Supporting Information

Size: px
Start display at page:

Download "Supporting Information"

Transcription

1 Supporting Information Su et al /pnas SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS (Gibco). All other cell lines used in this study were cultured in DMEM plus 10% FBS. Rnf2 cdna was cloned into prk5-flag vector or pgex- 4T1 vector. p53 cdna was cloned into prk5-myc vector or pet-28a vector. HA Mdm2 construct was provided by Dr. Shengcai Lin. Rnf2ΔRing cdna (amino acid ) was cloned into prk5 FLAG vector. Bmi1 and Bmi1Δ1 44 cdna was cloned into pet-28a vector. The Rnf2 point mutants were generated using a site-directed mutagenesis kit (Transgen). Antibodies and Reagents. Anti-p53 (ab17990) and anti-rnf2 (ab3832 and ab28629) antibodies were purchased from Abcam. Anti-p53 (DO-1) antibody was fromsantacruz.anti-mdm2 (OP-46) was from Calbiochem. Anti-Bmi1 (05-637) was from Millipore. Anti-FLAG, anti-ha, anti-lamin, anti-tubulin, and anti-actin antibodies were from Sigma. Doxorubicin (D1515), CHX (C4859), and puromycin (P8833) were from Sigma. MG132 was from Calbiochem. Primers for Q-PCR. p21: forward-agcgaccttcctcatcca, reverse-agcctctactgccaccat; p53: forward-gactg- ACATTCTCCACTTCT, reverse-tctgacgcacacctattg; Rnf2: forward-gtgtgtggatgtgtgttt, reverse-atgtg- GCTATGTATATGTTACC; BAX: forward-tcagatgtggt- CTATAATG, reverse-caatgaacttgagcaatt; Mdm2: forward-gtcttctcttaggtcacat, reverse-acaggcaatt- ACAATCTTAC; GAPDH: forward-tcctggtatgacaacg- AAT, reverse-tcttcctcttgtgctctt; and Puma: forward- TGTGAATCCTGTGCTCTG, reverse-cccaaatgaatgcca- GTG. RNA Interference. Rnf2 control shrna, Rnf2 shrnas, and p53 shrna fragments were cloned into the psuperretro vector. The following shrna sequences were used: Control shrna sequence, TCGGTACTCAACCGTTAAG; Rnf2 shrna-1, ACGGAACT- CAACCATTAAG; Rnf2 shrna-2, TGGATGGTGCTAGTGA- AAT; p53 shrna, GACTCCAGTGGTAATCTAC; and Bmi1 shrna, GTTCACAAGACCAGACCAC. The shrna plasmids were transfected into cells as described in the text. Coimmunoprecipitation Assay. The cells were lysed in lysis buffer (20 mm Tris HCl, ph 7.5, 100 mm NaCl, 1 mm EDTA, 1% Nonidet P-40) containing fresh protease inhibitors. Whole cell lysates were incubated with 2 μg of antibody and protein A or protein G Sepharose beads (Millipore) for 2 h at 4 C. The immunocomplexes were subsequently washed with lysis buffer four times and separated through SDS/PAGE. GST Precipitation Assay. GST or His fusion proteins were prepared following standard protocol. GST Rnf2 fusion proteins bound to the GSH Sepharose were incubated with purified His-p53. After washing for five times, the bound proteins were separated by SDS/PAGE. In Vitro Binding Assay. In vitro translated fusion proteins were prepared following standard protocol (Promega). FLAG Rnf2 fusion proteins bound to the anti-flag M2 affinity gel were incubated with 35 S-labeled p53 fragments. After washing for five times, the bound proteins were separated by SDS/PAGE. Immunofluorescence. Tera-1 cells were plated on glass coverslips and transfected with indicated constructs. After 72 h with puromycin treatment, cells were fixed with 4% paraformaldehyde for 10 min at room temperature and stained with indicated antibodies. In Vivo Ubiquitination Assay. HCT116 cells were transfected with the indicated plasmids. The cells were treated with MG132 for 6 h, harvested, and lysed with RIPA buffer supplemented with 10 mm iodoacetamide (GE Healthcare) and protease inhibitors. Endogenous p53 was immunoprecipitated with 1 μg of anti-p53 polyclonal antibodies and immunoblotted with anti-ha or antip53 (DO-1) antibodies. In Vitro Ubiquitination Assay. A 100 μl sample of the in vitro translated FLAG-tagged Rnf2 (TNT, Promega) was purified using FLAG beads and incubated with bacteria expressed Bmi1 for 1 h. After extensive washing, the reconstituted complex was used for in vitro ubiquitination without elution from the FLAG beads. We incubated 2 μl in vitro translated 35 S-labeled p53 (TNT, Promega) in a 30 μl reaction mixture containing 50 mm Tris HCl (ph 7.5), 5 mm MgCl 2, 0.6 mm DTT, 2 mm ATP, 100 ng of ubiquitin-activating enzyme E1, 200 ng of ubiquitin-conjugating enzyme UbcH5c, 10 μg of ubiquitin (Calbiochem), and 2 μg of the Rnf2 Bmi1 complex. After incubation at 37 C for 2 h, the reactions were boiled and separated on an 8% SDS/PAGE gel. The 35 S-labeled p53 was detected using autoradiography. Cytosal/Nuclear Fractionation. Cells were transfected with indicated constructs. At 48 or 72 h after transfection, cells were harvested and washed with PBS one time. Cytoplasmic proteins were extracted by lysing with solution A (10 mm Hepes, ph 7.9, 10 mm KCl, 1.5 mm MgCl 2, 0.34 M sucrose, 10% glycerol, 1 mm DTT, 0.1% Triton X-100) for 5 min. The intact nuclei were then lysed in RIPA buffer. Cell Cycle Analysis. Cells transfected with indicated shrnas were trypsinized at day 4, fixed with 70% ethanol for at least 2 h at 4 C. Cells were then washed with PBS, resuspended in 300 μl of PBS containing DNase-free RNase (100 μg/ml), and incubated at 37 C for 30 min. Propidium iodide (10 μg/ml, Sigma) was used for DNA staining. Samples were analyzed by flow cytometry (BD Pharmingen) and cell cycle analyses were performed by ModFit software. Apoptosis Assays. Cells transfected with indicated shrnas were fixed with 4% paraformaldehyde for 1 h and measured by TUNEL staining using an in situ cell death detection kit, TMR (Roche Applied Science). Apoptotic cell numbers were analyzed by flow cytometry using APC-conjugated annexin V (BD Pharmingen) staining. Colonogenic survival assay was performed by seeding cells transfected with indicated shrnas in culture medium supplemented with 1 μg/ml puromycin. After 3 wk, colonies were fixed with 4% paraformaldehyde and stained with 0.2% methylene blue for visualization. Tissue Microarray. The tissue arrays of human ovarian cancer samples were purchased from US Biomax (BC11115). Immunohistochemical staining of Rnf2, p53, and Mdm2 were scored by pathologists in a blinded manner. 1of6

2 Fig. S1. Rnf2 negatively regulates p53 related to Fig. 1. (A) Rnf2 interacts with the DNA binding domain of p53. Indicated p53 DNA plasmids were used to translate their respective proteins in a TNT-coupled Reticulocyte Lysate system. The translated 35 S p53 polypeptides were incubated with FLAG or FLAG-Rnf2 M2 Affinity Gel. Proteins retained on the gels were resolved in SDS/PAGE and revealed by autoradiogram. (B) Relative mrna levels of Rnf2 in transfected Tera- 1 cells. (C) Rnf2 overexpression represses p53 protein levels in Tera-1 cells. Tera-1 cells transfected with indicated plasmids were treated with Doxorubicin for 2 h before harvest. Cell lysates were subjected to SDS/PAGE and blotted with indicated antibodies. (D) Rnf2 protein sequences are highly conserved among human, mouse, and zebrafish. (E) p53 up-regulation in Rnf2 depleted cells can be reversed by zebrafish Rnf2 or Mdm2 cotransfection. Tera-1 cells were transfected with indicated constructs. Cells were lysed and cell lysates were blotted with indicated antibodies 72 h later. 2of6

3 Fig. S2. Rnf2 regulates p53 in specific cell types related to Fig. 2. (A) Rnf2 depletion increases p53 protein levels in Tera-2, MCF-7 cells, and MEFs but not in HeLa or PA-1 cells. Tera-2, MCF-7, HeLa, or PA-1 cells transfected with control or Rnf2 shrna constructs were harvested 3 d after puromycin treatment. Rnf2 flox/flox MEFs infected with control or CMV-Cre expression adenovirus were harvested 2 d after infection. Cell lysates were then subjected to immunoblotting. (B) Rnf2 interacts with p53 in HEK 293 cells. HEK 293 cell lysates were subject to immunoprecipitation with control IgG or anti-p53 antibodies. The immunoprecipitates were then blotted with indicated antibodies. (C) Expression levels of Rnf2 and p53 in different cell lines. (D) Rnf2 is not a direct target of p53. Tera-1 cells treated with doxorubicin were harvested at the indicated time. Proteins were extracted and subjected to Western blot. Fig. S3. Rnf2 poly-ubiquitinates p53 in cell nucleus related to Fig. 3. (A and B) Rnf2 promotes nuclear p53 poly-ubiquitination in vivo. HCT116 cells transfected with indicated constructs were treated with MG132 for 4 h before harvest. The cells were harvested and fractionated, cytoplasmic, or nuclear p53 was immunoprecipitated with anti-p53 polyclonal antibodies and immunoblotted with an anti-ha monoclonal antibody. (C) Bmi1 is required for Rnf2-mediated p53 ubiquitination. HCT116 cells transfected with indicated constructs were treated with MG132 for 4 h before harvest. p53 was immunoprecipitated with antip53 polyclonal antibodies and immunoblotted with monoclonal anti-ha or anti-p53 antibodies. 3of6

4 Fig. S4. Rnf2 regulates p53-mediated cell growth arrest and apoptosis in specific cells related to Fig. 4. (A and B) Rnf2 regulates cell growth through p53 pathway. (A) Tera-1 cells transfected with indicated constructs were fixed and stained as described. (B) Quantification of p-h3 positive cells in A. Error bars represent the SEM of triplicate experiments. **P < 0.01; *P < 0.05 two-tailed Student t test. (C and D) Rnf2 depletion does not cause G1 arrest and apoptosis in 293 andhelacells. HeLa or 293 cells transfected with indicated constructswere treated with puromycin for 3 d. Cells were then harvested andcell-cycle profiles or apoptosis were determined by FACS. 4of6

5 Fig. S5. Rnf2 regulates ovarian carcinoma cell growth through p53 related to Fig. 5. (A and B) Rnf2 regulates ovarian cancer cell growth. A2780 cells transfected with indicated constructs were plated, and cell numbers were then counted at the indicated time. (C) Cell cycle analysis of A2780 cells stably expressed with indicated shrnas. (D and E) Immunostaining of p-h3 was performed with A2780 cells transfected with the indicated shrna constructs. (E) Quantification of p-h3 positive cells in D. Error bars represent the SEM of triplicate experiments. **P < 0.01; *P < 0.05 two-tailed Student t test. (F) Rnf2 ubiquitinates p53 mutants. HCT116 cells (p53 negative) transfected with indicated constructs were treated with MG132 for 4 h before harvest. p53 mutants were immunoprecipitated with anti-myc polyclonal antibodies and immunoblotted with monoclonal anti-ha or anti-p53 antibodies. (G) Rnf2 interacts with p53 mutants. HCT116 cells (p53 negative) transfected with indicated constructs were lysed and subject to immunoprecipitation with antiflag monoclonal antibody. The immunoprecipitates were then blotted with the indicated polyclonal antibodies. 5of6

6 Table S1. Statistic analysis of Rnf2 expression in normal and ovarian carcinoma tissues Tissue types No. tissue samples Rnf2 positive (%) Rnf2 negative (%) Normal ovarian tissue 10 0 (0%) 10 (100%) Ovarian serous cystoadenoma (87.5%) 9 (12.5%) Ovarian mucinous carcinoma 10 9 (90%) 1 (10%) Ovarian clear cell carcinoma 5 3 (60%) 2 (40%) Rnf2 expression is up-regulated in ovarian carcinoma cells-related to Fig. 5. The table shows quantifications of Rnf2, p53, and Mdm2 expression levels in ovarian carcinoma samples. Table S2. Statistic analysis of p53 expression in normal and ovarian carcinoma tissues Tissue types No. tissue samples p53 positive (%) p53 negative (%) Normal ovarian tissue 10 Ovarian serous cystoadenoma (37.5%) 44 (61.1%) Ovarian mucinous carcinoma 10 1 (10%) 9 (90%) Rnf2 expression is up-regulated in ovarian carcinoma cells-related to Fig. 5. The table shows quantifications of Rnf2, p53, and Mdm2 expression levels in ovarian carcinoma samples. Table S3. Statistic analysis of Mdm2 expression in normal and ovarian carcinoma tissues Tissue types No. tissue samples Mdm2 normal (%) Mdm2 up-regulation (%) Normal ovarian tissue (100%) 0 (0%) Ovarian serous cystoadenoma (66.7%) 24 (33.3%) Ovarian mucinous carcinoma (100%) 0 (0%) Ovarian clear cell carcinoma 5 5 (100%) 0 (0%) Rnf2 expression is up-regulated in ovarian carcinoma cells-related to Fig. 5. The table shows quantifications of Rnf2, p53, and Mdm2 expression levels in ovarian carcinoma samples. 6of6

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko

More information

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

OPPF-UK Standard Protocols: Mammalian Expression

OPPF-UK Standard Protocols: Mammalian Expression OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

IMMUNOPRECIPITATION (IP)

IMMUNOPRECIPITATION (IP) 1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us

More information

Mitochondria/Cytosol Fractionation Kit

Mitochondria/Cytosol Fractionation Kit Mitochondria/Cytosol Fractionation Kit Sufficient for analysis of 50 samples Cat. No. MIT1000 FOR RESEARCH USE ONLY Not for use in diagnostic procedures. USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951)

More information

A General Protocol for GST Pull-down Lili Jing *

A General Protocol for GST Pull-down Lili Jing * A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down

More information

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).

Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA). 175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

The preparation of native chromatin from cultured human cells.

The preparation of native chromatin from cultured human cells. Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Mitochondrial DNA Isolation Kit

Mitochondrial DNA Isolation Kit Mitochondrial DNA Isolation Kit Catalog Number KA0895 50 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1

More information

GTTCGGGTTCC TTTTGAGCAG

GTTCGGGTTCC TTTTGAGCAG Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela

More information

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Garth Hamilton, Karen S. Yee, Simon Scrace, and Eric O Neill

Garth Hamilton, Karen S. Yee, Simon Scrace, and Eric O Neill Current Biology, Volume 19 Supplemental Data ATM Regulates a RASSF1A-Dependent DNA Damage Response Garth Hamilton, Karen S. Yee, Simon Scrace, and Eric O Neill Supplemental Experimental Procedures Tissue

More information

MEK1/2 (MAPK Kinase) Activity Assay Kit

MEK1/2 (MAPK Kinase) Activity Assay Kit MEK1/2 (MAPK Kinase) Activity Assay Kit For 96 tests Cat. No. SGT440 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0)

More information

Supplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock

Supplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Molecular Cell, Volume 49 Supplemental Information PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Dafne Campigli Di Giammartino, Yongsheng Shi, and James L. Manley Supplemental Information

More information

Cellular Fractionation

Cellular Fractionation Cellular Fractionation Lamond Lab Protocol 2007 More detailed protocol can be found here: http://www.lamondlab.com/f7nucleolarprotocol.htm This protocol has been adapted to fractionate a variety of different

More information

SUMOylated protein capture kit

SUMOylated protein capture kit SUMOylated protein capture kit Cat no. A010-100 Capture and detect SUMOylated proteins High capacity, high specificity SUMO binding matrix Fast, convenient protein isolation using purification system provided

More information

Supplementary Information

Supplementary Information Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Data Supplementary Figure Legends and Scheme Figure S1. Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,

More information

AmpliScribe T7-Flash Transcription Kit

AmpliScribe T7-Flash Transcription Kit AmpliScribe T7-Flash Transcription Kit Cat. Nos. ASF3257 and ASF3507 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA191E AmpliScribe T7-Flash Transcription Kit 12/2016 1 1. Introduction

More information

Supplemental Materials and Methods:

Supplemental Materials and Methods: Supplemental Materials and Methods: Cloning: Oligonucleotides used in the subcloning steps are listed in Supplemental Table 1. Human FANCI (isoform 1, KIAA1794) was subcloned from pcmv6-xl4 [FANCI] in

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

Department of Biochemistry and Molecular Biophysics, Columbia University, New York, USA

Department of Biochemistry and Molecular Biophysics, Columbia University, New York, USA RNA Chromatin Immunoprecipitation (RNA-ChIP) in Caenorhabditis elegans Germano Cecere * and Alla Grishok Department of Biochemistry and Molecular Biophysics, Columbia University, New York, USA * For correspondence:

More information

ab Ubiquitylation Assay Kit (HeLa lysate-based)

ab Ubiquitylation Assay Kit (HeLa lysate-based) ab139471 Ubiquitylation Assay Kit (HeLa lysate-based) Instructions for Use For the generation of ubiquitin-conjugated lysate proteins This product is for research use only and is not intended for diagnostic

More information

Myers Lab ChIP-seq Protocol v Modified January 10, 2014

Myers Lab ChIP-seq Protocol v Modified January 10, 2014 Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org

More information

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

Kinase Reaction and Alkylation Protocol

Kinase Reaction and Alkylation Protocol Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*

More information

Jae Myoung Suh, Daniel Zeve, Renee McKay, Jin Seo, Zack Salo, Robert Li, Michael Wang, and Jonathan M. Graff

Jae Myoung Suh, Daniel Zeve, Renee McKay, Jin Seo, Zack Salo, Robert Li, Michael Wang, and Jonathan M. Graff Cell Metabolism, Volume 6 Supplemental Data Adipose Is a Conserved, Dosage-Sensitive Antiobesity Gene Jae Myoung Suh, Daniel Zeve, Renee McKay, Jin Seo, Zack Salo, Robert Li, Michael Wang, and Jonathan

More information

96-well Checkpoint Kinase Activity Assay Kit

96-well Checkpoint Kinase Activity Assay Kit Product Manual 96-well Checkpoint Kinase Activity Assay Kit Catalog Number STA-414 STA-414-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a

More information

TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by

TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was

More information

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription

More information

Ni-NTA Agarose. User Manual. 320 Harbor Way South San Francisco, CA Phone: 1 (888) MCLAB-88 Fax: 1 (650)

Ni-NTA Agarose. User Manual. 320 Harbor Way South San Francisco, CA Phone: 1 (888) MCLAB-88 Fax: 1 (650) Ni-NTA Agarose User Manual 320 Harbor Way South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 871-8796 www. Contents Introduction -----------------------------------------------------------------------

More information

Technical tips Session 5

Technical tips Session 5 Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation

More information

mcherry Polyclonal Antibody Catalog Number PA Product data sheet

mcherry Polyclonal Antibody Catalog Number PA Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Polyclonal Antibody Catalog Number PA5-34974 Product data sheet Details Size

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

Intracellular receptors specify complex patterns of gene expression that are cell and gene

Intracellular receptors specify complex patterns of gene expression that are cell and gene SUPPLEMENTAL RESULTS AND DISCUSSION Some HPr-1AR ARE-containing Genes Are Unresponsive to Androgen Intracellular receptors specify complex patterns of gene expression that are cell and gene specific. For

More information

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine

More information

The Human Papillomavirus 16 E6 Protein Binds to Fas-associated Death Domain and Protects Cells from Fas-triggered Apoptosis*

The Human Papillomavirus 16 E6 Protein Binds to Fas-associated Death Domain and Protects Cells from Fas-triggered Apoptosis* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 279, No. 24, Issue of June 11, pp. 25729 25744, 2004 2004 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. The Human Papillomavirus

More information

Purification of cytoplasmic RNA from animal cells using the RNeasy Mini Kit

Purification of cytoplasmic RNA from animal cells using the RNeasy Mini Kit QIAGEN Supplementary Protocol: Purification of cytoplasmic RNA from animal cells using the RNeasy Mini Kit This protocol requires the RNeasy Mini Kit. IMPORTANT: Please consult the Safety Information and

More information

pdsipher and pdsipher -GFP shrna Vector User s Guide

pdsipher and pdsipher -GFP shrna Vector User s Guide pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

Geneaid DNA Isolation Kit (Yeast)

Geneaid DNA Isolation Kit (Yeast) Geneaid DNA Isolation Kit (Yeast) GEY100, GEY300 Advantages Sample: up to 2 10 8 yeast and other fungus species Yield: high yield, high quality DNA (A260/A280 = 1.8-2.0) Format: scalable DNA precipitation

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

E.Z.N.A. Tissue RNA Kit. R preps R preps

E.Z.N.A. Tissue RNA Kit. R preps R preps E.Z.N.A. Tissue RNA Kit R6688-00 5 preps R6688-01 50 preps May 2015 E.Z.N.A. Tissue RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Important Notes...4 Homogenization

More information

ChIP-chip protocol adapted for the mod-encode project

ChIP-chip protocol adapted for the mod-encode project ChIP-chip protocol adapted for the mod-encode project Version 1.2 : August 2007 Nicolas Nègre, Xiaochun Ni, Sergey Lavrov, Giacomo Cavalli and Kevin P. White University of Chicago, Department of Human

More information

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:

More information

RayBio Phospho- Akt (Ser473) ELISA Kit

RayBio Phospho- Akt (Ser473) ELISA Kit RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)

More information

Convoy TM Transfection Reagent

Convoy TM Transfection Reagent Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

Supporting Information. SI Material and Methods

Supporting Information. SI Material and Methods Supporting Information SI Material and Methods RNA extraction and qrt-pcr RNA extractions were done using the classical phenol-chloroform method. Total RNA samples were treated with Turbo DNA-free (Ambion)

More information

Cells and Tissue DNA Isolation Kit (Magnetic Bead System) 50 Preps Product # 59100

Cells and Tissue DNA Isolation Kit (Magnetic Bead System) 50 Preps Product # 59100 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cells and Tissue DNA Isolation Kit (Magnetic Bead System) 50 Preps

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 5.0 Rev 03/25/205 Table of Contents Introduction 2 Limitations of Use 2 Features 2 Applications 2 Storage 2

More information

E.Z.N.A. Blood DNA Mini Kit. D preps D preps D preps

E.Z.N.A. Blood DNA Mini Kit. D preps D preps D preps E.Z.N.A. Blood DNA Mini Kit D3392-00 5 preps D3392-01 50 preps D3392-02 200 preps January 2017 E.Z.N.A. Blood DNA Mini Kit Table of Contents Introduction and Overview...2 Illustrated Protocol...3 Kit Contents/Storage

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

NOTE ACRYLAMIDE IS NEUROTOXIN YOU MUST WEAR GLOVES.

NOTE ACRYLAMIDE IS NEUROTOXIN YOU MUST WEAR GLOVES. GST Purfication and Pulldown Part I Instructor: David Deitcher TA: Kristy Lawton In order to study the function of a protein it is often useful to have that protein purified away from others in the cell.

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein

More information

*Corresponding author. Tel: ;

*Corresponding author. Tel: ; 1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland

More information

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm) I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary

More information

Cells and Tissue DNA Isolation 96-Well Kit (Magnetic Bead System) Product # 62500

Cells and Tissue DNA Isolation 96-Well Kit (Magnetic Bead System) Product # 62500 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cells and Tissue DNA Isolation 96-Well Kit (Magnetic Bead System)

More information

Ral Activation Assay Kit

Ral Activation Assay Kit Product Manual Ral Activation Assay Kit Catalog Number STA-408 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family of

More information

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR)

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product

More information

Plasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only

Plasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only Plasmid Midiprep Plus Purification Kit Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only 1 Description: The Plasmid Midiprep Plus Purification Kit provides simple

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips) Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming

More information

Cytoplasmic & Nuclear RNA Purification Kit Product # 21000, 37400

Cytoplasmic & Nuclear RNA Purification Kit Product # 21000, 37400 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cytoplasmic & Nuclear RNA Purification Kit Product # 21000, 37400

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods 125 I-CXCL12 binding assay KG1 cells (2 10 6 ) were preincubated on ice with cold CXCL12 (1.6µg/mL corresponding to 200nM), CXCL11 (1.66µg/mL corresponding to 200nM),

More information

ab SIRT1 Activity Assay Kit (Fluorometric)

ab SIRT1 Activity Assay Kit (Fluorometric) ab156065 SIRT1 Activity Assay Kit (Fluorometric) Instructions for Use For the quantitative measurement of SIRT1 activity in cell lysates This product is for research use only and is not intended for diagnostic

More information

PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)

PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) 1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) DESCRIPTION Nickel NTA Magnetic Agarose Beads are products that allow rapid and easy small-scale purification of

More information

TECHNICAL BULLETIN NUCLEI EZ PREP NUCLEI ISOLATION KIT. Product Number NUC-101 Store at 2-8 C

TECHNICAL BULLETIN NUCLEI EZ PREP NUCLEI ISOLATION KIT. Product Number NUC-101 Store at 2-8 C NUCLEI EZ PREP NUCLEI ISOLATION KIT Product Number NUC-101 Store at 2-8 C TECHNICAL BULLETIN Product Description Sigma s Nuclei EZ Prep Kit is designed for the rapid isolation of nuclei from mammalian

More information

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a

More information

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No for preparation of 100 nucleic acid samples Cat. No. 1 796 88 Principle Cells are lysed during a short incubation with Proteinase K in the presence of a chaotropic salt (guanidine HCl), which immediately

More information

MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack

MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack Bioneer s magnetic nanobead-based solution for DNA/RNA extraction and purification 20150910 Ver.1(EN) MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack Fast, easy separation - Just

More information

For the rapid isolation of Mitochondrial DNA in various cell and tissue samples.

For the rapid isolation of Mitochondrial DNA in various cell and tissue samples. ab65321 Mitochondrial DNA Isolation Kit Instructions for Use For the rapid isolation of Mitochondrial DNA in various cell and tissue samples. This product is for research use only and is not intended for

More information

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5 Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation Application Note Authors Yoonseok Kam 1, Ned Jastromb 1, Joe Clayton, Paul Held, and Brian P. Dranka 1 1 Agilent

More information

YeaStar Genomic DNA Kit Catalog No. D2002

YeaStar Genomic DNA Kit Catalog No. D2002 Instructions YeaStar Genomic DNA Kit Catalog No. D2002 Table of Contents General Information...... 1 Package Contents Ordering Information General Description...... 2 Protocol I.......... 2 Protocol II.

More information