DNA-Sequencing. Technologies & Devices
|
|
|
- Merilyn May
- 6 years ago
- Views:
Transcription
1 DNA-Sequencing Technologies & Devices
2 Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/ Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/ Mb/23h, 800 nt reads Illumina MiSeq 1/2013 7,5 Gb/1d, 2x250 nt reads HiSeq /2013 2x300 Gb/10d, 2x100 nt reads 2x100 Gb/2d, 2x150 nt reads
3 Moore s law Next Generation Sequencing - a game changer
4 NGS Terminologies 2 nd generation = massively parallel 3 rd generation = true single-molecule
5 1 st Generation Maxam-Gilbert. Sanger. Pyro
6 Maxam-Gilbert sequencing Chemical modifications, radioactive *1977
7 Sanger sequencing Dideoxy chain termination, radioactive *1977 Fred Sanger Nobel prices 1958, 1980
8 Sanger sequencing Fluorescence labeling
9 Sanger sequencing Dye primer
10 Sanger sequencing Dye terminator
11 Sanger sequencing Engineered polymerase Thermo-Sequenase = Taq polymerase Phe>Thy mutated PNAS 92:6339 (1995)
12 Sanger sequencing Cycle sequencing
13 Pyrosequencing PPi ATP
14 2 nd Generation Roche/454. Illumina/Solexa. ABI/Solid ABI/IonTorrent. Complete Genomics
15 454 Genome Sequencer GS20/FLX/FLX+ A Revolutionary Method for Rapid Whole Genome Sequencing and Assembly And more..
16 454 Nature, July
17 454 Nature, July Mb 99% accuracy 4h de novo assembly Mycoplasma genitalium (0.58 Mb): 96% coverage, 99,96% accuracy 100x currant Sanger technology
18 Roche/454 Workflow
19 Roche/454 Preparation of A/B-fragments for sequencing dsdna fragments P Bio A P Ligation B Bio Fill in Bio Bio Bio Capture on SA-Beads & Wash Alkaline Elution A B
20 Roche/454 empcr
21 Roche/454 Sample loading
22 Roche/454 Flowgram
23 Roche/454 No cloning bias green reads red - Sanger reads black - GC content G+C % GC poor low-cloned coverage GC normal high-cloned coverage
24 Roche/454 Deep sequencing rare mutation detection T only C to T ratio: 1/500 Mutation Freq. Mutation Freq. Primer sequence Background subtracted 0.16% Coverage Coverage Primer sequence
25 Roche/454 Read length
26 Roche/454 Read length
27 Advanced genetic analysis one billion bases at a time
28 Solexa Technology Clonal Singe Molecule Array TM Sequencing By Synthesis (SBS) reversible fluorescent labels reversible 3 OH blocking
29 Illumina/Solexa Linker ligation
30 Illumina/Solexa Solid-phase clonal single molecule PCR Bridge amplification
31 Illumina/Solexa Solid-phase clonal single molecule PCR 100μm colony of 1000 singlestranded DNA templates Single well of 454 Life Sciences PicoTiterPlate TM (to same scale)
32 Illumina/Solexa Sequencing by synthesis (SBS) 1 st cycle 2 nd cycle * *removal of fluorescent labels & 3 OH blocking *
33 Illumina/Solexa Sequencing by synthesis (SBS) μm colony of 1000 singlestranded DNA templates
34 Illumina/Solexa Assembly - Mapping read length: nt
35 Illumina/Solexa Paired ends & Mate pairs
36 Illumina/Solexa Multiplexing
37 Illumina/Solexa Data output
38 Illumina/Solexa Patterned flow cells Two new platforms January 2014 NextSeq Gb/day 1 human genome or 16 exomes HiSeq X Ten 150 Gb/day 5 human genome at $1000 each Patent US A1 (2012)
39 Agencourt
40 ABI/SOLID Bead deposition
41 ABI/SOLID Probes 16
42 ABI/SOLID 2-base encoding 16 dinucleotides / 4 dyes = 4 dinucleotides/dye
43 ABI/SOLID 4-color ligation
44 ABI/SOLID 4-color ligation
45 ABI/SOLID Detection
46 ABI/SOLID Cleavage
47 ABI/SOLID 2 nd cycle ligation
48 ABI/SOLID 2 nd cycle detection
49 ABI/SOLID 2 nd cycle cleavage + additional 3 ligation cyles
50 ABI/SOLID Reset after 5 th cycle
51 ABI/SOLID 6 th cycle ligation
52 ABI/SOLID Cycling scheme
53 ABI/SOLID 2-base encoding
54 ABI/SOLID Paired ends two sequences
55
56 Complete Genomics In-house technology self-assembling DNA nanoballs (DNB) patterned nanoarrays combinatorial probe anchor ligation (cpal) Drmanac et al. Science 327:78 (2009)
57 Complete Genomics Performance launched by mid : 2011: ~600 human genomes ~4,000 genomes end 2011: genomes/month mid 2012: new machines with 6 genomes/day end 2012: <3,000 $/genome
58 PGM - Personal Genome Machine
59 ABI/Ion Torrent The chip is the machine ionogram
60 ABI/Ion Torrent Read length
61 ABI/Ion Torrent Data output
62 ABI/Ion Torrent Data output
63 ABI/Ion Torrent Post-light sequencing of Gordon Moore Nature 475:348 (2011)
64 2 nd Generation sequencing Applications Re-sequencing RNA-seq mirna-seq ChIP-seq Ribosome-footprinting
65 3 rd Generation Helicos. Pacific Biosciences VisigGen. Nanopore(s)
66
67 Helicos First true single molecule sequencing (tsms)
68 Helicos DRS Nature 461:814 (2009)
69
70 Pacific Biosciences Technologogies et al. : 2
71 Pacific Biosciences Fluorescent lable
72 Pacific Biosciences Immobilised polymerase long sequences
73 Pacific Biosciences Zero-mode waveguide chip
74 Pacific Biosciences Real-time DNA methylation detection Tex Nature Methods 7:461 (2010)
75 Pacific Biosciences Epigenetics
76 Pacific Biosciences Direct RNA sequencing
77 Pacific Biosciences Translation
78 VisiGen Fluorescence resonance energy transfer (FRET) F-donor : F-acceptor: polymerase γ-phosphate of dntp 1Mb/s >1 human genome/day visigenbio.com
79 Nanopore Ion current Messwert Strom von K + -Ionen, die der DNA beim Porendurchtritt entgegen fließen
80 IBM Waver pore
81 genome.fli-leibniz.de Lectures
DNA-Sequenzierung. Technologien & Geräte
DNA-Sequenzierung Technologien & Geräte Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 400 Mb/7h, 350 nt reads
DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
Human genome sequence
NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion
Third Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
Introduction to Next Generation Sequencing (NGS)
Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it
High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
Next Generation Sequencing. Simon Rasmussen Assistant Professor Center for Biological Sequence analysis Technical University of Denmark
Next eneration Sequencing Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark DNA Sequencing DNA sequencing Reading the order of bases in DNA fragments
Research school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias
Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand
Opportunities offered by new sequencing technologies
Opportunities offered by new sequencing technologies Pierre Taberlet Laboratoire d'ecologie Alpine CNRS UMR 5553 Université Joseph Fourier, Grenoble, France Nature Biotechnology, October 2008: special
Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture
The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles
CSC Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx By Anonymous. Similarity Index
Page 1 of 6 Document Viewer TurnitinUK Originality Report Processed on: 05-Dec-20 10:49 AM GMT ID: 13 Word Count: 1587 Submitted: 1 CSC8313-201 - Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx
INTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING'
INTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING' Bioinformàtica per a la Recerca Biomèdica Ricardo Gonzalo Sanz ricardo.gonzalo@vhir.org 14/12/2016 1. Introduction to NGS 2. First Generation
Next-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Vorlesung #
Thema Gentechnologie Erwin R. Schmidt Institut für Molekulargenetik Vorlesung #10 01. 07. 2014 Pyrosequenzierung The Pyrosequencing technology is a relatively new DNA sequencing method originally
Next Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
Biochemistry 412. New Strategies, Technologies, & Applications For DNA Sequencing. 12 February 2008
Biochemistry 412 New Strategies, Technologies, & Applications For DNA Sequencing 12 February 2008 Note: Scale is wrong!! (at least for sequences) 10 6 In 1980, the sequencing cost per finished bp $1.00
Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
Next Generation Sequencing Technologies
Next Generation Sequencing Technologies What is first generation? Sanger Sequencing DNA Polymerase Base-adding reaction +H + http://chemwiki.ucdavis.edu/organic_chemistry/organic_chemistry_with_a_biological_emphasis/chapter_10%3a_phosphoryl_transfer_reactions/section_10.4%3a_phosphate_diesters
Sequencing techniques and applications
I519 Introduction to Bioinformatics Sequencing techniques and applications Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Sequencing techniques Sanger sequencing Next generation
Welcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
High Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
BIOINFORMATICS 1 SEQUENCING TECHNOLOGY. DNA story. DNA story. Sequencing: infancy. Sequencing: beginnings 26/10/16. bioinformatic challenges
BIOINFORMATICS 1 or why biologists need computers SEQUENCING TECHNOLOGY bioinformatic challenges http://www.bioinformatics.uni-muenster.de/teaching/courses-2012/bioinf1/index.hbi Prof. Dr. Wojciech Makałowski"
Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
Bioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms
Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Laura Moya Andérico Master in Advanced Genetics Genomics Class December 16 th, 2015 Brief Overview First-generation
NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
Single Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
NEXT-GENERATION SEQUENCING AND BIOINFORMATICS
NEXT-GENERATION SEQUENCING AND BIOINFORMATICS Moore's law: the number of transistors in a dense integrated circuit doubles every two years Moore's law calculates and predicts the pace of improvement of
FGCZ NEWSLETTER FALL Next Generation Sequencing at the Functional Genomics Center Zurich
FGCZ NEWSLETTER FALL 2011 newsletter Technologies, Applications, and Access to Support Next Generation Sequencing at the Functional Genomics Center Zurich OVERVIEW 1 NGS AT THE FGCZ Technologies and organization
Published in: Next Generation Sequencing - Advances, Applications and Challenges DOI: /61964
Next-Generation Sequencing An Overview of the History, Tools, and Omic Applications Kulski, J. (2016). Next-Generation Sequencing An Overview of the History, Tools, and Omic Applications. In J. K. Kulski
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
MHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells
DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned
Next-Generation Sequencing for Biomedical Applications
University of New Mexico UNM Digital Repository Biomedical Sciences ETDs Electronic Theses and Dissertations 7-1-2013 Next-Generation Sequencing for Biomedical Applications Mingyan Xu Follow this and additional
Methods, Models & Techniques. High-throughput DNA sequencing concepts and limitations
High-throughput DNA sequencing concepts and limitations Martin Kircher and Janet Kelso Recent advances in DNA sequencing have revolutionized the field of genomics, making it possible for even single research
Introduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall
Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with
Next Generation Sequencing Technologies. Some slides are modified from Robi Mitra s lecture notes
Next Generation Sequencing Technologies Some slides are modified from Robi Mitra s lecture notes What will you do to understand a disease? What will you do to understand a disease? Genotype Phenotype Hypothesis
Amplicon Sequencing Template Preparation
Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The
NEXT GENERATION SEQUENCING: A REVOLUTION IN GENE SEQUENCING
NEXT GENERATION SEQUENCING: A REVOLUTION IN GENE SEQUENCING Ritesh Kaur and *Chander Parkash Malik School of Life Sciences, Jaipur National University, Jaipur, Rajasthan 302017, India *Author for Correspondence
Computational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
Lecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
Comparative genomics on gene and single nucleotide level
Technische Fakultät Center for Biotechnology (CeBiTec) Computational Genomics Comparative genomics on gene and single nucleotide level Zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften
Introductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
Next Generation Sequencing (NGS) Market Size, Growth and Trends ( )
Next Generation Sequencing (NGS) Market Size, Growth and Trends (2014-2020) July, 2017 4 th edition Information contained in this market report is believed to be reliable at the time of publication. DeciBio
Analysing genomes and transcriptomes using Illumina sequencing
Analysing genomes and transcriptomes using Illumina uencing Dr. Heinz Himmelbauer Centre for Genomic Regulation (CRG) Ultrauencing Unit Barcelona The Sequencing Revolution High-Throughput Sequencing 2000
Targeted Sequencing in the NBS Laboratory
Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February
RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
Sequencing and analysis of gene expression
Sequencing and analysis of gene expression Jiří Fajkus CG080 Methods of Genomics and Proteomics A = adenine C = cytosine G = guanine T = thymine R = G A (purine) Y = T C (pyrimidine) K = G T (keto) M
Introduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
Lecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
DNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
Bioanalytical chemistry. 6. DNA sequencing
123 Bioanalytical chemistry 6. DNA sequencing Some objectives for this section You will know how DNA was traditionally sequenced by 1 color, 4 lane methods You will know how DNA was traditionally sequenced
Next Generation Sequencing: An Overview
Next Generation Sequencing: An Overview Cavan Reilly November 13, 2017 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform Next generation
Lecture 18. PCR Technology. Growing PCR Industry
Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand
Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the
Genetic Fingerprinting
Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.
ACCEL-NGS 2S DNA LIBRARY KITS
ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries
Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales
Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology
KAPA HiFi Real-Time PCR Library Amplification Kit
Technical Data Sheet KAPA HiFi Real-Time PCR Library Amplification Kit 1. Product Description High fidelity PCR is used to selectively enrich library fragments carrying appropriate adaptor sequences and
Mate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
DNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
IMGM Laboratories GmbH. Sales Manager
IMGM Laboratories GmbH Dr. Jennifer K. Kuhn Sales Manager About IMGM Laboratories IMGM Laboratories was founded in 2001 IMGM operates as professional provider of advanced genomic services from research
The $100 Genome: Implications for the DoD
The $100 Genome: Implications for the DoD MITRE The $100 Genome: Implications for the DoD Contact: D, McMorrow - dmcmorrow@mitre.org December 2010 JSR-10-100 Approved for public release. Distribution unlimited
Chapter 3. Enzyme manipulation of DNA and RNA
Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA
Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center
Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping
Lab methods: Exome / Genome. Ewart de Bruijn
Lab methods: Exome / Genome 27 06 2013 Ewart de Bruijn Library prep is only a small part of the complete DNA analysis workflow DNA isolation library prep enrichment flowchip prep sequencing bioinformatics
How much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
Recombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
SUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
Next Generation Sequencing. Dylan Young Biomedical Engineering
Next Generation Sequencing Dylan Young Biomedical Engineering What is DNA? Molecule composed of Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Paired as either AT or CG Provides genetic instructions
KAPA Library Amplification Kit Illumina Platforms
KAPA Library Amplification Kit KR0408 v7.17 This provides product information and a detailed protocol for the KAPA Library Amplification Kits. This documents applies to KAPA Library Amplification Kits
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
Implementation of Ion AmpliSeq in molecular diagnostics
Implementation of Ion AmpliSeq in molecular diagnostics The Rotterdam Experience Ronald van Marion Deelnemersbijeenkomst SKML sectie Pathologie Amersfoort, 26 mei 2016 Molecular Diagnostics in Rotterdam
A window into third-generation sequencing
Human Molecular Genetics, 2010, Vol. 19, Review Issue 2 doi:10.1093/hmg/ddq416 Advance Access published on September 21, 2010 A window into third-generation sequencing R227 R240 Eric E. Schadt, Steve Turner
SYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
Intelligent DNA Chips: Logical Operation of Gene Expression Profiles on DNA Computers
Genome Informatics 11: 33 42 (2000) 33 Intelligent DNA Chips: Logical Operation of Gene Expression Profiles on DNA Computers Yasubumi Sakakibara 1 Akira Suyama 2 yasu@j.dendai.ac.jp suyama@dna.c.u-tokyo.ac.jp
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
Please purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
Illumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme
Illumina (Solexa) Current market leader Based on sequencing by synthesis Current read length 100-150bp Paired-end easy, longer matepairs harder Error ~0.1% Mismatch errors dominate Throughput: 4 Tbp in
Amplicon Library Preparation Method Manual. GS FLX Titanium Series October 2009
GS FLX Titanium Series 1. Workflow 3. Procedure The procedure to prepare Amplicon libraries is shown in Figure 1. It consists of a PCR amplification, performed using special Fusion Primers for the Genome
Sequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute
Sequencing Theory Brett E. Pickett, Ph.D. J. Craig Venter Institute Applications of Genomics and Bioinformatics to Infectious Diseases GABRIEL Network Agenda Sequencing Instruments Sanger Illumina Ion
Genetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
NEBNext. for Ion Torrent LIBRARY PREPARATION KITS
NEBNext for Ion Torrent LIBRARY PREPARATION KITS NEBNEXT PRODUCTS FOR ION TORRENT Table of Contents 3 General Introduction 4 5 6 6 7 8 DNA Library Preparation Workflow Product Selection Product Details
Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
Primer Design Ameer Effat M. Elfarash
Primer Design Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com PCR Cycle Each cycle (Round) of PCR contains 3 steps: 1- Denaturation 2- Primer annealing
HiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not