2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?

Size: px
Start display at page:

Download "2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?"

Transcription

1 2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics and Genomics Allow us to analyze gene sequences and expression levels of all genes in an organisms. In many cases, simultaneously. This allows us to study how this varies in: the animal kingdom, in populations, individuals, in cell types, and in health and disease. How do we do analyze gene expression and sequences?? What have we learned from this so far? What could we learn in the future? 1

2 Key Features of Transcription (making RNA from DNA) ~ 30,000 human genes ~ 150,000 (?) human mrnas - a rough estimate Promoter which controls levels, cell specificity and temporal aspects of transcription gene Genomic DNA DNA Transcription pre-mrna Alternative Splicing mrna Transcription mrna transcript Genome Transcriptome (for protein coding RNAs) Human 30,000 genes 150,000 unique mrnas Alternative splicing of mrnas! Alternative splicing yields different mrnas and protein isoforms Gene Introns = Intervening regions ATG Gene TAA Exons = oding regions Transcription Transcription Nuclear pre-mrna The Processed or mature cytoplasmic mrna Splicing: removal of introns Translation: of mature mrna E1 E2 E4 Alternative Splicing Translation E1 E3 E4 Alternatively spliced mrnas Encoded protein Protein 1 Protein 2 Unique protein isoforms 2

3 ! Measuring the abundance of a specific gene s mrna transcripts Northern blotting can be used to detect specific mrnas Investigating gene expression: 2. Measuring changes in gene expression via mrna 1. Separate total RNA by gel electrophoresis 2. Transfer the separated RNAs out of the gel and onto a nylon membrane (85%) Nylon membrane Agarose gel Electroblotting drives the RNA out of the gel and onto the membrane! Detecting the mrna transcripts of a specific gene (DNA probe hybridization) Hybridize to a labeled DNA of the gene of interest needs to be labelled e.g. with radioactive 32 P Northern Blot analysis of two plant mrnas during flower development mrna bands detected by the Gene1 and Gene2 probes Time (days) Using DNA complimentary to the mrnas (cdna) mrna Gene 1 mrna Gene 2 Gene1 and Gene 2 show developmentally regulated expression during flower development 3

4 ! Reverse transcriptase makes DNA from an RNA template polya tail (almost all mrnas have one)! Measuring the abundance of mrnas via amplification of cdna Reverse Transcription-PR (RT-PR) Add oligo dt primer Add Reverse transcriptase Quantifies mrna indirectly via PR amplification of cdna copies Heart Lung Kidney Liver Brain Reverse transcription Amplified cdna Gene 1: Kinase Amplified cdna Gene 2: Actin Add RNAse H DNA polymerase Microarrays to measure changes in gene expression across the whole genome! Using DNA microarrays for genome-wide analyses of gene expression A 2-D microarray of oligonucleotide probes representing each gene in the genome 30,000 50,000 oligonucleotide probes per microarray (DNA chip) Each probe spot has a defined location in the array Extract RNA from each sample Oligonucleotide probes fixed to chip surface Reverse transcribe RNA to cdna Gene 1 Gene 2 Red label Green label Sample A cdna labelled with Red fluorophore Sample B cdna labelled with Green fluorophore 4

5 ! Microarray hybridization and processing! Microarray example I: How does gene expression differ between normal cells vs. cancer cells? Labelled cdnas cdna hybridization to specific array probes Genes that are upregulated in cancer.cells are potential drug targets Microarray probes The gene expression profile may be diagnostic for particular cancer sub-types and aid diagnosis Data analysis Measurement of fluorescence yield for each gene probe Laser excitation of hybridized cdna Hybridize to microarray Identify gene expression differences etc Microarrays are typically used for sampling expression of relatively small numbers of diagnostic genes. They are also used to screen a panel of diagnostic mutations mrna profiling is now via large scale cdna sequencing (costs falling!). Affymetrix (microarrays) DNA sequencing Illumina (NextGen Sequencing) 5

6 ! Determining the base sequence of a DNA molecule Key to Sanger sequencing is the development of di-deoxynucleotides to terminate chain synthesis (and gels to resolve DNA fragments of similar size) DNA sequencing today generally uses the Sequencing by synthesis method Sequencing by synthesis was developed by Fred Sanger G H H Fred Sanger G Deoxy G PPi (pyrophosphate) Dideoxy G The absence of the 3 -OH group in a di-deoxy nucleotide prevents further elongation of the chain It terminates chain synthesis! General principle of sequencing by synthesis! Fluorescently-labelled dideoxynucleotides made sequencing more efficient The site to which the primer anneals defines the start point Use a radio-labelled primer Add dntps and DNA polymerase to extend the primer Separate the newly synthesized DNA strands by size using gel electrophoresis through a polyacrylamide gel Use autoradiography to reveal the newly-synthesized DNA strands Template strand 3 -GGTATTAAAAGGTGTAAATTAGGGA-5 5 -AGTGGAA Primer T G A Smallest DNA molecules Laser causes bands to fluorescence ombine the 4 reactions Separate fragments on a gel analysis Each dideoxynucleotide is tagged with a unique colored fluorophore Electropherogram 6

7 2/5/16 Pyrophosphate Sequencing Mostafa Ronaghi, Mathias Uhlén and Pål Nyrén* Based on detecting pyrophosphate released during DNA extension Next-Generation Sequencing Very fast, parallel short reads of Millions of (35-400bp) sequences reads. Roche/454 Illumina/Solexa Life Technologies/ABI G Pyrogram (sequencing from a template) PPi (pyrophosphate) Helicos Pacific Biosciences omplete Genomics The first cycle in a round of Solexa sequecing Solexa/illumina uses clusters of single DNA molecule. Shotgun sequencing Your genome sequence for $ Sequence millions of small random fragments (10X coverage). omputers assemble the sequence 7

8 Human Genomics To identify mutations for disease, disease resistance, drug sensitivity, and traits Phenylketonuria! Sequenced genomes.. List_of_sequenced_eukaryotic_genomes Why? R5 delta 32 mutation confers" resistance to Aids" Understand biodiversity, mechanisms, (develop drugs) industrial proteins etc. stephen_friend_the_hunt_for_unexpected_genetic_heroes? language=en Gene Prospecting Sargasso Sea 200 litres of water. Filter (multiple steps) Extract DNA Shot gun sequence Assemble / compare. 1 ml of water as 1 million bacteria, 10 million viruses. Identified ,000 species of bacteria 1.2 million new genes (and doubled the number of protein families known)

9 2/5/16 Synthetic Biology Synthia: the artificial bacterium Mycoplasma mycoides 1,200,000 bp Hamilton O Smith raig Venter Undergraduate Members: Team Ben Wilson, Patrick King, David Fallon, Arnas Petraukas, Daire Gannon, Emma ooke, Remsha Afzal, Zaneta Najda, Marlena Mucha, Anya Aleshko. Apr 25, 2015 Nov 01, 2015 Trinity Undergraduates Aim to Build AntiMalarial 'Biobrick.' Members of the Genetics Department amongst winners of International Genetically Engineered Machine (igem) competition. Trinity ollege Dublin igem 2015 Project Introduction 9

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?

More information

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated

More information

Research school methods seminar Genomics and Transcriptomics

Research school methods seminar Genomics and Transcriptomics Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence

More information

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

CSC Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx By Anonymous. Similarity Index

CSC Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx By Anonymous. Similarity Index Page 1 of 6 Document Viewer TurnitinUK Originality Report Processed on: 05-Dec-20 10:49 AM GMT ID: 13 Word Count: 1587 Submitted: 1 CSC8313-201 - Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Quiz Submissions Quiz 4

Quiz Submissions Quiz 4 Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

Next Generation Sequencing. Simon Rasmussen Assistant Professor Center for Biological Sequence analysis Technical University of Denmark

Next Generation Sequencing. Simon Rasmussen Assistant Professor Center for Biological Sequence analysis Technical University of Denmark Next eneration Sequencing Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark DNA Sequencing DNA sequencing Reading the order of bases in DNA fragments

More information

Genetic Fingerprinting

Genetic Fingerprinting Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.

More information

Additional Activity: Sanger Dideoxy Sequencing: A Simulation Activity

Additional Activity: Sanger Dideoxy Sequencing: A Simulation Activity Student Worksheet Additional Activity: Sanger Dideoxy Sequencing: A Simulation Activity LSM 6.3-7 In 1977, Frederick Sanger developed a method by which the nucleotide sequence of a DNA fragment could be

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Chapter 20: Biotechnology 1. DNA Sequencing 2. DNA Cloning 3. Studying Gene Expression 4. Manipulating Genomes 5. herapeutic & Diagnostic echniques 1. DNA Sequencing Chapter Reading pp. 409-412 DNA Sequencing

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,

More information

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

More information

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,

More information

DNA-Sequenzierung. Technologien & Geräte

DNA-Sequenzierung. Technologien & Geräte DNA-Sequenzierung Technologien & Geräte Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 400 Mb/7h, 350 nt reads

More information

Sequencing the Human Genome

Sequencing the Human Genome The Biotechnology 339 EDVO-Kit # Sequencing the Human Genome Experiment Objective: In this experiment, DNA sequences obtained from automated sequencers will be submitted to Data bank searches using the

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss

More information

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics

More information

DNA-Sequencing. Technologies & Devices

DNA-Sequencing. Technologies & Devices DNA-Sequencing Technologies & Devices Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 800 Mb/23h, 800 nt reads

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

Biochemistry 412. New Strategies, Technologies, & Applications For DNA Sequencing. 12 February 2008

Biochemistry 412. New Strategies, Technologies, & Applications For DNA Sequencing. 12 February 2008 Biochemistry 412 New Strategies, Technologies, & Applications For DNA Sequencing 12 February 2008 Note: Scale is wrong!! (at least for sequences) 10 6 In 1980, the sequencing cost per finished bp $1.00

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

Exam 2 BIO200, Winter 2012

Exam 2 BIO200, Winter 2012 Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide

More information

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

Student Learning Outcomes (SLOS)

Student Learning Outcomes (SLOS) Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017 Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I

More information

Lecture 8: Sequencing and SNP. Sept 15, 2006

Lecture 8: Sequencing and SNP. Sept 15, 2006 Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics

More information

Goals of pharmacogenomics

Goals of pharmacogenomics Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion

More information

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality

More information

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology. SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

DNA sequencing. Course Info

DNA sequencing. Course Info DNA sequencing EECS 458 CWRU Fall 2004 Readings: Pevzner Ch1-4 Adams, Fields & Venter (ISBN:0127170103) Serafim Batzoglou s slides Course Info Instructor: Jing Li 509 Olin Bldg Phone: X0356 Email: jingli@eecs.cwru.edu

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs?

2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs? 2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs? Answer: edna is made from mrna and not from trnas or rrnas because polyt primers are used to prime the first

More information

Human genome sequence

Human genome sequence NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

LECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING

LECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING Page 1 of 25 Chapter 5 Notes Biochemistry 461 Fall 2010 CHAPTER 5, EXPLORING GENES: LECTURE TOPICS 1) RESTRICTION ENZYMES 2) GEL ELECTROPHORESIS OF DNA 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Introduction to Next Generation Sequencing (NGS)

Introduction to Next Generation Sequencing (NGS) Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Product Name : Simple mirna Detection Kit

Product Name : Simple mirna Detection Kit Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components

More information

HiPer Real-Time PCR Teaching Kit

HiPer Real-Time PCR Teaching Kit HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from

More information

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Sensitivity vs Specificity

Sensitivity vs Specificity Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome

More information

Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD

Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints

More information

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230 mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR

More information

Advanced Techniques. Electrophoresis, PCR, Southern Blot, Sequencing, RFLPs, Microarrays. AP Biology

Advanced Techniques. Electrophoresis, PCR, Southern Blot, Sequencing, RFLPs, Microarrays. AP Biology Advanced Techniques Electrophoresis, PCR, Southern Blot, Sequencing, RFLPs, Microarrays 1 Gel Electrophoresis Separation of DNA fragments by size DNA is negatively charged moves toward + charge in electrical

More information

Outline. Array platform considerations: Comparison between the technologies available in microarrays

Outline. Array platform considerations: Comparison between the technologies available in microarrays Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

Next Gen Sequencing. Expansion of sequencing technology. Contents

Next Gen Sequencing. Expansion of sequencing technology. Contents Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND

More information

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not

More information

1. A brief overview of sequencing biochemistry

1. A brief overview of sequencing biochemistry Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

Different types of PCR and principles of Real Time PCR. Prof. Dr. Hamdy M. El-Aref Assiut University, Faculty of Agriculture Genetics Department

Different types of PCR and principles of Real Time PCR. Prof. Dr. Hamdy M. El-Aref Assiut University, Faculty of Agriculture Genetics Department Different types of PC and principles of eal Time PC. Prof. Dr. Hamdy M. El-Aref Assiut University, Faculty of Agriculture Genetics Department I N T O D U C T I O N PC Cycle (round) I N T O D U C T I O

More information