Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter
|
|
- Jasper Bradley
- 6 years ago
- Views:
Transcription
1 Plant Molecular and Cellular Biology Lecture 9: Nuclear Genome Organization: Chromosome Structure, Chromatin, DNA Packaging, Mitosis Gary Peter 9/16/2008 1
2 Learning Objectives 1. List and explain how DNA is packaged in the nucleus 2. Explain how euchromatin and heterochromatin differ 3. Explain proposed mechanisms that maintain heterochromatin in its state 4. Explain the structure, functions of enzymes that mediate chromatin remodeling and their proposed mechanisms 9/16/2008 PMCB Lecture 11: G. Peter 2
3 DNA in the Nucleus is Organized into Chromosomes Chromosomes One very long linear dsdna molecule/chromosome with Single copy, Repetitive, and Highly repetitive sequences Centromere sequences Two teleomere sequences Multiple origins of replication Proteins that fold and pack the long DNA strand into more compact chromatin Histones Nonhistone chromosomal proteins 9/16/2008 PMCB Lecture 11: G. Peter 3
4 Example of Human Genome A human cell contains 2 m of DNA stretched end to end that must fit into a nucleus that is ~6 um in diameter A maize cell contains 2 m of DNA stretched end to end that must fit in a nucleus that is <10 um in diameter Compaction is ~1000 fold for interphase chromosomes and 10,000 fold between dsdna and mitotic chromosomes 9/16/2008 PMCB Lecture 11: G. Peter 4
5 Packing of DNA into the Nucleus: Multiple Levels of Compaction 3-fold 27 fold 700 fold ~1000 fold Interphase Mitotic 9/16/2008 PMCB Lecture 11: G. Peter 5
6 Evidence for Nucleosomes as the Basic Unit of Chromosome Structure Histone mass = the mass of DNA in chromatin Gentle lysis of nuclei and TEM analysis shows that chromatin is a 30nm wide thread Decondensation of chromatin reveals beads on string 9/16/2008 PMCB Lecture 11: G. Peter 6
7 Nucleosome Isolation & Organization Unfolded chromatin is digested with micrococcal nuclease Limited digestion leaves histone H1 + nucleosomal core with an average of 200bp of DNA More extensive digestion releases H1 and yields core particles with 146bp of DNA protected from nuclease digestion The 54bp on average is a linker DNA (Linker varies from 5-80bp) Nuclesome cores dissociated with high salt removes the 146 bp DNA from the octameric histone core 9/16/2008 PMCB Lecture 11: G. Peter 7
8 Nucleosome Core Structure: X-ray Crystal Structure Core is a histone octamer with 2 subunits of H2A, H2B, H3 and H4 with DNA wrapped around 1.65 turns in a left-handed coil Histones are basic proteins rich in lysine and arginine that make salt bridges with the backbone phosphates Extensive hydrogen bonds (146) between histones and DNA with ~1/2 forming between amino acids and phosphates on the DNA Hydrophobic bonds and salt bridges also hold the core together and the DNA The long amino terminal tails of each histone extend out from the central portion of the nucleosome 9/16/2008 PMCB Lecture 11: G. Peter 8
9 Structure of Nucleosome Core Histones Histones are highly conserved across all eukaryotic organisms Histones are small basic proteins ( aa) rich in lysine and arginine Each histone contains a region that folds in a characteristic structure called the histone fold and a tail region Tail region is post translationally modified in various ways to control many aspects of chromatin structure 9/16/2008 PMCB Lecture 11: G. Peter 9
10 Histone Octamer Assembly Dimers of H3-H4 form and then two dimers assemble into a very stable tetramer Two H2A-H2B dimers associate with the H3- H4 tetramer 9/16/2008 PMCB Lecture 11: G. Peter 10
11 Nucleosome Packing into 30nm Fibers Zigzag and solenoid models for packing Histone H1 plays a role by possibly altering the path of DNA that exits from the histone core helping to pull nucleosomes together Histone tails may help attach nucleosomes together 9/16/2008 PMCB Lecture 11: G. Peter 11
12 What is the Fold Compaction in 30nm Fibers? Assuming that the 30nm chromatin fiber contains 20 nucleosomes (200bp/nucleosome) per 50nm of length what is the degree of compaction? It is compacted 27 fold in 30nm fibers relative to extended DNA dsdna in 50nm is (20 nucleosomes x 200 bp/nucleosome x 0.34 nm/bp) = 1360nm 1360/50 = /16/2008 PMCB Lecture 11: G. Peter 12
13 Heterochromatin Structure Heterochromatin is highly condensed and more compact than the loops of 30nm fibers Remains tightly condensed even in interphase Centromeres, pericentromeres and telomeres are organized in facultative heterochromatin Heterochromatin contains few genes Heterochromatin represses gene expression Facultative heterochromatin regions can spread and retract Histone 3 tails (H3K9Met) and Lys 27 are methylated and are underacetylated in heterochromatin 9/16/2008 PMCB Lecture 11: G. Peter 13
14 Heterochromatin: Centromeres Centromeres contain sequence elements that are repeated (>1000X) Repeat sequences are variable in number and sequence composition between species Centromere sequences are highly compacted and contain particularly dense nucleosome arrangements Centromere nucleosomes have a unique histone H3 variant (CenH3) that together with centromere specific proteins combine to form the kinetochore that attaches the centromere to the spindle apparatus 9/16/2008 PMCB Lecture 11: G. Peter 14
15 Model for the Organization of a Chromosome End The telomere forms a t-loop which lacks nucelosomes In heterochromatin, unacetylated lysine 16 of histone H4 is required for the formation of telomeric heterochromatin, whereas acetylation of this lysine functions as a barrier to the spread of heterochromatin. 9/16/2008 PMCB Lecture 11: G. Peter 15
16 Model for Higher Order Euchromatin Structure 30nm fibers are folded into loops of 20, ,000 bp that are attached to a scaffold through matrix attachment regions (MARS) MARS are AT rich DNA sequence motifs bp in length 9/16/2008 PMCB Lecture 11: G. Peter 16
17 Evidence for Scaffold It appears that interphase and mitotic chromatin are attached to a scaffold when visualized after gentle nuclear lysis by TEM negative staining 9/16/2008 PMCB Lecture 11: G. Peter 17
18 Chromatin is Highly Dynamic Interphase chromosomes are in constant flux controlled by small nuclear RNAs, DNA methylation and histone modification Chromatin remodeling unfolds 30nm fibers to expose the regions for other proteins to access and perform functions such as transcription and DNA replication Evidence comes from chromosome puff regions in Drosophila polytene chromosomes and the identification of protein complexes that remodel chromatin 9/16/2008 PMCB Lecture 11: G. Peter 18 FEBS Letters 567 (2004) 15 19
19 Nucleosome Positioning Nucleosome spacing is irregular due to the local sequence of DNA and proteins bound in the vicinity A-T bases in minor groove make it more energetically favorable to bend DNA tightly around the histone core Proteins bound to DNA at specific sites can promote while others can inhibit nucleosome binding 9/16/2008 PMCB Lecture 11: G. Peter 19
20 Chromatin Remodeling Works at Multiple Levels Histone H1 controls 30nm chromatin fiber organization Multiple isoforms of H1 and their abundance are important for cell growth and proliferation ATP dependent chromatin remodeling works at the level of nucleosomes 3-fold 27 fold 700 fold 9/16/2008 PMCB Lecture 11: G. Peter 20
21 Chromatin Remodeling: Dynamic Repositioning of Nucleosomes Chromatin remodeling complexes are multisubunit protein complexes that hydrolyze ATP to change the structure of the nucleosome core so that the DNA becomes less tightly associated Movement of the H2A & H2B dimers in the nucleosome cores may be the mechanism 9/16/2008 PMCB Lecture 11: G. Peter 21
22 ATP Dependent Chromatin Remodeling ATP dependent protein remodeling is mediated by multiple large multisubunit complexes These complexes affect the interaction of DNA with the nucleosomes opening the DNA for access by other factors The SWI/SNF complexes from yeast are required for viability and bind well with naked DNA Many sets of different chromatin remodeling enzymes exist These activities are involved in most all aspects of DNA repair, DNA transcription, DNA replication 9/16/2008 PMCB Lecture 11: G. Peter 22
23 Modification of Histone NH4 Terminal Tails Affect the Stability of 30nm Fiber and Higher Order Structures The NH4 tails of the histones in the nucleosomal core are reversibly Acetylated by histone acetyl transferases Deacetylated by histone deacetylases Phosphorylated by histone kinases Dephosphorylated histone phosphatases Methylated by methylases Demethylated by demethylases 9/16/2008 PMCB Lecture 11: G. Peter 23
24 Position of Postranslational Modifications on Histone Tails in a Histone Octamer 9/16/2008 PMCB Lecture 11: G. Peter 24 Cell, Vol. 116, , January 23, 2004,
25 Histone Code Hypothesis Distinct markings of histone tails confers particular meanings by attracting those proteins involved with appropriate functions Gene expression should not take place DNA has been recently replicated 9/16/2008 PMCB Lecture 11: G. Peter 25
26 DNA Methylation and Chromatin Organization: Epigenetic Control in Plants The DDM1 gene of Arabidopsis is required to maintain DNA methylation levels and is needed for transposon and transgene silencing It also is required for maintenance of histone H3 methylation patterns DDM1 is similar to the SWI/SNF family of ATP dependent chromatin remodeling genes DNA methylation patterns may depend on histone H3 methylation patterns Epigenetic inheritance of hypomethylated DNA occurs 9/16/2008 PMCB Lecture 11: G. Peter 26
27 Telomeres & Telomere Replication Replication of the ends of linear DNA molecules are problematic for the replication machinery and loss of sequences from the ends occurs through multiple cycles Telomeres are located at the ends of the chromosomes, and they have unique repeated sequences and a 3 overhanging single stranded DNA Telomerase is a DNA polymerase that completes replication of telomere sequences Specialized reverse transcriptase TRENDS in Genetics Vol.19 No.8 August /16/2008 PMCB Lecture 8: G. Peter 27
28 Telomerase Cell, Vol. 95, , 1998 A ribonucleoprotein complex that adds repeated DNA nucleotides to the end of a 3 OH The ribonucleotide provides the complementary bases for synthesis 9/16/2008 PMCB Lecture 8: G. Peter 28
29 Summary DNA is folded in very precise ways to fit the long DNA molecules into a very small space, but still be able to access the DNA for replication and the genes for transcription Chromatin is very dynamic Some of the mechanisms for regulating chromatin reorganization are now being dissected 9/16/2008 PMCB Lecture 11: G. Peter 29
Chapter 5 DNA and Chromosomes
Chapter 5 DNA and Chromosomes DNA as the genetic material Heat-killed bacteria can transform living cells S Smooth R Rough Fred Griffith, 1920 DNA is the genetic material Oswald Avery Colin MacLeod Maclyn
More informationNUCLEUS. Fig. 2. Various stages in the condensation of chromatin
NUCLEUS Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion. Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents some linear molecules
More informationChromatin Structure and its Effects on Transcription
Chromatin Structure and its Effects on Transcription Epigenetics 2014 by Nigel Atkinson The University of Texas at Austin From Weaver 4th edition and Armstrong 1st edition What is the point? DNA is not
More informationGenes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology
Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may
More informationChromatin. Structure and modification of chromatin. Chromatin domains
Chromatin Structure and modification of chromatin Chromatin domains 2 DNA consensus 5 3 3 DNA DNA 4 RNA 5 ss RNA forms secondary structures with ds hairpins ds forms 6 of nucleic acids Form coiling bp/turn
More informationDNA: The Genetic Material. Chapter 10
DNA: The Genetic Material Chapter 10 DNA as the Genetic Material DNA was first extracted from nuclei in 1870 named nuclein after their source. Chemical analysis determined that DNA was a weak acid rich
More informationChapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".
Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope
More informationLecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics
Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Epigenetics represents the science for the studying heritable
More informationFig. 16-7a. 5 end Hydrogen bond 3 end. 1 nm. 3.4 nm nm
Fig. 16-7a end Hydrogen bond end 1 nm 3.4 nm 0.34 nm (a) Key features of DNA structure end (b) Partial chemical structure end Fig. 16-8 Adenine (A) Thymine (T) Guanine (G) Cytosine (C) Concept 16.2: Many
More informationThe DNA Molecule: The Molecular Basis of Inheritance
Slide hapter 6 he DN Molecule: he Molecular Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil ampbell and Jane Reece Lectures by hris Romero, updated by Erin Barley
More informationNucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.
BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid
More informationEpigenetics. Medical studies in English, Lecture # 12,
Epigenetics Medical studies in English, 2018. Lecture # 12, Epigenetics Regulation of gene activity in eukaryotes Correlation of chromatin structure with transcription stably heritable phenotype resulting
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationDivision Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationChromatin and Transcription
Chromatin and Transcription Chromatin Structure Chromatin Represses Transcription Nucleosome Positioning Histone Acetylation Chromatin Remodeling Histone Methylation CHIP Analysis Chromatin and Elongation
More informationTypes of nucleic acid
RNA STRUCTURE 1 Types of nucleic acid DNA Deoxyribonucleic acid RNA ribonucleic acid HOCH 2 O OH HOCH 2 O OH OH OH OH (no O) ribose deoxyribose 2 Nucleic acids consist of repeating nucleotide that have
More informationChapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationNUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationDNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
More information6.2 Chromatin is divided into euchromatin and heterochromatin
6.2 Chromatin is divided into euchromatin and heterochromatin Individual chromosomes can be seen only during mitosis. During interphase, the general mass of chromatin is in the form of euchromatin. Euchromatin
More informationGENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s
GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationGenome Architecture Structural Subdivisons
Lecture 4 Hierarchical Organization of the Genome by John R. Finnerty Genome Architecture Structural Subdivisons 1. Nucleotide : monomer building block of DNA 2. DNA : polymer string of nucleotides 3.
More information14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION
14 DNA STRUCTURE, REPLICATION, AND ORGANIZATION Chapter Outline 14.1 ESTABLISHING DNA AS THE HEREDITARY MOLECULE Experiments began when Griffith found a substance that could genetically transform pneumonia
More informationOverview: Life s Operating Instructions Concept 16.1: DNA is the genetic material The Search for the Genetic Material: Scientific Inquiry
Overview: Life s Operating Instructions In 1953, James Watson and Francis Crick introduced an elegant double-helical model for the structure of deoxyribonucleic acid, or DNA DNA, the substance of inheritance,
More informationREGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes
REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationThe Molecular Basis of Inheritance
The Molecular Basis of Inheritance Chapter 16 Objectives Describe the contributions of the following people: Griffith; Avery, McCary, and MacLeod; Hershey and Chase; Chargaff; Watson and Crick; Franklin;
More informationNucleosomes: Structure and Function
Nucleosomes: Structure and Function Karolin Luger, Colorado State University, Fort Collins, Colorado, USA The structure of the nucleosome core particle, the basic repeating unit in eukaryotic chromatin,
More informationStructure/function relationship in DNA-binding proteins
PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA
More informationGene Expression and Heritable Phenotype. CBS520 Eric Nabity
Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.
More informationChapter 13 Active Reading Guide The Molecular Basis of Inheritance
Name: AP Biology Mr. Croft Chapter 13 Active Reading Guide The Molecular Basis of Inheritance Section 1 1. What are the two chemical components of chromosomes? 2. Why did researchers originally think that
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More informationEpigenetics in. Saccharomyces cerevisiae. Chapter 4 2/4/14
Epigenetics in Saccharomyces cerevisiae Chapter 4 2/4/14 The budding yeast - Saccharomyces cerevisiae The fission yeast - Schizosaccharomyces pombe The budding yeast, Saccharomyces cerevisiae and the fission
More informationRegulation of Gene Expression
Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationBiology Lecture 2 Genes
Genes Definitions o Gene: DNA that codes for a single polypeptide/mrna/rrna/trna o Euchromatin: region of DNA containing genes being actively transcribed o Heterochromatin: region of DNA containing genes
More informationDNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.
DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose
More informationDNA Replication. The Organization of DNA. Recall:
Recall: The Organization of DNA DNA Replication Chromosomal form appears only during mitosis, and is used in karyotypes. folded back upon itself (chromosomes) coiled around itself (chromatin) wrapped around
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationVocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase
DNA and Replication TEKS (6) Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: (A)
More informationTHE CELLULAR AND MOLECULAR BASIS OF INHERITANCE
Umm AL Qura University THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Dr. Neda Bogari www.bogari.net EMERY'S ELEMENTS OF MEDICAL GENETICS Peter Turnpenny and Sian Ellard 13 th edition 2008 COURSE SYLLABUS
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationThe replication of DNA Kornberg 1957 Meselson and Stahl 1958 Cairns 1963 Okazaki 1968 DNA Replication The driving force for DNA synthesis. The addition of a nucleotide to a growing polynucleotide
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationChapter Fundamental Molecular Genetic Mechanisms
Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise
More informationExam 2 BIO200, Winter 2012
Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide
More informationChapter 3. DNA Replication & The Cell Cycle
Chapter 3 DNA Replication & The Cell Cycle DNA Replication and the Cell Cycle Before cells divide, they must duplicate their DNA // the genetic material DNA is organized into strands called chromosomes
More informationRNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix
Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure
More informationCHAPTER 13 LECTURE SLIDES
CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationMolecular Biology of the Gene
Molecular Biology of the Gene : where the genetic information is stored, blueprint for making proteins. RNA: Always involved in protein synthesis Macromolecules (polymers!) Monomers (units): nucleotides
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationChapter 9-II - Transcriptional Control of Gene Expression
Chapter 9-II - Transcriptional Control of Gene Expression Transcriptional Control of Gene Expression 9.3 RNA Polymerase II Promoters and General Transcription Factors Three types of promoter sequences
More informationPost-translational modifications of histones: encoding or patterning? Histones are subject to an enormous number of posttranslational
R546 Primer Histones and histone modifications Craig L. Peterson and Marc-André Laniel Imagine trying to stuff about 10,000 miles of spaghetti inside a basketball. Then, if that was not difficult enough,
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationCHAPTER 11 LECTURE SLIDES
CHAPTER 11 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationChromosomes. Ms. Gunjan M. Chaudhari
Chromosomes Ms. Gunjan M. Chaudhari Chromsomes Chromosome structure Chromatin structure Chromosome variations The new cytogenetics Prokaryotic chromosomes Circular double helix Complexed with protein in
More informationEinführung in die Genetik
Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de
More informationEUKARYOTIC REGULATION C H A P T E R 1 3
EUKARYOTIC REGULATION C H A P T E R 1 3 EUKARYOTIC REGULATION Every cell in an organism contains a complete set of DNA. But it doesn t use all of the DNA it receives Each cell chooses different DNA sequences
More informationBCMB Nucleic Acids - Chapter 33. DNA is the genetic component of life
BCMB 3100 - Nucleic Acids - Chapter 33 Discovery of DNA Nucleotides, nucleosides & bases Polynucleotides DNA as genetic material Structure of double-stranded DNA Chromatin RNA Nucleases 1 DNA is the genetic
More informationCells and Tissues. Overview CELLS
Cells and Tissues WIll The basic unit of structure and function in the human body is the cell. Each of a cell's parts, or organelles, as well as the entire cell, is organized to perform a specific function.
More informationCELLULAR PROCESSES; REPRODUCTION. Unit 5
CELLULAR PROCESSES; REPRODUCTION Unit 5 Cell Cycle Chromosomes and their make up Crossover Cytokines Diploid (haploid diploid and karyotypes) Mitosis Meiosis What is Cancer? Somatic Cells THE CELL CYCLE
More informationMechanisms of Transcription. School of Life Science Shandong University
Mechanisms of Transcription School of Life Science Shandong University Ch 12: Mechanisms of Transcription 1. RNA polymerase and the transcription cycle 2. The transcription cycle in bacteria 3. Transcription
More informationSection 10. Junaid Malek, M.D.
Section 10 Junaid Malek, M.D. Cell Division Make sure you understand: How do cells know when to divide? (What drives the cell cycle? Why is it important to regulate this?) How is DNA replication regulated?
More informationAnswers to the multiple choice questions are at the bottom of the last page of this document.
Review for Unit Test #2: Cell Parts, Functions and Protein Synthesis, Answers Answers to the multiple choice questions are at the bottom of the last page of this document. 1. Know all of the material on
More information1. Mitosis = growth, repair, asexual reproduc4on
Places Muta4ons get passed on: Cell Reproduc4on: 2 types of cell reproduc4on: 1. Mitosis = growth, repair, asexual reproduc4on Photocopy machine Growth/Repair Passed on in the same body 2. Meiosis = sexual
More information3. How Genomes Function
3. How Genomes Function In order for the cell to utilize the biological information contained within its genome, groups of genes, each gene representing a single unit of information, have to be expressed
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationChapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome
Chapter 14 Control of Eukaryotic Genome How many genes? Genes only ~3% of human genome protein-coding sequences 1% of human genome non-protein coding genes 2% of human genome trna ribosomal RNAs sirnas
More informationBioinformatics of Transcriptional Regulation
Bioinformatics of Transcriptional Regulation Carl Herrmann IPMB & DKFZ c.herrmann@dkfz.de Wechselwirkung von Maßnahmen und Auswirkungen Einflussmöglichkeiten in einem Dialog From genes to active compounds
More informationEinführung in die Genetik
Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Twitter: @PlantDevTUM, #genetiktum FB: Plant Development TUM Prof. Dr. Claus Schwechheimer
More informationDifferential Gene Expression
Biology 4361 - Developmental Biology Differential Gene Expression June 18, 2009 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationNucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationProblem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.
Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationRNA Structure and the Versatility of RNA. Mitesh Shrestha
RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis
More informationDNA: Structure and Replication - 1
DNA: Structure and Replication - 1 We have briefly discussed that DNA is the genetic molecule of life. In eukaryotic organisms DNA (along with its histone proteins) is found in chromosomes. All cell activities
More information4) separates the DNA strands during replication a. A b. B c. C d. D e. E. 5) covalently connects segments of DNA a. A b. B c. C d. D e.
1) Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that a. the relative proportion of each of the four bases differs from species to species. b.
More information9 MOLECULAR BIOLOGY. Chapter Outline. Introduction
Concepts of Biology Chapter 9 Molecular Biology 199 9 MOLECULAR BIOLOGY Figure 9.1 Dolly the sheep was the first cloned mammal. Introduction 9.1: The Structure of DNA 9.2: DNA Replication 9.3: Transcription
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationCentral Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)
More informationTranscriptional Regulation in Eukaryotes
Transcriptional Regulation in Eukaryotes Concepts, Strategies, and Techniques Michael Carey Stephen T. Smale COLD SPRING HARBOR LABORATORY PRESS NEW YORK 2000 Cold Spring Harbor Laboratory Press, 0-87969-537-4
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationDNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.
DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov
More informationLesson Overview DNA Replication
12.3 THINK ABOUT IT Before a cell divides, its DNA must first be copied. How might the double-helix structure of DNA make that possible? Review Question! At what stage of the cell cycle do cells duplicate
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationChapter 9: DNA: The Molecule of Heredity
Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of
More information