems ViiA 7 Real-Time PCR System a new era in high-productivity qpcr The ViiA 7 Real-Time PCR System delivers the proven reliability, sensitivity,
More informationGeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
More informationImplementation of Automated Sample Quality Control in Whole Exome Sequencing
Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor
More informationSYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
More informationUser Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR
User Manual VisiBlue qpcr mix colorant Version 1.3 September 2012 For use in quantitative real-time PCR VisiBlue qpcr mix colorant Table of contents Background 4 Contents 4 Storage 4 Fluorescence data
More informationQuantStudio 3D Digital PCR System
PRODUCT BULLETIN QuantStudio 3D Digital PCR System QuantStudio 3D Digital PCR System Absolutely attainable digital PCR Simple chip-based workflow no emulsion PCR Affordable low total cost of ownership
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationConsiderations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center
Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping
More informationMagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack
Bioneer s magnetic nanobead-based solution for DNA/RNA extraction and purification 20150910 Ver.1(EN) MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack Fast, easy separation - Just
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationInstruction Manual Version DNA Elution Module. Cat. No. C (mc-magme-002)
Instruction Manual Version 2-01.14 DNA Elution Module Cat. No. C01010120 (mc-magme-002) diagenode headquarters Diagenode s.a. BELGIUM EUROPE LIEGE SCIENCE PARK Rue Bois Saint-Jean, 3 4102 Seraing - Belgium
More informationOptimize Your qpcr and RT-qPCR Assays with Careful Planning and Design
Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design Nadine Nassif, January 2013 Outline Real-Time PCR overview / Understanding qpcr data qpcr detection strategies: dye-based versus label-based
More informationquantitate host cell DNA with high sensitivity and throughput resdnaseq Host Cell DNA Quantitation Systems: CHO, E.
quantitate host cell DNA with high sensitivity and throughput resdnaseq Host Cell DNA Quantitation Systems: CHO, E. coli, Vero, NS0 Precision counts Integrated real-time qpcr systems for quantitation of
More informationLightCycler 480 qpcr Tools. Meeting the Challenge of Your Research
LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing
More informationAbsolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationLabChip GXII: Antibody Analysis
WHITE PAPER LabChip GXII: Antibody Analysis Antibody Analysis using microfluidic technology in high throughput Quality by Design Experiments Abstract Current initiatives in Process Analytical Technology
More informationThird Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
More informationChromatrap 96 DNA Micro Elution Purification Kit
V 1.0 Chromatrap 96 DNA Micro Elution Purification Kit High throughput plates for ultra-pure DNA Protocol v1.0 Catalogue no. 500240 ADVANCEMENTS IN EPIGENETICS Contents Kit Components and Storage 3 Additional
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More informationIllumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler
Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Introduction David Horvath, M.S., Senior Applications Scientist, Beckman Coulter, Inc.; Tim Hill, Scientist,
More informationNEBNext Magnesium RNA Fragmentation Module
SAMPLE PREPARATION NEBNext Magnesium RNA Fragmentation Module Instruction Manual NEB #E6150S 200 reactions NEBNext Magnesium RNA Fragmentation Module Table of Contents: Description....2 Applications....2
More informationIMGM Laboratories GmbH. Sales Manager
IMGM Laboratories GmbH Dr. Jennifer K. Kuhn Sales Manager About IMGM Laboratories IMGM Laboratories was founded in 2001 IMGM operates as professional provider of advanced genomic services from research
More informationEvaluating the Agilent 4200 TapeStation System for High Throughput Sequencing Quality Control
Evaluating the Agilent TapeStation System for High Throughput Sequencing Quality Control Application Note Nucleic Acid Analysis Authors Elisa Viering, Laura-Jane Behl, Stefan Pinkert, and Stephan Wolf
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationPrincipals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
More informationAmplification: Consumables. Reagent Comparison Guide for Real-Time PCR
Amplification: Consumables Reagent Comparison Guide for Real-Time PCR Introduction With the introduction of the minimum information for publication of quantitative real-time PCR experiments (MIQE) guidelines
More informationTable of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
More informationscgem Workflow Experimental Design Single cell DNA methylation primer design
scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease
More informationPCR Add-on Kit for Illumina Instruction Manual
PCR Add-on Kit for Illumina Instruction Manual Catalog Numbers: 001 (SENSE mrna-seq Library Prep Kit V2 for Illumina) 009 (SENSE Total RNA-Seq Library Prep Kit for Illumina) 015 (QuantSeq 3 mrna-seq Library
More informationReduce microrna RT-qPCR Assay Costs by More Than 10-fold Without Compromising Results
Reduce microrna RT-qPCR Assay Costs by More Than 10-fold Without Compromising Results Authors: Marianna Goldrick 1, Peter Kamp Busk 2, Lance Lepovitz 1 2. Aalborg University, Copenhagen, A.C. Meyers Vænge
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationMicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology
Technical note MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Abstract We introduce a new assay that enables
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationCertificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE
Certificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE Product name Holotype HLA 24/7 Configuration A1 & CE Reference number H52 LOT number 00027 (N4/002-P5/006-E1/004-R2/006) Expiration
More informationAmplicon Sequencing Template Preparation
Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The
More informationTQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5
www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, no ROX) TQ1100 200 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ1101 500 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x
More informationUser Manual. Chromofy dsdna binding dye Version 1.0 April 2009 For use in quantitative real-time PCR
User Manual Chromofy dsdna binding dye Version 1.0 April 2009 For use in quantitative real-time PCR Chromofy dsdna binding dye Table of contents Background 4 Contents 4 Storage 4 Fluorescence data 4 Additionally
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationA Genomics (R)evolution: Harnessing the Power of Single Cells
A Genomics (R)evolution: Harnessing the Power of Single Cells Fundamental Question #1 If Transcriptional Heterogeneity ( Noise ) is so great in single cells What s the Point? Single Cells = True Biology
More informationmirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis
mirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis A Maxwell RSC mirna Tissue Kit Application Note Materials Required: Maxwell RSC mirna Tissue Kit (Cat.# AS1480) QuantiFluor RNA System
More informationWELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)
WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow
More informationKAPA HiFi Real-Time PCR Library Amplification Kit
Technical Data Sheet KAPA HiFi Real-Time PCR Library Amplification Kit 1. Product Description High fidelity PCR is used to selectively enrich library fragments carrying appropriate adaptor sequences and
More informationIntroduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
More informationEcho-Enhanced SMART-Seq v4 for RNA Sequencing
Echo-Enhanced SMART-Seq v4 for RNA Sequencing Jefferson Lai, Anna Lehto, John Lesnick and Carl Jarman Labcyte Inc. INTRODUCTION As the cost of sequencing has continued to decline by orders of magnitude
More informationLabChip 90 System with DataViewer Software
Revolutionizing DNA and Protein Gel Electrophoresis LabChip 90 System with DataViewer Software The Proven Alternative to Slab Gels. The massive flow of information emerging from today s genomic and proteomic
More informationRelative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA)
The LightCycler 480 System Short Guide Topic: Purpose: Assay Principle: Detection Format: Result: Relative Quantification (Mono-Color) Describes how to set up and perform mono-color Relative Quantification
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationBacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,
More informationIDEAL TM Spike-In RNA Kit. Individual Assays Principle, Workflow and Protocol
IDEAL TM Spike-In RNA Kit Individual Assays Principle, Workflow and Protocol Table of Contents Content Page Working Principle 3 Kit Contents & Storage 4 Additional Equipment and Compatibility 5 Workflow
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More informationSole Source Justification (SSJ) in accordance with FAR subparts or 13.5 using Simplified Acquisitions Procedures (SAP) BRAND NAME ONLY
DEPARTMENT OF THE ARMY US ARMY MEDICAL RESEARCH ACQUISITION ACTIVITY 820 CHANDLER STREET FORT DETRICK MD 21702-5014 Control No: JA17219 Sole Source Justification (SSJ) in accordance with FAR subparts 13.106
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationUSB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
More informationRT 2 Easy First Strand Handbook
March 2011 RT 2 Easy First Strand Handbook For cdna synthesis Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,
More informationACCEL-NGS 2S DNA LIBRARY KITS
ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
More informationNEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1)
LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) Instruction Manual NEB #E7300S/L 24/96 reactions Version 4.0 9/17 be INSPIRED drive DISCOVERY stay GENUINE This product
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationNEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1)
LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) Instruction Manual NEB #E7300S/L 24/96 reactions Sign up for the NEBNext e-newsletter Scan this code or visit www.neb.com/
More information