Chapter Fundamental Molecular Genetic Mechanisms

Size: px
Start display at page:

Download "Chapter Fundamental Molecular Genetic Mechanisms"

Transcription

1 Chapter Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise Synthesis of Proteins on Ribosomes 5.5 DNA Replication 5.6 DNA Repair and Recombination 5.7 Viruses: Parasites of the Cellular Genetic System

2 Why is it necessary? What do you want to do? Genetic engineering Basic understanding

3 Overview of four basic molecular genetic processes. Can you explain this picture?

4 Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids DNA and RNA structure and function Protein interaction affects DNA structure Three types of RNAs function in protein synthesis

5 Chemical directionality of a nucleic acid strand. Where are the 5 end and 3 end?

6 Chemical directionality of a nucleic acid strand. How to grow from 5 to 3?

7 Nucleotide structure

8 Nucleotide Which Which one direction is the will attacker? it be grown? 1. 5 => => 5 5 Electron attacks! 3

9 The DNA double helix. In 1953, James D. Watson and Francis H. C. Crick proposed DNA double-helical structure, based on analysis of DNA fiber x- ray diffraction patterns generated by Rosalind Franklin and Maurice Wilkins and Chargaff s revelation that the percentages of A=T and G=C. (a) Space-filling model of B DNA (the most common form of DNA in cells) bases (light shades) project inward from the sugar-phosphate backbones (dark red and blue) of each strand the major and minor grooves are lined by potential hydrogen bond donors and acceptors (yellow), which can interact with proteins and other molecules (b) Chemical structure of DNA double helix shows the two sugar-phosphate backbones and 2 hydrogen bonds in A-T and 3 hydrogen bonds in G-C base pairs. 5 to 3 1. Double helix 2. Major and minor grooves 3. 5 to 3 4. A-T, G-C

10 Major and minor grooves 1 2

11 G-C A-T binding What kind of bond?

12 Double helix

13 5 to 3 Comparison of A-Form and B-Form DNA. (a) B form of DNA: about 10.5 base pairs per helical turn; stacked base pairs are 0.34 nm apart (b) A form of DNA: 11 base pairs per turn, with a much deeper major groove and a much shallower minor groove than in B-form DNA. Removal of water changes the crystallographic structure from B to A. a shorter, more compact helical structure whose base pairs are not perpendicular to the helixaxis as in B-DNA.

14 Stability of DNA and RNA

15 Base-catalyzed hydrolysis of RNA. DNA is more stable than RNA and therefore a better carrier of genetic information. RNA is less stable because the 2ʹ-hydroxyl group in RNA (absent from deoxy DNA) can act as a nucleophile, attacking the phosphodiester bond and breaking the strand. The 2ʹ,3ʹ cyclic monophosphate product is further hydrolyzed to a mixture of 2ʹ and 3ʹ monophosphates.

16 Stability of DNA and RNA

17 DNA-protein complex A representative DNA binding protein. TATA binding protein (TBP)

18 How to know the site for transcription start? TATA Transcription start site DNA

19 TATA box A TATA box is a DNA sequence that indicates where a genetic sequence can be read and decoded. The TATA box is named for its conserved DNA sequence, which is most commonly TATAAA. Many eukaryotic genes have a conserved TATA box located base pairs before the transcription start site of a gene. TATA Transcription start site DNA

20 TATA binding protein TFIID in eukaryote

21 Interaction with a protein can bend DNA. The conserved C-terminal domain of the TATA box binding protein (TBP) binds to the minor groove of specific DNA sequences rich in A and T, untwisting and sharply bending the double helix. Transcription of most eukaryotic genes requires participation of TBP. Like clip!

22 Think the roles of DNA Which kind of structural changes are important? 1. Replication 2. Transcription

23 DNA melting Hydrogen bond How can you melt the dsdna? by raising temperature, which breaks the hydrogen bonds between base-paired bases. DNA strands unwind and separate ( denature / melt ) during replication and transcription by breaking the hydrogen bonds between base-paired bases.

24 How to easily detect the dsdna and ssdna? dsdna vs. ssdna UV absorption difference 260 nm Vs. Duplex DNA base pairs absorb less UV light than the unpaired bases in single-stranded DNA; duplex melting causes an increase in UV light absorption (hyperchromicity). 260 nm More free to absorb!

25 G C content of DNA affects melting temperature. G-C vs. A-T, which one is more critical for melting by temperature? The greater the G+C percentage, the higher the T m ; breaking the three G-C hydrogen bonds requires more energy than breaking the two A-T hydrogen bonds.

26 When can you use this knowledge? 1. Understanding the basic replication and transcription processes 2. DNA manipulation techniques 1. Cloning 2. Subcloning 3. PCR 4. DNA cutting Ex) PCR rx and G-C content

27 Macrostructure of DNA

28 Circular DNA

29 Topoisomerase I relieves torsional stress on DNA. Many linear (eukaryote genomes, viral DNAs) and circular (bacterial genomes, mitochondrial DNA) are subject to torsional stress developed during replication and transcription

30 How to separate the DNA by weight? Yes! Negative charge!!!

31 How to separate the DNA by weight? Yes! Negative charge!!!

32 DNA gel electrophoresis

33 Question: Which one moves faster? Circular Super-coiled

34 Secondary & tertiary structure of RNA

35 RNA secondary and tertiary structures. RNA has a hydroxyl at 2, uracil base instead of thymine, and usually is single-stranded. Ribozyme RNAs have catalytic activity based on tertiary structures formed by base paring. (a) Base pairing between distant complementary segments of an RNA molecule forms hairpins (5 10 nucleotide loop), stem-loops (11 100s of nucleotide loop), and other secondary structures, including pseudoknots that contribute to tertiary structure. (b) Pseudoknot: three diagrams of the human telomerase RNA core domain Left: Secondary-structure, with base-paired nucleotides in green and blue and singlestranded regions in red Middle: Sequence (colored to correspond to the secondary-structure diagram at the left) Right: 3D structure determined by 2D-NMR, showing paired bases and only a tube for the sugar phosphate backbone (colored to correspond to the diagrams at left)

36 Fundamental Molecular Genetic Mechanisms 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna DNA transcription Prokaryotic operon gene organization and regulation Eukaryotic gene organization and regulation

37 Which direction for RNA synthesis? RNA is synthesized 5ʹ 3ʹ. One gene DNA strand is template for transcription of an RNA by pairing complementary bases. RNA polymerase catalyzes phosphodiester bond formation between the 3ʹ oxygen of the growing strand and the α phosphate of a correctly base-paired rntp

38 Now it s time to think the steps of transcription! dsdna Complementary binding for transcription How is it possible here? RNA

39 Initiation: RNA polymerase melts DNA duplex to form a transcription bubble and begin polymerizing ribonucleotides (rntps) at the start site. Three stages in transcription.

40 Think the directions 5 3 dsdna sense 3 5 Antisense 5 3 sense RNA Protein

41 Elongation: Polymerase advances 3 5 down template strand polymerizing one rntp at a time onto the 3 end of growing RNA. The 5ʹ end of the RNA strand is displaced from the template DNA and exits through a channel in the RNA polymerase. [Separated strands in the region behind the moving RNA polymerasetranscription bubble reassociate into a double helix.] Three stages in transcription.

42 Termination is also important! ssdna ssdna Stuck here??!?!? RNA

43 Termination: RNA polymerase dissociates from the template DNA at a specific termination sequence (stop site). Three stages in transcription.

44 Bacterial RNA polymerase. RNA polymerases of bacteria, archaea, and eukaryotic cells are similar in structure and function. Composed of two related large subunits (βʹ and β), two copies of a smaller subunit (α), and one copy of a fifth subunit (ω) that is important in polymerase assembly and stability but is not essential for transcription, plus other smaller subunits in archaea and eukaryotes. Polymerase bends transcription bubble template DNA.

45 Bacterial transcription

46 How does the transcription look? Prokaryote Eukaryote

47 You can see Eukaryotic transcription in yeast Nascent pre-mrnas. The RNA processing machinery is contained inside structures called "terminal knobs" in nascent RNA transcripts. Terminal knobs are visible in this electron micrograph of chromatin spreads from yeast.

48 Gene organization in prokaryotes and in eukaryotes. (a) Bacterial (E. coli ) tryptophan (trp) operon: a continuous chromosome segment containing five genes (blue) that encode the enzymes necessary for the stepwise synthesis of tryptophan, in the order the enzymes function in the tryptophan synthesis pathway the entire operon is transcribed from one promoter into one long continuous trp mrna (red) mrna translation begins at five different start sites, yielding five proteins (green) (b) The five genes encoding the enzymes required for tryptophan synthesis in baker s yeast (Saccharomyces cerevisiae): on four different chromosomes each gene is transcribed from its own promoter to yield a primary transcript that is processed into a functional mrna encoding a single protein

49 Gene organization in prokaryotes and in eukaryotes. (a) Bacterial (E. coli ) tryptophan (trp) operon: a continuous chromosome segment containing five genes (blue) that encode the enzymes necessary for the stepwise synthesis of tryptophan, in the order the enzymes function in the tryptophan synthesis pathway the entire operon is transcribed from one promoter into one long continuous trp mrna (red) mrna translation begins at five different start sites, yielding five proteins (green) (b) The five genes encoding the enzymes required for tryptophan synthesis in baker s yeast (Saccharomyces cerevisiae): on four different chromosomes each gene is transcribed from its own promoter to yield a primary transcript that is processed into a functional mrna encoding a single protein

50 Operon In genetics, an operon is a functioning unit of genomic DNA containing a cluster of genes under the control of a single promoter. The genes are transcribed together into an mrna strand and either translated together in the cytoplasm

51 Tryptophan operon in E. Coli

52 Gene organization in prokaryotes and in eukaryotes. (a) Bacterial (E. coli ) tryptophan (trp) operon: a continuous chromosome segment containing five genes (blue) that encode the enzymes necessary for the stepwise synthesis of tryptophan, in the order the enzymes function in the tryptophan synthesis pathway the entire operon is transcribed from one promoter into one long continuous trp mrna (red) mrna translation begins at five different start sites, yielding five proteins (green) (b) The five genes encoding the enzymes required for tryptophan synthesis in baker s yeast (Saccharomyces cerevisiae): on four different chromosomes each gene is transcribed from its own promoter to yield a primary transcript that is processed into a functional mrna encoding a single protein

53 Structure of the 5ʹ methylated cap. Eukaryotic precursor mrnas are processed at both 5 and 3 ends to form functional mrnas. 5ʹ methylated cap added by enzymes as 5 end emerges from RNA polymerase protects mrna from enzymatic degradation, assists export to the cytoplasm, and is bound by a protein factor required to begin translation by a ribosome in the cytoplasm. 5ʹ 5ʹ linkage of 7-methylguanylate to the initial nucleotide of the mrna molecule and methyl group addition to the 2ʹ hydroxyl of the ribose of base 1 occur in all animal and higher plant cells yeasts lack the methyl group on base 1 vertebrate cells also methylate the base 2 ribose

54 3 modification & splicing RNA processing produces functional mrna in eukaryotes. 5ʹ cap: added during formation of the primary RNA transcript. Poly A tail: primary transcript is cleaved at a specific site downstream of the translation STOP codon and multiple ( ) A residues (not encoded by the gene DNA template) are added enzymatically by poly (A) polymerase poly(a) tail stabilizes mrnas in the nucleus and cytoplasm and is involved in mrna translation Splicing: removes introns and joins exons

55 Alternative splicing Alternative RNA splicing increases the number of protein isoforms expressed from a single eukaryotic gene. Fibronectin is a multifunctional extracellular matrix protein that is secreted from fibroblasts (connective tissue cells) and hepatocytes (liver cells).

56 DNA to RNA, then in next class Translation Replication

57 Discussion with friends 1. See the left graph and explain how the double stranded DNA changes its absorption at a certain point of temperature. 2. The same sequences of DNAs which have different structures, super-coiled and circular moved different differences in gel electrophoresis. How can you measure the right size (base pairs)? (Hint: Please find restriction enzyme). 3. What are the differences between the prokaryotic and eukaryotic transcriptions? Please read this article and answer the question RNA is less stable than DNA. How does mrna keep its stability? Discuss the mechanisms.

58 Etc ( 참고 )

59 G C content of DNA affects melting temperature. Duplex DNA base pairs absorb less UV light than the unpaired bases in single-stranded DNA; duplex melting causes an increase in UV light absorption (hyperchromicity).

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

Nucleic Acids: DNA and RNA

Nucleic Acids: DNA and RNA Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis. Chapter 4: Background DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)

NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix

Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Chapter 1 Structure of Nucleic Acids DNA The structure of part of a DNA double helix Deoxyribonucleic acid ) (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Molecular Genetics Student Objectives

Molecular Genetics Student Objectives Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

The Molecular Basis of Inheritance

The Molecular Basis of Inheritance The Molecular Basis of Inheritance Chapter 16 Objectives Describe the contributions of the following people: Griffith; Avery, McCary, and MacLeod; Hershey and Chase; Chargaff; Watson and Crick; Franklin;

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs. DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Transcription & post transcriptional modification

Transcription & post transcriptional modification Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

DNA Replication. Packet #17 Chapter #16

DNA Replication. Packet #17 Chapter #16 DNA Replication Packet #17 Chapter #16 1 HISTORICAL FACTS ABOUT DNA 2 Historical DNA Discoveries 1928 Frederick Griffith finds a substance in heat-killed bacteria that transforms living bacteria 1944 Oswald

More information

The Central Dogma of Molecular Biology

The Central Dogma of Molecular Biology The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

Overview: Life s Operating Instructions Concept 16.1: DNA is the genetic material The Search for the Genetic Material: Scientific Inquiry

Overview: Life s Operating Instructions Concept 16.1: DNA is the genetic material The Search for the Genetic Material: Scientific Inquiry Overview: Life s Operating Instructions In 1953, James Watson and Francis Crick introduced an elegant double-helical model for the structure of deoxyribonucleic acid, or DNA DNA, the substance of inheritance,

More information

AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review

AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review AP BIOLOGY RNA, DNA, & Proteins Chapters 16 & 17 Review Enzyme that adds nucleotide subunits to an RNA primer during replication DNA polymerase III Another name for protein synthesis translation Sugar

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College RNA and Protein Synthesis Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How

More information

Nucleic Acids: Structure and Function

Nucleic Acids: Structure and Function ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,

More information

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds.

RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. The Versatility of RNA Primary structure of RNA RNA is a single strand molecule composed of subunits called nucleotides joined by phosphodiester bonds. Each nucleotide subunit is composed of a ribose sugar,

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

DNA & Protein Synthesis UNIT D & E

DNA & Protein Synthesis UNIT D & E DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information

More information

DNA - DEOXYRIBONUCLEIC ACID

DNA - DEOXYRIBONUCLEIC ACID DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

Microbiology: The Blueprint of Life, from DNA to protein

Microbiology: The Blueprint of Life, from DNA to protein Microbiology: The Blueprint of Life, from DNA to protein I. Overview A. DNA ultimately determines every aspect of a cell from shape to function 1. DNA = 2. Nucleotides of DNA have three units a. A nitrogen-containing

More information

Chapter 9: DNA: The Molecule of Heredity

Chapter 9: DNA: The Molecule of Heredity Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of

More information

Hershey & Chase Avery, MacLeod, & McCarty DNA: The Genetic Material

Hershey & Chase Avery, MacLeod, & McCarty DNA: The Genetic Material DA: The Genetic Material Chapter 14 Griffith s experiment with Streptococcus pneumoniae Live S strain cells killed the mice Live R strain cells did not kill the mice eat-killed S strain cells did not kill

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

CHAPTER 16 MOLECULAR BASIS OF INHERITANCE

CHAPTER 16 MOLECULAR BASIS OF INHERITANCE CHAPTER 16 MOLECULAR BASIS OF INHERITANCE DNA as genetic material? Deducted that DNA is the genetic material Initially worked by studying bacteria & the viruses that infected them 1928 Frederick Griffiths

More information

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps

More information

DNA Structure and Protein synthesis

DNA Structure and Protein synthesis DNA Structure and Protein synthesis What is DNA? DNA = deoxyribonucleic acid Chromosomes are made of DNA It carries genetic information: controls the activities of cells by providing instructions for making

More information

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.

Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t. BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid

More information

The replication of DNA Kornberg 1957 Meselson and Stahl 1958 Cairns 1963 Okazaki 1968 DNA Replication The driving force for DNA synthesis. The addition of a nucleotide to a growing polynucleotide

More information

DNA, RNA and Protein Synthesis

DNA, RNA and Protein Synthesis By the end of this lesson, I can Relate how Griffith s bacterial experiments showed that a hereditary factor was involved in transformation. Summarize how Avery s experiments led his group to conclude

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date

Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing

More information

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

More information

DNA Replication and Protein Synthesis

DNA Replication and Protein Synthesis DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.

4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e. 1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.

More information

DNA Structure and Replication, and Virus Structure and Replication Test Review

DNA Structure and Replication, and Virus Structure and Replication Test Review DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

MOLECULAR BASIS OF INHERITANCE

MOLECULAR BASIS OF INHERITANCE MOLECULAR BASIS OF INHERITANCE C H A P T E R 1 6 as genetic material? Deducted that is the genetic material Initially worked by studying bacteria & the viruses that infected them 1928 Frederick Griffiths

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12

More information

Frederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria

Frederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria Frederick Griffith Live Smooth Bacteria Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S Bacteria Live Smooth Bacteria Frederick Griffith Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Exam 2 BIO200, Winter 2012

Exam 2 BIO200, Winter 2012 Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

THE COMPONENTS & STRUCTURE OF DNA

THE COMPONENTS & STRUCTURE OF DNA THE COMPONENTS & STRUCTURE OF DNA - How do genes work? - What are they made of, and how do they determine the characteristics of organisms? - Are genes single molecules, or are they longer structures made

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

RNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm

RNA synthesis/transcription I Biochemistry 302. February 6, 2004 Bob Kelm RNA synthesis/transcription I Biochemistry 302 February 6, 2004 Bob Kelm Overview of RNA classes Messenger RNA (mrna) Encodes protein Relatively short half-life ( 3 min in E. coli, 30 min in eukaryotic

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

Friday, April 17 th. Crash Course: DNA, Transcription and Translation. AP Biology

Friday, April 17 th. Crash Course: DNA, Transcription and Translation. AP Biology Friday, April 17 th Crash Course: DNA, Transcription and Translation Today I will 1. Review the component parts of a DNA molecule. 2. Describe the process of transformation. 3. Explain what is meant by

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Answers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth.

Answers to Module 1. An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. Answers to Module 1 Short Answers 1) What is an obligate aerobe? An obligate aerobe is an organism that has an absolute requirement of oxygen for growth. What about facultative anaerobe? 2) Distinguish

More information

Storage and Expression of Genetic Information

Storage and Expression of Genetic Information Storage and Expression of Genetic Information 29. DNA structure, Replication and Repair ->Ch 25. DNA metabolism 30. RNA Structure, Synthesis and Processing ->Ch 26. RNA metabolism 31. Protein Synthesis

More information

Gene Expression - Transcription

Gene Expression - Transcription DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making

More information

C. Incorrect! Threonine is an amino acid, not a nucleotide base.

C. Incorrect! Threonine is an amino acid, not a nucleotide base. MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information