WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)
|
|
|
- Oswald Clarke
- 6 years ago
- Views:
Transcription
1
2 WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC)
3 o o o
4 o o o
5 o o o
6 o o o
7
8 Grow Your Business: Assistance for Industry Partners CBLS
9 UB Genomics and Bioinformatics Core Laboratory Technicians Sujith Valiyaparambil Natalie Waldron Mission Bioinformatics Team Jie (Jessie) Wang, Ph.D Jonathan Bard Brandon Marzullo Strive to offer latest advances in next-generation sequencing and gene expression services to UB, external researchers and private entities to help facilitate research, discovery, and product development.
10 GBC continued How can High-throughout Sequencing work for you? ChiP-seq DNA-seq (whole genome and exome) RNA-seq mirna-seq 16S Amplicon Kahvejian et.al., Nature biotechnology, 2008
11 GBC continued Technology Platforms Nucleic Acid Purification, QC, Library preparation QIASymphony automated nucleic acid purification platform Advanced Analytics Fragment Analyzer Biotek Synergy plate reader for picogreen quantitation Sage Biosciences Blue Pippin Prep Diagenode SX-8G Automated system Sequencing and Gene Expression Illumina Hiseq 2500 Illumina Miseq Affymetrix Genechip 450 Biorad digital droplet PCR (QX100)
12 GBC continued Genomic DNA Illumina Sequencing Workflow RNA/miRNA
13 Percentage GBC continued Bioinformatics Support Initial Data Processing Quality Monitoring Assay Specific Analysis Peak Model forward tags reverse tags shifted tags d= Distance to the middle Illumina base pipeline generating FASTQ files Sequencing run quality assessment and metrics Automated analysis pipelines dependent on sample type Data Hosting and Visualization Viewable aligned sequence data and analysis via UCSC genome browser
14 GBC continued Leveraging CCR Resources for Data Storage and Analysis )
15 The Relevancy of Classic Techniques Differential Gene Expression Northern blotting (1977) : 1 Probe 20 samples Dot Blots (1987) : 100s of probes 1 sample RT-PCR (1992) : 100s of probes samples Microarrays (1995 ) : 100,000s of probes 1 sample Next-gen sequencing (2005) : 250 x 10 6 reads 1 sample
16 Research and Development Product development Lab-on-chip testing and development for Rheonix. Clinical diagnostics Development of diagnostic gene panels for Multiple Sclerosis and Autism Spectrum Disorder in partnership with Lineagen. Translational research Global mirna sequencing of plasma from animals with Traumatic Brain injury. Project led by Sinapis Pharma. Microbiome Sequencing V1-V3 and V3-V4 16S amplification and sequencing of oral microbiota samples
17
18 Copyright Rheonix, Inc All Rights Reserved
19 Copyright Rheonix, Inc All Rights Reserved
20 Successful Integration of NGS Library Prep on CARD Copyright Rheonix, Inc All Rights Reserved
21 Copyright Rheonix, Inc All Rights Reserved
22 Copyright Rheonix, Inc All Rights Reserved
23
24
25
26
27
28
29
30
31 Using Advanced Proteomic Analysis to Identify Optimal Clinical Applications for Novel Cancer Therapies TREAT CELLS WITH DRUG X ISOLATE TOTAL PROTEIN ADAPT TO CLINICAL PRACTICE VALIDATE WITH PRE-CLINICAL MODELS PATHWAY 1: COMBINE WITH DRUG Z IDENTIFY AND QUANTITATE INDIVIDUAL PROTEINS PATHWAY 2: AVOID DRUG Y PATHWAY 3: NEW INDICATION? PATHWAY 4: NEW DOSING REGIMEN? USE DATA TO REVEAL/DESIGN OPTIMAL THERAPEUTIC APPLICATIONS DEFINE PATHWAYS/PROCESSES AFFECTED BY DRUG X
32
33 S TAT E U N I V E R S I T Y AT B U F FA L O UB CCR's Industry Cluster C e n t e r f o r C o m p u t a t i o n a l R e s e a r c h
34 HPC NY : NYS High Performance Computing Consortium Powered by ESD/NYSTAR
35 UB Center for Computational Research
36 The UB CCR industry cluster Industry Cluster Node Rack
37 Current Industrial Partners (18) genomics data analytics molecular modeling fluid dynamics
38 Where to go for more information
39
40 Webware Infrastructure for Rapid Conversion and Implementation of Predictive Modeling Approaches in a Web-Based Tool Physics-based Model HPC Database HPC Enabled Meta-model Meta-Model Web-based computational lifing tool Engineering components: bearing, gears For general users as well as experts Rapid Meta-model based tests High accuracy physics-based tests Turkey solution for O&M, buy on life High Fidelity High Accuracy Tests DigitalClone TM UX Fast Screening Real Time Tests Introduction to Sentient Science 3/30/2016
41 Thank You Q&A
Single Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE)
TriMark Publications April 2007 Volume: TMRGER07-0401 GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE) Trends, Industry Participants, Product Overviews and Market Drivers TABLE OF CONTENTS
E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research
www.hcltech.com E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research whitepaper April 2015 TABLE OF CONTENTS Introduction 3 Challenges associated with NGS data analysis 3 HCL s NGS Solution
Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL
Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That
Gene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
Targeted Sequencing in the NBS Laboratory
Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February
Welcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
Introduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
2100 Bioanalyzer. Overview & News. Ralph Beneke Dec 2010
2100 Bioanalyzer Overview & News Ralph Beneke Dec 2010 RNA QC in Gene Expression Workflows Cited in over 10,000 peer-reviewed papers RIN is the industry standard for RNA QC For any size and at low sample
Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
Introductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
Gene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
Introduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
Towards unbiased biomarker discovery
Towards unbiased biomarker discovery High-throughput molecular profiling technologies are routinely applied for biomarker discovery to make the drug discovery process more efficient and enable personalised
Top 5 Lessons Learned From MAQC III/SEQC
Top 5 Lessons Learned From MAQC III/SEQC Weida Tong, Ph.D Division of Bioinformatics and Biostatistics, NCTR/FDA Weida.tong@fda.hhs.gov; 870 543 7142 1 MicroArray Quality Control (MAQC) An FDA led community
Next Generation Sequencing. Target Enrichment
Next Generation Sequencing Target Enrichment Next Generation Sequencing Your Partner in Every Step from Sample to Data NGS: Revolutionizing Genetic Analysis with Single-Molecule Resolution Next generation
IMGM Laboratories GmbH. Sales Manager
IMGM Laboratories GmbH Dr. Jennifer K. Kuhn Sales Manager About IMGM Laboratories IMGM Laboratories was founded in 2001 IMGM operates as professional provider of advanced genomic services from research
Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away
Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away Venkat Malladi Computational Biologist Computational Core Cecil H. and Ida Green Center for Reproductive Biology Science Introduc
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
Next Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
How much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
Chapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales
Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology
A Genomics (R)evolution: Harnessing the Power of Single Cells
A Genomics (R)evolution: Harnessing the Power of Single Cells Fundamental Question #1 If Transcriptional Heterogeneity ( Noise ) is so great in single cells What s the Point? Single Cells = True Biology
Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep
Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION &
TIME IT S PRIME. chemagic TM Prime TM instrument Streamlined Walk-away Automation. For all Human Sample Materials. Primary Sample Handling
IT S PRIME TIME chemagic TM Prime TM instrument Streamlined Walk-away Automation. For all Human Sample Materials. Primary Sample Nucleic Acid Isolation Eluate Quantitation of Extracted Samples Assay Setup
Long and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
QuantStudio 3D Digital PCR System
PRODUCT BULLETIN QuantStudio 3D Digital PCR System QuantStudio 3D Digital PCR System Absolutely attainable digital PCR Simple chip-based workflow no emulsion PCR Affordable low total cost of ownership
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
DNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
Target Enrichment Strategies for Next Generation Sequencing
Target Enrichment Strategies for Next Generation Sequencing Anuj Gupta, PhD Agilent Technologies, New Delhi Genotypic Conference, Sept 2014 NGS Timeline Information burst Nearly 30,000 human genomes sequenced
SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
Implementation of Automated Sample Quality Control in Whole Exome Sequencing
Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor
Ion S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
HiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
University of Pennsylvania Perelman School of Medicine High Throughput Screening Core
University of Pennsylvania Perelman School of Medicine High Throughput Screening Core Sara Cherry, Ph. D. David C. Schultz, Ph. D. dschultz@mail.med.upenn.edu (215) 573 9641 67 John Morgan Building Mission
LATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
Introduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
Bioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
ACCEL-NGS 2S DNA LIBRARY KITS
ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries
Bioinformatics and computational tools
Bioinformatics and computational tools Etienne P. de Villiers (PhD) International Livestock Research Institute Nairobi, Kenya International Livestock Research Institute Nairobi, Kenya ILRI works at the
Examples of founding and evolving leading LifeScience companies. November 2016
Examples of founding and evolving leading LifeScience companies November 2016 Peter Pohl Born: in Salzburg Love: my wife and my two children (age 9&7) Education: Business Adminstration Serial entrepreneur
6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
Cancer Genetics Solutions
Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting
Accessible answers. Targeted sequencing: accelerating and amplifying answers for oncology research
Accessible answers Targeted sequencing: accelerating and amplifying answers for oncology research Help advance precision medicine Accelerate results with Ion Torrent NGS Life without cancer. This is our
Next Generation Sequencing for Gene Fusion Detection: A Complementary Tool for Cytogenetics
Next Generation Sequencing for Gene Fusion Detection: A Complementary Tool for Cytogenetics Ravindra Kolhe, MD, PhD Assistant Professor of Pathology Medical Director, AUMC Cytogenetics laboratory Laboratory
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data
Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Bruno Zeitouni Bionformatics department of the Institut Curie Inserm U900 Mines ParisTech Ion Torrent User Meeting 2012, October
Microarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays
High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science
DNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
Program overview. SciLifeLab - a short introduction. Advanced Light Microscopy. Affinity Proteomics. Bioinformatics.
Open House Program SciLifeLab Open House in Stockholm November 4, 2015 09:00-16:00 Contact: events@scilifelab.se Program overview 09:00-09:30-10:00-10:30-11:00-11:30-12:00-12:30-13:00-13:30-14:00-14:30-15:00-15:30-09:30
MiSeq. system applications
MiSeq system applications Choose your application. Load, and go. Focused power. Speed and simplicity for targeted and small-genome sequencing. Optimized sample preparation kits, push-button sequencing,
leading the way in research & development
leading the way in research & development people. passion. possibilities. ABBVIE 2 immunology AbbVie Immunology has a demonstrated record of success in identifying and developing both small molecule and
Lecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
RNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM
SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400
QIAGEN Sample & Assay Technologies From Discovery to Patient
QIAGEN From Discovery to Patient New York, February 14 QIAGEN 2008 Analyst & Investor Day Peer Schatz, CEO -7- Forward Looking Statements Safe Harbor Statement: Certain of the statements contained in this
Improved Chemistry for NGS Library Cleanup and Size Selection Speakers: Charles Cowles, PhD & Curtis Knox
Improved Chemistry for NGS Library Cleanup and Size Selection Speakers: Charles Cowles, PhD & Curtis Knox Promega Corporation Agenda What is size-selective purification and how is it used? Why is there
Sanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
PAREXEL GENOMIC MEDICINE SERVICES. Applying genomics to enhance your drug development journey
PAREXEL GENOMIC MEDICINE SERVICES Applying genomics to enhance your drug development journey YOUR JOURNEY. OUR MISSION. Genomic expertise to simplify the route to product approval and maximize patient
Next-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
Getting the Most from Your DNA Analysis from Purification to Downstream Analysis. Eric B. Vincent, Ph.D. February 2013
Getting the Most from Your DNA Analysis from Purification to Downstream Analysis Eric B. Vincent, Ph.D. February 2013 1 Presentation Outline Genomic Analysis Purification Quantitation Qualification Analysis
SMEs in IMI2 Calls for Proposals
SMEs in IMI2 Calls for Proposals Why should an SME participate in an IMI project IMI projects are focused on translating excellent research into real world outcomes an opportunity for SMEs Unique collaborative
Course Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
Technical note: Molecular Index counting adjustment methods
Technical note: Molecular Index counting adjustment methods By Jue Fan, Jennifer Tsai, Eleen Shum Introduction. Overview of BD Precise assays BD Precise assays are fast, high-throughput, next-generation
Lab methods: Exome / Genome. Ewart de Bruijn
Lab methods: Exome / Genome 27 06 2013 Ewart de Bruijn Library prep is only a small part of the complete DNA analysis workflow DNA isolation library prep enrichment flowchip prep sequencing bioinformatics
Ion S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Introducing the Ion S5 and Ion S5 XL systems Now, adopting next-generation sequencing in your lab is simpler than ever. The Ion S5
Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
Exeter s experience of trying to keep up with demand for NGS. Anna Bussell
Exeter s experience of trying to keep up with demand for NGS Anna Bussell Overview Sample received and DNA extracted Admin & test review NGS wet lab work Sequencing Report authorisation & distribution
MICROARRAYS+SEQUENCING
MICROARRAYS+SEQUENCING The most efficient way to advance genomics research Down to a Science. www.affymetrix.com/downtoascience Affymetrix GeneChip Expression Technology Complementing your Next-Generation
RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
A step-by-step guide to ChIP-seq data analysis
A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D. EMBL-European Bioinformatics Institute Wellcome Trust Sanger Institute Target audience Wet-lab biologists with no experience
DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products
Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand
Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the
DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
High-throughput scale. Desktop simplicity.
High-throughput scale. Desktop simplicity. NextSeq 500 System. Flexible power. Speed and simplicity for whole-genome, exome, and transcriptome sequencing. Harness the power of next-generation sequencing.
Innovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing
Innovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing Overview Serving biotech and pharma community since 1998 Proven track record of advancing small molecules from
Pyrosequencing. Alix Groom
Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases
2014 APHL Next Generation Sequencing (NGS) Survey
APHL would like you to complete the Next Generation Sequencing (NGS) in Public Health Laboratories Survey. The purpose of this survey is to collect information on current capacities for NGS testing and
Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis
Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis Trevor Pugh, PhD, FACMG Princess Margaret Cancer Centre, University Health Network Dept.
quantitate host cell DNA with high sensitivity and throughput resdnaseq Host Cell DNA Quantitation Systems: CHO, E.
quantitate host cell DNA with high sensitivity and throughput resdnaseq Host Cell DNA Quantitation Systems: CHO, E. coli, Vero, NS0 Precision counts Integrated real-time qpcr systems for quantitation of
Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends ( )
Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends (2013-2021) May, 2017 3 rd Edition Information contained in this market report is believed to be reliable at the time
Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry
Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Clinical proteomics is the application of proteomic approach to the field of medicine. Proteome of an organism changes
Introduction to Next Generation Sequencing (NGS)
Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it
Fast decisions instead of delays Quality Control through outstanding design
Fast decisions instead of delays Quality Control through outstanding design We are CustomBiotech from Roche In your operations, behind your decisions, powering your products You are driving a paradigm
The Translational Genomics Core at Partners Personalized Medicine: Facilitating the Transition of Research towards Personalized Medicine
The Translational Genomics Core at Partners Personalized Medicine: Facilitating the Transition of Research towards Personalized Medicine The Harvard community has made this article openly available. Please
RNA spike-in controls & analysis methods for trustworthy genome-scale measurements
RNA spike-in controls & analysis methods for trustworthy genome-scale measurements Sarah A. Munro, Ph.D. Genome-Scale Measurements Group ABRF Meeting March 29, 2015 Overview External RNA Controls Consortium
Getting high-quality cytogenetic data is a SNP.
Getting high-quality cytogenetic data is a SNP. SNP data. Increased insight. Cytogenetics is at the forefront of the study of cancer and congenital disorders. And we put you at the forefront of cytogenetics.