2100 Bioanalyzer. Overview & News. Ralph Beneke Dec 2010

Size: px
Start display at page:

Download "2100 Bioanalyzer. Overview & News. Ralph Beneke Dec 2010"

Transcription

1 2100 Bioanalyzer Overview & News Ralph Beneke Dec 2010

2 RNA QC in Gene Expression Workflows Cited in over 10,000 peer-reviewed papers RIN is the industry standard for RNA QC For any size and at low sample input

3 RNA QC Key Target Aplications RNA QC is key for multiple gene expression applications and workflows Cost- or labor intensive downstream experiments require reliable integrity assessment of RNA starting material RNA QC Microarray qrt-pcr RNA-Seq

4 RNA QC in RNA-Seq workflow Quality control of total & fragmented RNA Illumina sequencing: It is very important to use high-quality RNA as the starting material..illumina recommends that you check total RNA integrity following isolation using an Agilent Technologies 2100 Bioanalyzer with an RNA Integrity Number (RIN) value greater than 8. SOLiD sequencing Illumina mrna Sequencing Sample Preparation Guide 454 sequencing append/supp/cms_ pdf Roche - cdna Rapid Library Preparation Method Manual GS FLX Titanium Series, October 2009

5 trna mirna Region Quality Control of small RNA libraries Quality Control of small RNA extractions allows to identify mirna content and trna contaminations Quality Control of small RNA libraries allows to identify adaptors, primer dimers and trna contaminations Small RNA Region Small RNA library Adaptors trna

6 RNA QC prior to qpcr Leverage the MIQE guidelines Bustin et al.: The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem Apr;55(4): Epub 2009 Feb 26:. It is also essential to document the quality assessment of RNA templates.key information to report includes data on RNA quantity, integrity, and the absence of reverse transcription or PCR inhibitors Q4/Q1 - PLAX SU Direct marketing campaign: RNA QC Webinar with Mikael Kubista from TATAA Biocenter e-push (AFO, EMEA), sponsored e-newsletters Landing Page, Flyer Combined Wave 1 and Wave 2 generated > 5000 landing page views and ~ 300 inquiries (CD & Quote requests)

7 RNA quality control in mirna expression analysis - qpcr NEW mirna QC App Note: EN RNA quality control in mirna expression analysis Aplication Area: mirna analysis, qrt-pcr Co-Author: Michael W. Pfaffl qpcr opinion leader Key statements: Proposed workflow: mirna expression analysis - qpcr RNA Nano QC A fast and reliable analysis of total RNA integrity can be performed with the lab-on-a-chip technology of the Agilent 2100 Bioanalyzer using automated capillary electrophoresis. This is the current gold standard for standardized RNA integrity assessment. The performance of RT-qPCR is impaired by decreasing RNA quality for mirna similar to mrna, but to a lower magnitude. The use of biological samples showing a RIN higher than 5, and primers producing short PCR product are recommended. It is recommended to consider mirna in combination with the total RNA. Small RNA QC qpcr

8 RNA QC in Gene Expression workflows Sales tools and References RNA Integrity/QPCR CD-ROM, NGS instrument provider protocols, Publications and References Customer Publications/Citations Discover the RNA QC reference site: RNA QC flyer: EN Examples: 1. Jahn et al.: Evaluation of isolation methods and RNA integrity for bacterial RNA quantitation, Journal of Microbiological Methods: The assessment of RNA integrity using the Agilent 2100 BioAnalyzer was critical for obtaining meaningful gene expression data. 2. Ibberson et al: RNA degradation compromises the reliability of microrna expression profi ing. BMC Biotechnology 2009, 9:102: MicroRNA expression cannot be reliably profiled in degraded total RNA. For the profiling of micrornas we recommend use of RNA samples with a RNA integrity number equal to or above seven.

9 Bioanalyzer in the NGS library prep workflow

10 Bioanalyzer Key Information The Bioanalyzer with its RNA/DNA kit portfolio enables to: assess integrity of total RNA starting material monitor mirna content in small RNA extractions monitor the size distribution after DNA or RNA fragmentation quantify NGS libraries qpcr can be additionally used as orthogonal quantification method identify and quantify library preparation artifacts such as adapters, primer dimers, PCR artifacts

11 Unique High Sensitivity DNA Kit Bioanalyzer 10-Chip kit for sizing and quantification of ds-dna fragments and ds-dna smears of bp in size and down to pg/µl in concentration. By increasing the sensitivity of the Bioanalyzer DNA Assays: Low concentrated samples can be quantified and sized. ChIP-Seq The number of PCR cycles for library amplification can be significantly reduced. NoPCR libraries, SureSelect workflow Agilent High Sensitivity DNA Kit ( ) High Sensitivity DNA Reagents ( )

12 Protein Application News Western Blotting Immuno precipitation Superior protein QC with unsurpassed speed, sensitivity, reproducibility

13 Bioanalyzer Protein Applications in the NBE Workflows in Biopharma research & production Product Characterization Cell Culture Stability Studies P80 P230 Purity Identity Clone Selection -Pack HSP-250 Monitoring Batch Consistency CFR 21 Part 11 Impurity Detection & Identification

14 Protein Kit Portfolio P80 P230 HSP EN: Protein analysis with the Agilent 2100 Bioanalyzer - An overview of the protein kit portfolio

15 Gene Expression Analysis: Immune precipitation Wenz & Rüfer, Electrophoresis 2009, 30, Wenz, et. al., Electrophoresis 2010, 31, Appliction Notes: EN EN EN EN EN

16 Western Blot with PTEN-GST Fusion in E. coli Background Western Blot kda IP/HSP kda : 1 % PTEN 2: 0.1 % PTEN 3: 0.01 % PTEN 4: % PTEN 5: % PTEN 6: E. coli only 7: PTEN only Advantages of the IP/HSP-250 Method: LM - Sensitivity - Specificity - Time-to-result: 3 hours - Cost: less primary & no secondary antibodies More application work ongoing

17 Bioanalyzer: Main Advantages Largest installed base Experience since 1999 in commercial Microfluidics More than 6500 instruments installed More than citations Dominant posititon in RNA QC with RIN Industry standard proven technology Sample volume 1 µl Largest Assay portfolio: unique assays... Cells, picorna,small RNA, HSP-250, HS-DNA Unique in NGS (sensitivity, resolution, reproducibility) Highest sensitivity and linear dynamic range HS-DNA, HSP-250 Easy Handling & Maintenance Easy standard procedure, fast, reproducible digital data Quick assay-change Replaceable cartridge Service

18 Application Compendium DNA applications: bp to bp Genotyping by DNA restriction digest, multiplex-pcr (GMO, Food, MDx, Forensics) (5% size resolution) Copy number analysis DNA library sizing & quantification, impurity detection & quantification (20% absolute accuracy) Quantify from low DNA amounts (11 samples) RNA applications: 50 pg to 500 ng cdna multiplex gene expression regulation analysis (PCR standards, response curves) RNA integrity analysis, sub-population distinction, DNA-contamination, quantification Quantify small RNAs (mirna from 10ng total RNA, size resolution 5bp/100bp) Quantify from low RNA amounts (200pg total RNA, <10% CV)

19 Application Compendium Protein analysis: 5-80 kda or kda Protein expression from 10 cell lysates/ 30 min Purification: enrichment/depletion analysis from fractions Low protein amounts can be quantified (>1pg) QA/QC of antibody production, sizing resolution & quantification (3-4 logs) Food analysis (milk, wheat,...) Glycoprotein sizing Cell analysis: Flow cell module Batch of 6 samples/ 30 min Cell counting & sub-population quantification from >500 cells (low cost consumption) Survival vs. death, specific target (surface or intracell.) staining: 20,000 cells/10 microliter Transfection efficiency analysis

Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer

Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Technical Note 10 Measured conc. [ng/µl] 1 Y intercept = 0.09 r 2 = 0.993 0.1 0.1 1 10 Reference concentration

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow

More information

Application Note. Genomics. Abstract. Authors. Kirill Gromadski Ruediger Salowsky Susanne Glueck Agilent Technologies Waldbronn, Germany

Application Note. Genomics. Abstract. Authors. Kirill Gromadski Ruediger Salowsky Susanne Glueck Agilent Technologies Waldbronn, Germany Improving sample quality for target enrichment and next-gen sequencing with the Agilent High Sensitivity DNA Kit and the Agilent SureSelect Target Enrichment Platform Application Note Genomics Authors

More information

Agilent s Mx3000P and Mx3005P

Agilent s Mx3000P and Mx3005P Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded

More information

Agilent Bioanalyzer and TapeStation Systems. systems, consumables and supplies

Agilent Bioanalyzer and TapeStation Systems. systems, consumables and supplies Agilent Bioanalyzer and TapeStation Systems systems, consumables and supplies Table of Contents Agilent 2100 Bioanalyzer System... 3 Agilent 2100 Bioanalyzer System... 4 Agilent 2100 Expert Software...

More information

Single Cell Genomics

Single Cell Genomics Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell

More information

Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand

Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)

More information

Gene Expression on the Fluidigm BioMark HD

Gene Expression on the Fluidigm BioMark HD Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental

More information

Applications for DNA, RNA, and Protein Analysis

Applications for DNA, RNA, and Protein Analysis Agilent 21 Bioanalyzer System Agilent 42 TapeStation System Applications for DNA, RNA, and Protein Analysis Application Compendium 2 Agilent 21 Bioanalyzer System Agilent 42 TapeStation System Applications

More information

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating

More information

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Getting the Most from Your DNA Analysis from Purification to Downstream Analysis. Eric B. Vincent, Ph.D. February 2013

Getting the Most from Your DNA Analysis from Purification to Downstream Analysis. Eric B. Vincent, Ph.D. February 2013 Getting the Most from Your DNA Analysis from Purification to Downstream Analysis Eric B. Vincent, Ph.D. February 2013 1 Presentation Outline Genomic Analysis Purification Quantitation Qualification Analysis

More information

Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep

Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION &

More information

10 Reasons to Switch from SDS-PAGE to the Agilent 2100 Bioanalyzer

10 Reasons to Switch from SDS-PAGE to the Agilent 2100 Bioanalyzer Welcome to our E-Seminar: 10 Reasons to Switch from SDS-PAGE to the Agilent 2100 Bioanalyzer Presenter: Dr. Tanja Wulff Agilent Technologies 10 Reasons to Switch from SDS-PAGE to the Agilent 2100 Bioanalyzer

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible)

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible) NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents

More information

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques

Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Application Note Author Deborah Vitale Agilent Technologies, Inc. Palo Alto, CA, USA Abstract This Application

More information

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa

More information

Cancer Genetics Solutions

Cancer Genetics Solutions Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Globin Block Modules for QuantSeq Instruction Manual

Globin Block Modules for QuantSeq Instruction Manual Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for

More information

Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples

Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples APPLICATION NOTE SuperScript IV Reliable and sensitive RT-qPCR analysis of whole-blood RNA samples Introduction Most commercially available reverse transcription products do not perform well with difficult

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the

More information

Assay Design Considerations, Optimization and Validation

Assay Design Considerations, Optimization and Validation Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment

More information

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used

More information

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230 mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

One platform, endless possibilities

One platform, endless possibilities One platform, endless possibilities The Agilent 2100 Bioanalyzer is an indispensable tool for food chemists and biologists. Now you can have a multi-purpose platform that streamlines your workflows from

More information

PCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System

PCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System PCR SYSTEMS a new era in high-productivity qpcr Applied Biosystems ViiA 7 Real-Time PCR System a new era in high-productivity qpcr The ViiA 7 Real-Time PCR System delivers the proven reliability, sensitivity,

More information

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000

More information

Implementation of Automated Sample Quality Control in Whole Exome Sequencing

Implementation of Automated Sample Quality Control in Whole Exome Sequencing Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor

More information

SYBR Green Realtime PCR Master Mix

SYBR Green Realtime PCR Master Mix Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection

More information

User Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR

User Manual. VisiBlue qpcr mix colorant. Version 1.3 September 2012 For use in quantitative real-time PCR User Manual VisiBlue qpcr mix colorant Version 1.3 September 2012 For use in quantitative real-time PCR VisiBlue qpcr mix colorant Table of contents Background 4 Contents 4 Storage 4 Fluorescence data

More information

QuantStudio 3D Digital PCR System

QuantStudio 3D Digital PCR System PRODUCT BULLETIN QuantStudio 3D Digital PCR System QuantStudio 3D Digital PCR System Absolutely attainable digital PCR Simple chip-based workflow no emulsion PCR Affordable low total cost of ownership

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center

Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping

More information

MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack

MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack Bioneer s magnetic nanobead-based solution for DNA/RNA extraction and purification 20150910 Ver.1(EN) MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack Fast, easy separation - Just

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

Instruction Manual Version DNA Elution Module. Cat. No. C (mc-magme-002)

Instruction Manual Version DNA Elution Module. Cat. No. C (mc-magme-002) Instruction Manual Version 2-01.14 DNA Elution Module Cat. No. C01010120 (mc-magme-002) diagenode headquarters Diagenode s.a. BELGIUM EUROPE LIEGE SCIENCE PARK Rue Bois Saint-Jean, 3 4102 Seraing - Belgium

More information

Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design

Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design Nadine Nassif, January 2013 Outline Real-Time PCR overview / Understanding qpcr data qpcr detection strategies: dye-based versus label-based

More information

quantitate host cell DNA with high sensitivity and throughput resdnaseq Host Cell DNA Quantitation Systems: CHO, E.

quantitate host cell DNA with high sensitivity and throughput resdnaseq Host Cell DNA Quantitation Systems: CHO, E. quantitate host cell DNA with high sensitivity and throughput resdnaseq Host Cell DNA Quantitation Systems: CHO, E. coli, Vero, NS0 Precision counts Integrated real-time qpcr systems for quantitation of

More information

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research

LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing

More information

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

LabChip GXII: Antibody Analysis

LabChip GXII: Antibody Analysis WHITE PAPER LabChip GXII: Antibody Analysis Antibody Analysis using microfluidic technology in high throughput Quality by Design Experiments Abstract Current initiatives in Process Analytical Technology

More information

Third Generation Sequencing

Third Generation Sequencing Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence

More information

Chromatrap 96 DNA Micro Elution Purification Kit

Chromatrap 96 DNA Micro Elution Purification Kit V 1.0 Chromatrap 96 DNA Micro Elution Purification Kit High throughput plates for ultra-pure DNA Protocol v1.0 Catalogue no. 500240 ADVANCEMENTS IN EPIGENETICS Contents Kit Components and Storage 3 Additional

More information

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not

More information

Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler

Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Introduction David Horvath, M.S., Senior Applications Scientist, Beckman Coulter, Inc.; Tim Hill, Scientist,

More information

NEBNext Magnesium RNA Fragmentation Module

NEBNext Magnesium RNA Fragmentation Module SAMPLE PREPARATION NEBNext Magnesium RNA Fragmentation Module Instruction Manual NEB #E6150S 200 reactions NEBNext Magnesium RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

IMGM Laboratories GmbH. Sales Manager

IMGM Laboratories GmbH. Sales Manager IMGM Laboratories GmbH Dr. Jennifer K. Kuhn Sales Manager About IMGM Laboratories IMGM Laboratories was founded in 2001 IMGM operates as professional provider of advanced genomic services from research

More information

Evaluating the Agilent 4200 TapeStation System for High Throughput Sequencing Quality Control

Evaluating the Agilent 4200 TapeStation System for High Throughput Sequencing Quality Control Evaluating the Agilent TapeStation System for High Throughput Sequencing Quality Control Application Note Nucleic Acid Analysis Authors Elisa Viering, Laura-Jane Behl, Stefan Pinkert, and Stephan Wolf

More information

Introductory Next Gen Workshop

Introductory Next Gen Workshop Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection

More information

Amplification: Consumables. Reagent Comparison Guide for Real-Time PCR

Amplification: Consumables. Reagent Comparison Guide for Real-Time PCR Amplification: Consumables Reagent Comparison Guide for Real-Time PCR Introduction With the introduction of the minimum information for publication of quantitative real-time PCR experiments (MIQE) guidelines

More information

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.

More information

scgem Workflow Experimental Design Single cell DNA methylation primer design

scgem Workflow Experimental Design Single cell DNA methylation primer design scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease

More information

PCR Add-on Kit for Illumina Instruction Manual

PCR Add-on Kit for Illumina Instruction Manual PCR Add-on Kit for Illumina Instruction Manual Catalog Numbers: 001 (SENSE mrna-seq Library Prep Kit V2 for Illumina) 009 (SENSE Total RNA-Seq Library Prep Kit for Illumina) 015 (QuantSeq 3 mrna-seq Library

More information

Reduce microrna RT-qPCR Assay Costs by More Than 10-fold Without Compromising Results

Reduce microrna RT-qPCR Assay Costs by More Than 10-fold Without Compromising Results Reduce microrna RT-qPCR Assay Costs by More Than 10-fold Without Compromising Results Authors: Marianna Goldrick 1, Peter Kamp Busk 2, Lance Lepovitz 1 2. Aalborg University, Copenhagen, A.C. Meyers Vænge

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology

MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Technical note MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Abstract We introduce a new assay that enables

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Certificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE

Certificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE Certificate of Analysis of the Holotype HLA 24/7 Configuration A1 & CE Product name Holotype HLA 24/7 Configuration A1 & CE Reference number H52 LOT number 00027 (N4/002-P5/006-E1/004-R2/006) Expiration

More information

Amplicon Sequencing Template Preparation

Amplicon Sequencing Template Preparation Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The

More information

TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5

TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5 www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, no ROX) TQ1100 200 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ1101 500 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x

More information

User Manual. Chromofy dsdna binding dye Version 1.0 April 2009 For use in quantitative real-time PCR

User Manual. Chromofy dsdna binding dye Version 1.0 April 2009 For use in quantitative real-time PCR User Manual Chromofy dsdna binding dye Version 1.0 April 2009 For use in quantitative real-time PCR Chromofy dsdna binding dye Table of contents Background 4 Contents 4 Storage 4 Fluorescence data 4 Additionally

More information

Introduction To Real-Time Quantitative PCR (qpcr)

Introduction To Real-Time Quantitative PCR (qpcr) Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular

More information

A Genomics (R)evolution: Harnessing the Power of Single Cells

A Genomics (R)evolution: Harnessing the Power of Single Cells A Genomics (R)evolution: Harnessing the Power of Single Cells Fundamental Question #1 If Transcriptional Heterogeneity ( Noise ) is so great in single cells What s the Point? Single Cells = True Biology

More information

mirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis

mirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis mirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis A Maxwell RSC mirna Tissue Kit Application Note Materials Required: Maxwell RSC mirna Tissue Kit (Cat.# AS1480) QuantiFluor RNA System

More information

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow

More information

KAPA HiFi Real-Time PCR Library Amplification Kit

KAPA HiFi Real-Time PCR Library Amplification Kit Technical Data Sheet KAPA HiFi Real-Time PCR Library Amplification Kit 1. Product Description High fidelity PCR is used to selectively enrich library fragments carrying appropriate adaptor sequences and

More information

Introduction to Real-Time PCR: Basic Principles and Chemistries

Introduction to Real-Time PCR: Basic Principles and Chemistries Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the

More information

Echo-Enhanced SMART-Seq v4 for RNA Sequencing

Echo-Enhanced SMART-Seq v4 for RNA Sequencing Echo-Enhanced SMART-Seq v4 for RNA Sequencing Jefferson Lai, Anna Lehto, John Lesnick and Carl Jarman Labcyte Inc. INTRODUCTION As the cost of sequencing has continued to decline by orders of magnitude

More information

LabChip 90 System with DataViewer Software

LabChip 90 System with DataViewer Software Revolutionizing DNA and Protein Gel Electrophoresis LabChip 90 System with DataViewer Software The Proven Alternative to Slab Gels. The massive flow of information emerging from today s genomic and proteomic

More information

Relative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA)

Relative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA) The LightCycler 480 System Short Guide Topic: Purpose: Assay Principle: Detection Format: Result: Relative Quantification (Mono-Color) Describes how to set up and perform mono-color Relative Quantification

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Bacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only

Bacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,

More information

IDEAL TM Spike-In RNA Kit. Individual Assays Principle, Workflow and Protocol

IDEAL TM Spike-In RNA Kit. Individual Assays Principle, Workflow and Protocol IDEAL TM Spike-In RNA Kit Individual Assays Principle, Workflow and Protocol Table of Contents Content Page Working Principle 3 Kit Contents & Storage 4 Additional Equipment and Compatibility 5 Workflow

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from

More information

Sole Source Justification (SSJ) in accordance with FAR subparts or 13.5 using Simplified Acquisitions Procedures (SAP) BRAND NAME ONLY

Sole Source Justification (SSJ) in accordance with FAR subparts or 13.5 using Simplified Acquisitions Procedures (SAP) BRAND NAME ONLY DEPARTMENT OF THE ARMY US ARMY MEDICAL RESEARCH ACQUISITION ACTIVITY 820 CHANDLER STREET FORT DETRICK MD 21702-5014 Control No: JA17219 Sole Source Justification (SSJ) in accordance with FAR subparts 13.106

More information

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5

More information

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate

More information

RT 2 Easy First Strand Handbook

RT 2 Easy First Strand Handbook March 2011 RT 2 Easy First Strand Handbook For cdna synthesis Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,

More information

ACCEL-NGS 2S DNA LIBRARY KITS

ACCEL-NGS 2S DNA LIBRARY KITS ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

ReverTra Ace qpcr RT Master Mix

ReverTra Ace qpcr RT Master Mix Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template

More information

NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1)

NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) Instruction Manual NEB #E7300S/L 24/96 reactions Version 4.0 9/17 be INSPIRED drive DISCOVERY stay GENUINE This product

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information

NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1)

NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) Instruction Manual NEB #E7300S/L 24/96 reactions Sign up for the NEBNext e-newsletter Scan this code or visit www.neb.com/

More information