NOTES Gene Expression ACP Biology, NNHS
|
|
- Jasper Tate
- 6 years ago
- Views:
Transcription
1 Name Date Block NOTES Gene Expression ACP Biology, NNHS Model 1: Transcription the process of genes in DNA being copied into a messenger RNA 1. Where in the cell is DNA found? 2. Where in the cell does transcription take place? 3. What enzyme is required for transcription? (HINT: Enzyme names usually end in ase.) 4. Does the enzyme move in one direction or two directions? 5. What polymer (long chain) is synthesized during transcription? 6. What monomers (single units) are used to construct this polymer? 7. Is DNA double or single stranded? 8. Is RNA double or single stranded? N. Berg, NNHS Page 1
2 9. What are the four bases found in DNA? 10. What are the four bases found in RNA? 11. When a DNA strand has an A what base is opposite it on the growing RNA strand? 12. When a DNA strand has a T what base is opposite it on the growing RNA strand? 13. When a DNA strand has a C what base is opposite it on the growing RNA strand? 14. When a DNA strand has a G what base is opposite it on the growing RNA strand? 15. If a DNA strand reads A T C G G A, then what would the transcribed RNA read? CRITICAL THINKING: 16. Nearly all cells in an organism contain identical DNA, and each DNA strand may contain hundreds or thousands of individual genes. Is it likely that a cell would transcribe all the genes within its nucleus at same time? 17. Considering the many types of cells in a multicellular organism, and their different functions, is it likely that all cells transcribe all their genes at some point in their lifetime? Page 2
3 Model 2: mrna Processing Non-coding regions; they do not provide instructions for a protein. Coding regions; they do provide instructions to make a protein. 18. What are the coding regions of the RNA called? 19. What are the non-coding regions of the RNA called? 20. Before the mrna strand can exit the nucleus, it must be processed. Compare the pre-mrna strand to the mrna strand that is leaving the nucleus. a. What has been removed from the pre-mrna to make it into mrna? b. What has been added to the 5 end of the mrna? c. What has been added to the 3 end of the mrna? 21. The mrna leaves the nucleus through what structure? 22. The nucleotides on the mrna will be later read by a ribosome. What sequence of bases indicates the starting point of the instructions? CRITICAL THINKING: 23. The m in mrna is short for messenger. Why is this molecule called messenger RNA? Page 3
4 Read This! The methyl 5 cap helps the mrna molecule move through the nuclear pore and attach to a ribosome. mrna is a short-lived molecule. Once in the cytoplasm the mrna will be subject to exonucleases that immediately start to remove individual nucleotides from the 3 end of a mrna. The free nucleotides will then be free to be used again during transcription. 24. What are the two jobs of a methyl 5 cap? 25. What do exonucleases do to the mrna in the cytoplasm of the cell? CRITICAL THINKING: 26. What is the advantage of the poly-a tail added to the 3 end of the mrna? 27. Different mrna molecules can have poly-a tails of different lengths. Considering the purpose of adding the poly-a tail (from the previous question), why are some tails longer than others? Page 4
5 Model 3: Translation the process of the ribosome reading and carrying out instructions on mrna in order to build a protein. Codon 28. What do the letters U, C, A, and G in Model 3 represent? 29. What do the abbreviations such as Cys, Ala, and Gly in Model 1 represent? 30. How many nucleotides make up a single codon? 31. What amino acid does UUU code for? 32. How many different codons code for the amino acid Proline (Pro)? 33. Compare all of the codons for Proline (Pro). a. How are these codons similar? b. How are these codons different? CRITICAL THINKING 34. Considering that mistakes can occur during transcription, what advantage is there for an organism to have multiple mrna sequences code for the same amino acid? Page 5
6 Codon 35. How does the ribosome know when the instructions for making the protein begin? 36. How many start codons are there? 37. According to the codon chart, what amino acid is at the beginning of every protein? 38. How does the ribosome know when the instructions for making the protein are done? 39. How many stop codons are there? 40. Using the codon chart above and complementary base pairing rules during transcription, complete the following: DNA: T A C C T T C G G A T G G T C A C T mrna: Protein: (chain of amino acids) Page 6
7 Model 4: The Whole Picture How to make a protein. Nuclear membrane transferrna (trna) brings amino acids to the ribosome Ribosome reads the instructions on the mrna and builds the protein Cell membrane 41. What organelle reads the mrna and builds the protein? 42. What molecule brings amino acids to the ribosome? Page 7
Gene Expression Transcription
Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction
More informationTranscription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016
Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationTranscription and Translation
Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationThr Gly Tyr. Gly Lys Asn
Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human
More informationFrom Gene to Protein Transcription and Translation
Name: Hour: From Gene to Protein Transcription and Translation Introduction: In this activity you will learn how the genes in our DNA influence our characteristics. For example, how can a gene cause albinism
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationProtein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationFrom Gene to Protein Transcription and Translation i
How do genes influence our characteristics? From Gene to Protein Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different
More informationStudent Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13
http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationFrom Gene to Protein via Transcription and Translation i
How do genes influence our characteristics? From Gene to Protein via Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationDo you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
More informationActivity A: Build a DNA molecule
Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationCHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION
CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis
More informationCh 10.4 Protein Synthesis
Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains
More informationTRANSCRIPTION AND TRANSLATION
TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationGene Expression. Student:
Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the
More informationStudy Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis
Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationDNA/RNA. Transcription and Translation
DNA/RNA Transcription and Translation Review DNA is responsible for controlling the production of proteins in the cell, which is essential to life DNA RNA Proteins Chromosomes contain several thousand
More informationProtein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
More informationProtein Synthesis. Lab Exercise 12. Introduction. Contents. Objectives
Lab Exercise Protein Synthesis Contents Objectives 1 Introduction 1 Activity.1 Overview of Process 2 Activity.2 Transcription 2 Activity.3 Translation 3 Resutls Section 4 Introduction Having information
More informationProblem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.
Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose
More information2. The instructions for making a protein are provided by a gene, which is a specific segment of a molecule.
From Gene to Protein Transcription and Translation By Dr. Ingrid Waldron and Dr. Jennifer Doherty, Department of Biology, University of Pennsylvania, Copyright, 2011 1 In this activity you will learn how
More informationGene Expression REVIEW Packet
Name Pd. # Gene Expression REVIEW Packet 1. Fill-in-the-blank General Summary Transcription & the Big picture Like, ribonucleic acid (RNA) is a acid a molecule made of nucleotides linked together. RNA
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationStandards: SC.912.L.16.5: Explain the basic processes of transcription and translation, and how they result in the expression of genes.
Delicious DNA: Transcription and Translation Simulation Using an Edible Model Authors: Darcy Holoweski and Catherine Quist Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation,
More informationNucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationFour different segments of a DNA molecule are represented below.
Four different segments of a DNA molecule are represented below. There is an error in the DNA in which molecule? A. segment 1 only B. segment 3 only C. segment 2 and 3 D. segment 2 and 4 Explain the basic
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationProtein Synthesis: Transcription and Translation
Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationDaily Agenda. Warm Up: Review. Translation Notes Protein Synthesis Practice. Redos
Daily Agenda Warm Up: Review Translation Notes Protein Synthesis Practice Redos 1. What is DNA Replication? 2. Where does DNA Replication take place? 3. Replicate this strand of DNA into complimentary
More informationWhat is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
More informationComparing RNA and DNA
RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd
More informationClick here to read the case study about protein synthesis.
Click here to read the case study about protein synthesis. Big Question: How do cells use the genetic information stored in DNA to make millions of different proteins the body needs? Key Concept: Genetics
More informationDNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA 18 Lecture: DNA Structure Worksheet 19 Lecture:
More informationNeurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants
Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are
More informationSTUDY GUIDE SECTION 10-1 Discovery of DNA
STUDY GUIDE SECTION 10-1 Discovery of DNA Name Period Date Multiple Choice-Write the correct letter in the blank. 1. The virulent strain of the bacterium S. pneumoniae causes disease because it a. has
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More information6. Which nucleotide part(s) make up the rungs of the DNA ladder? Sugar Phosphate Base
DNA Unit Review Worksheet KEY Directions: Correct your worksheet using a non blue or black pen so your corrections can be clearly seen. DNA Basics 1. Label EVERY sugar (S), phosphate (P), and nitrogen
More informationDNA & Protein Synthesis #21
Name: Period: Date: Living Environment Lab DNA & Protein Synthesis #21 Introduction Of all the molecules that is in the body, DNA is perhaps the most important. DNA or dioxiribosenucleic acid is important
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationDNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video
DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA Create Tellegami or 18 Lecture: DNA Structure
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationRead and take notes on pages
Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have
More informationDNA REPLICATION REVIEW
Biology Ms. Ye DNA REPLICATION REVIEW 1. Number the steps of DNA replication the correct order (1, 2, 3): Name Date Block Daughter strands are formed using complementary base pairing DNA unwinds The DNA
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More information2. Examine the objects inside the box labeled #2. What is this called? nucleotide
Name Date: Period: Biology: DNA Review Packet Read each question and fill in the proper answer. 1. Label EVERY sugar (S), phosphate (P), and nitrogen base (A, T, C, G) in the diagram below. #2 2. Examine
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationDNA & Protein Synthesis UNIT D & E
DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information
More informationCreate a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function.
HASPI Medical Biology Lab 0 Purpose Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function. Background http://mssdbio.weebly.com/uploads/1//7/6/17618/970_orig.jpg
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More information1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
More informationGene Expression Translation U C A G A G
Why? ene Expression Translation How do cells synthesize polypeptides and convert them to functional proteins? The message in your DN of who you are and how your body works is carried out by cells through
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationPauling/Itano Experiment
Chapter 12 Pauling/Itano Experiment Linus Pauling and Harvey Itano knew that hemoglobin, a molecule in red blood cells, contained an electrical charge. They wanted to see if the hemoglobin in normal RBC
More informationComponents of DNA. Components of DNA. Aim: What is the structure of DNA? February 15, DNA_Structure_2011.notebook. Do Now.
Aim: What is the structure of DNA? Do Now: Explain the Hershey Chase experiment and what was its conclusion? Homework Read pp. 298 299 P.299 3,4,6.7 Do Now Paperclip Combos Material: 8 paperclips, 2 each
More informationThe common structure of a DNA nucleotide. Hewitt
GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationIf Dna Has The Instructions For Building Proteins Why Is Mrna Needed
If Dna Has The Instructions For Building Proteins Why Is Mrna Needed if a strand of DNA has the sequence CGGTATATC, then the complementary each strand of DNA contains the info needed to produce the complementary
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More information