Read Quality Assessment & Improvement. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
|
|
- Wilfrid Andrews
- 6 years ago
- Views:
Transcription
1 Read Quality Assessment & Improvement UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
2 QA&I should be interactive
3 Error modes Each technology has unique error modes, depending on the physico-chemical processes involved in the whole sequencing life cycle (not just base-calling step). Improving reads will work better if the assumptions made by the remediation tools match the source(s) of error. How do you know? Trial and error? QA&I is experimental, just like bench science.
4 Illumina read problems Contaminating sequence within reads adapters adapter dimers Poor quality and/or wrong sequence substitution, insertion / deletion ( indel ) errors Sample contamination Chimerism in library Sampling bias
5 Illumina errors Illumina errors are biased - they occur after some sequence motifs (not well addressed by any tools currently, IMO), and predominantly at the 3 -ends of reads. Polymerase errors explain isolated errors, but 3 bias is less intuitive.
6 Illumina - 3 -end errors (glass substrate)
7 Illumina - 3 -end errors (glass substrate)
8 Illumina - 3 -end errors 5 -CTCTTCCGATCT <-- add sequencing primers 5 -CTCTTCCGATCT 5 -CTCTTCCGATCT 5 -CTCTTCCGATCT (glass substrate) 5 -CTCTTCCGATCT 5 -CTCTTCCGATCT 5 -CTCTTCCGATCT 5 -CTCTTCCGATCT
9 Illumina - 3 -end errors 5 -CTCTTCCGATCTC <-- cycle 1 5 -CTCTTCCGATCTC 5 -CTCTTCCGATCTC 5 -CTCTTCCGATCTC (glass substrate) 5 -CTCTTCCGATCTC 5 -CTCTTCCGATCTC 5 -CTCTTCCGATCTC 5 -CTCTTCCGATCTC
10 Illumina - 3 -end errors 5 -CTCTTCCGATCTCT <-- cycle 2 5 -CTCTTCCGATCTCT 5 -CTCTTCCGATCTCT 5 -CTCTTCCGATCTCT (glass substrate) 5 -CTCTTCCGATCTCT 5 -CTCTTCCGATCTCT 5 -CTCTTCCGATCTCT 5 -CTCTTCCGATCTCT
11 Illumina - 3 -end errors 5 -CTCTTCCGATCTCTC <-- cycle 3 5 -CTCTTCCGATCTCTC 5 -CTCTTCCGATCTCTC 5 -CTCTTCCGATCTCTC (glass substrate) 5 -CTCTTCCGATCTCTC 5 -CTCTTCCGATCTCTC 5 -CTCTTCCGATCTCTC 5 -CTCTTCCGATCTCTC
12 Illumina - 3 -end errors 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase (glass substrate) 5 -CTCTTCCGATCTCTCTGCGCTTGAGAGA pre-phasing (+1) 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase 5 -CTCTTCCGATCTCTCTGCGCTTGAGA post-phasing (-1) 5 -CTCTTCCGATCTCTCTGCGCTTGAGAG in phase
13 Illumina - 3 -end errors # of molecules e l c y C 1-2 A T C G True cycle offset (pre- / post-phasing events)
14 Illumina - 3 -end errors # of molecules Cy stochastic variability -2 A T C G e l c Process Error
15 Illumina - 3 -end errors
16 Intensity Illumina - 3 -end errors = -2 A T C G Measurement Error
17 Illumina - 3 -end errors Measurement Error
18 Illumina - 3 -end errors
19 Illumina - error rates Overall Illumina error rate ~ 0.1-1% Of that, 99% are substitutions, 1% are insertions / deletions ( indels )
20 Adapter contamination
21 Adapter contamination Older "in-line" or "homebrew" adapters can be added to one or both ends of DNA library fragments. Tools like Sabre (Nik Joshi) can recognize these, separate reads into different files, and remove barcode bases.
22 Adapter contamination The problem is heterogeneous fragment sizes, resulting from any of the current library preparation techniques. All libraries will contain DNA fragments of variable size.
23 Adapter contamination Contamination is the result of the sequencer reading through a short read, into adapter sequence that didn't come from your sample!
24 Adapter contamination Where can you find out adapter sequences? Google "github ucdavis-bioinformatics", look for Scythe, look for "*_adapters.fa" Check Seqanswers.com Contact Illumina, PacBio, etc. for "tech notes" specifying the library prep primer / adapter sequences (not always that clear to work out). Find them in your data.
25 Adapter contamination >TruSeq_forward_contam AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[8bp index]atctcgtatgccgtcttctgcttgaaaaa >TruSeq_reverse_contam AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT[8bp index]gtggtcgccgtatcattaaaaa >Nextera_forward_contam CTGTCTCTTATACACATCTCCGAGCCCACGAGAC[8bp index]atctcgtatgccgtcttctgcttg >Nextera_reverse_contam CTGTCTCTTATACACATCTGACGCTGCCGACGA[8bp index]gtgtagatctcggtggtcgccgtatcatt >TruSeq_SmallRNA_forward_contam TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC[6bp adapter]atctcgtatgccgtcttctgcttg >TruSeq_SmallRNA_reverse_contam GATCGTCGGACTGTAGAACTCTGAACCTGTCG Also note small RNA trimming instructions here: find mirna on page
26 Base quality in the FASTQ format
27 Base quality in the FASTQ format SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS......XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX......IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ... }~ S - Sanger Phred+33, raw reads typically (0, 40) X - Solexa Solexa+64, raw reads typically (-5, 40) I - Illumina 1.3+ Phred+64, raw reads typically (0, 40) J - Illumina 1.5+ Phred+64, raw reads typically (3, 40) with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold) (Note: See discussion above). L - Illumina 1.8+ Phred+33, raw reads typically (0, 41)
28 Base qualities
29 FASTQ - Pop Quiz! 1. What does a quality character of ";" mean? 2. In Sanger (standard) FASTQ, which ASCII character would I use to indicate that I'm absolutely sure that I'm wrong about a particular base? 3. If a particular 40 bp read from a run analyzed with Illumina Pipeline 1.6 (phred + 64) had consistent quality characters of "J", how many errors should you expect in the read?
30 FASTQ - Base order / read orientation An "F/R" pair, or "innies"
31 Back to contamination / quality issues
32 Back to contamination / quality issues
33 Illumina Read IDs older pipelines newer pipelines Do your FASTQ files begin and end with the same IDs? Incomplete downloads, accidental sorting, different trimming, etc. can get your forward and reverse read files out of sync with each other.
34 Illumina Read 1:N:0:GCGCTA NTTGCGATAAGGCTCCGGATCATTGCGATTGGTCAGCATCACCACCGTCA + + F/R 2:N:0:GCGCTA ATGGCGGTATCTATTCTTCGATCGACGATCTGGCGAAGTGGGACGCGGCT + +
35 Illumina Read 1:N:0:GCGCTA NTTGCGATAAGGCTCCGGATCATTGCGATTGGTCAGCATCACCACCGTCA + + N = Not a bad read. Seriously. Y = Yes, it did violate the chastity filter. Usually these are removed, but some providers leave them in, and these could be good reads. Or maybe not. Barcode / Index. May contain mismatches to the real barcode, if pipeline was run allowing mismatches.
36 Illumina Read 1:N:0:GCGCTA NTTGCGATAAGGCTCCGGATCATTGCGATTGGTCAGCATCACCACCGTCA + + Most providers now spike phix174 library into every lane. If a read aligns to the phix174 reference, this field will contain a number the coordinate where the read aligns. It may be important to filter these reads out, depending on downstream processing.
37 Tools!
38 Scythe
39 Sickle
40 Error Correction Paired-read overlap ( read merging, paired read assemblers ) FLASH PEAR PANDAseq Correct bases in overlapping region; output a single read No merging / correction possible; output pair of reads Correct in overlapping region; trim overhangs (adapter); output single read
41 Questions?
Genomic DNA ASSEMBLY BY REMAPPING. Course overview
ASSEMBLY BY REMAPPING Laurent Falquet, The Bioinformatics Unravelling Group, UNIFR & SIB MA/MER @ UniFr Group Leader @ SIB Course overview Genomic DNA PacBio Illumina methylation de novo remapping Annotation
More informationQuality assessment and control of sequence data. Naiara Rodríguez-Ezpeleta
Quality assessment and control of sequence data Naiara Rodríguez-Ezpeleta Workshop on Genomics 2014 Quality control is important Some of the artefacts/problems that can be detected with QC Sequencing Sequence
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationGenomics AGRY Michael Gribskov Hock 331
Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will
More informationDifferential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 1: Introduction into high-throughput
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationAnalysing genomes and transcriptomes using Illumina sequencing
Analysing genomes and transcriptomes using Illumina uencing Dr. Heinz Himmelbauer Centre for Genomic Regulation (CRG) Ultrauencing Unit Barcelona The Sequencing Revolution High-Throughput Sequencing 2000
More informationSequencing techniques and applications
I519 Introduction to Bioinformatics Sequencing techniques and applications Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Sequencing techniques Sanger sequencing Next generation
More informationRNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationAlignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationThird Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
More informationEcole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
More informationBST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data
BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationIntroduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference
More informationTargeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales
Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology
More informationNGS sequence preprocessing. José Carbonell Caballero
NGS sequence preprocessing José Carbonell Caballero jcarbonell@cipf.es Contents Data Format Quality Control Sequence capture Fasta and fastq formats Sequence quality encoding Evaluation of sequence quality
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationAutomated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep
Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION &
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationBioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
More informationEuropean Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
Guideline for the submission of DNA sequences derived from genetically modified organisms and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 European
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationLong and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
More informationNext Generation Sequencing Technologies. Some slides are modified from Robi Mitra s lecture notes
Next Generation Sequencing Technologies Some slides are modified from Robi Mitra s lecture notes What will you do to understand a disease? What will you do to understand a disease? Genotype Phenotype Hypothesis
More informationIllumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme
Illumina (Solexa) Current market leader Based on sequencing by synthesis Current read length 100-150bp Paired-end easy, longer matepairs harder Error ~0.1% Mismatch errors dominate Throughput: 4 Tbp in
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationBase Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries
TECHNICAL NOTE Base Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries INTRODUCTION The Chromium Single Cell 3 v2 Protocol (CG00052) produces Single Cell 3 libraries, ready for Illumina
More informationNext Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationMeasuring transcriptomes with RNA-Seq
Measuring transcriptomes with RNA-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2017 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC
More informationBiochemistry 412. New Strategies, Technologies, & Applications For DNA Sequencing. 12 February 2008
Biochemistry 412 New Strategies, Technologies, & Applications For DNA Sequencing 12 February 2008 Note: Scale is wrong!! (at least for sequences) 10 6 In 1980, the sequencing cost per finished bp $1.00
More informationSanger sequencing troubleshooting guide. GATC Biotech AG
Sanger sequencing troubleshooting guide GATC Biotech AG April, 2017 Introduction All sequencing data generated at GATC Biotech is carefully analysed before it is delivered to the customer. In cases where
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationInfectious Disease Omics
Infectious Disease Omics Metagenomics Ernest Diez Benavente LSHTM ernest.diezbenavente@lshtm.ac.uk Course outline What is metagenomics? In situ, culture-free genomic characterization of the taxonomic and
More informationNext Generation Sequencing: An Overview
Next Generation Sequencing: An Overview Cavan Reilly November 13, 2017 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform Next generation
More informationData Analysis with CASAVA v1.8 and the MiSeq Reporter
Data Analysis with CASAVA v1.8 and the MiSeq Reporter Eric Smith, PhD Bioinformatics Scientist September 15 th, 2011 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense
More informationRADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé
RADSeq Data Analysis Through STACKS on Galaxy Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RAD sequencing: next-generation tools for an old problem INTRODUCTION source: Karim Gharbi
More informationscgem Workflow Experimental Design Single cell DNA methylation primer design
scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationA step-by-step guide to ChIP-seq data analysis
A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D. EMBL-European Bioinformatics Institute Wellcome Trust Sanger Institute Target audience Wet-lab biologists with no experience
More informationMapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationHLA and Next Generation Sequencing it s all about the Data
HLA and Next Generation Sequencing it s all about the Data John Ord, NHSBT Colindale and University of Cambridge BSHI Annual Conference Manchester September 2014 Introduction In 2003 the first full public
More informationHuman genome sequence
NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion
More informationReference genomes and common file formats
Reference genomes and common file formats Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF
More informationSequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute
Sequencing Theory Brett E. Pickett, Ph.D. J. Craig Venter Institute Applications of Genomics and Bioinformatics to Infectious Diseases GABRIEL Network Agenda Sequencing Instruments Sanger Illumina Ion
More informationWhy can GBS be complicated? Tools for filtering, error correction and imputation.
Why can GBS be complicated? Tools for filtering, error correction and imputation. Edward Buckler USDA-ARS Cornell University http://www.maizegenetics.net Many Organisms Are Diverse Humans are at the lower
More informationHiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
More informationGenome Assembly. J Fass UCD Genome Center Bioinformatics Core Friday September, 2015
Genome Assembly J Fass UCD Genome Center Bioinformatics Core Friday September, 2015 From reads to molecules What s the Problem? How to get the best assemblies for the smallest expense (sequencing) and
More informationTechnical note: Molecular Index counting adjustment methods
Technical note: Molecular Index counting adjustment methods By Jue Fan, Jennifer Tsai, Eleen Shum Introduction. Overview of BD Precise assays BD Precise assays are fast, high-throughput, next-generation
More informationConsiderations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center
Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping
More informationL3: Short Read Alignment to a Reference Genome
L3: Short Read Alignment to a Reference Genome Shamith Samarajiwa CRUK Autumn School in Bioinformatics Cambridge, September 2017 Where to get help! http://seqanswers.com http://www.biostars.org http://www.bioconductor.org/help/mailing-list
More informationIntroduction to Next Generation Sequencing (NGS)
Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationJenny Gu, PhD Strategic Business Development Manager, PacBio
IDT and PacBio joint presentation Characterizing Alzheimer s Disease candidate genes and transcripts with targeted, long-read, single-molecule sequencing Jenny Gu, PhD Strategic Business Development Manager,
More informationIntroduction to RNA sequencing
Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence
More informationaxe Documentation Release g6d4d1b6-dirty Kevin Murray
axe Documentation Release 0.3.2-5-g6d4d1b6-dirty Kevin Murray Jul 17, 2017 Contents 1 Axe Usage 3 1.1 Inputs and Outputs..................................... 4 1.2 The barcode file......................................
More informationCNV and variant detection for human genome resequencing data - for biomedical researchers (II)
CNV and variant detection for human genome resequencing data - for biomedical researchers (II) Chuan-Kun Liu 劉傳崑 Senior Maneger National Center for Genome Medican bioit@ncgm.sinica.edu.tw Abstract Common
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012
Introduction to transcriptome analysis using High Throughput Sequencing technologies D. Puthier 2012 A typical RNA-Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationIn this protocol, DNA Strider for Mac is used for demonstration. The design of oligos for deleting Adephagia gp73 is used as an example.
Phagehunting Program Designing Oligos for BRED Gene Deletion OBJECTIVE BACKGROUND To design oligonucleotides for gene deletion with BRED. Bacteriophage recombineering with electroporated DNA (BRED) a system
More informationRNAseq Differential Gene Expression Analysis Report
RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample
More informationHow much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
More informationVariation detection based on second generation sequencing data. Xin LIU Department of Science and Technology, BGI
Variation detection based on second generation sequencing data Xin LIU Department of Science and Technology, BGI liuxin@genomics.org.cn 2013.11.21 Outline Summary of sequencing techniques Data quality
More informationWorkflow of de novo assembly
Workflow of de novo assembly Experimental Design Clean sequencing data (trim adapter and low quality sequences) Run assembly software for contiging and scaffolding Evaluation of assembly Several iterations:
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationIntroduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationRNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More information1. A brief overview of sequencing biochemistry
Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry
More informationResearch school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
More informationAnalysis of barcode sequencing
Analysis of barcode sequencing Department of Functional Genomics, UST Jihyeob Mun 2016.12.07 Pooled library screen analysis experience knowledge gene A is a target? High-throughput Simplicity Fail Pooled
More information1.1 Post Run QC Analysis
Post Run QC Analysis 100 339 200 01 1. Post Run QC Analysis 1.1 Post Run QC Analysis Welcome to Pacific Biosciences' Post Run QC Analysis Overview. This training module will describe the workflow to assess
More informationAnnouncements. Coffee! Evalua,on. Dr. Yoshiki Sasai, R.I.P.
Announcements Coffee! Evalua,on. Dr. Yoshiki Sasai, R.I.P. Sequencing considerations Three basic problems Resequencing, coun,ng, and assembly. A. B. C. 1. Resequencing analysis We know a reference genome,
More informationGenome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias
Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationA shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter
A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing
More informationFinishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome
Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome Ruth Howe Bio 434W 27 February 2010 Abstract The fourth or dot chromosome of Drosophila species is composed primarily of highly condensed,
More informationLawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory
Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Title Glomus intraradices: Initial Whole-Genome Shotgun Sequencing and Assembly Results Permalink https://escholarship.org/uc/item/4c13k1dh
More informationAssembly of Ariolimax dolichophallus using SOAPdenovo2
Assembly of Ariolimax dolichophallus using SOAPdenovo2 Charles Markello, Thomas Matthew, and Nedda Saremi Image taken from Banana Slug Genome Project, S. Weber SOAPdenovo Assembly Tool Short Oligonucleotide
More informationMeasuring transcriptomes with RNA-Seq. BMI/CS 776 Spring 2016 Anthony Gitter
Measuring transcriptomes with RNA-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu Overview RNA-Seq technology The RNA-Seq quantification problem Generative
More informationDNA sequencing. Course Info
DNA sequencing EECS 458 CWRU Fall 2004 Readings: Pevzner Ch1-4 Adams, Fields & Venter (ISBN:0127170103) Serafim Batzoglou s slides Course Info Instructor: Jing Li 509 Olin Bldg Phone: X0356 Email: jingli@eecs.cwru.edu
More informationFundamentals of Next-Generation Sequencing: Technologies and Applications
Fundamentals of Next-Generation Sequencing: Technologies and Applications Society for Hematopathology European Association for Haematopathology 2017 Workshop Eric Duncavage, MD Washington University in
More informationAnalysis of Differential Gene Expression in Cattle Using mrna-seq
Analysis of Differential Gene Expression in Cattle Using mrna-seq mrna-seq A rough guide for green horns Animal and Grassland Research and Innovation Centre Animal and Bioscience Research Department Teagasc,
More informationDe novo Genome Assembly
De novo Genome Assembly A/Prof Torsten Seemann Winter School in Mathematical & Computational Biology - Brisbane, AU - 3 July 2017 Introduction The human genome has 47 pieces MT (or XY) The shortest piece
More informationCarl Woese. Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life
METAGENOMICS Carl Woese Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationNOW GENERATION SEQUENCING. Monday, December 5, 11
NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000
More informationDe novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Bioinformatics Facility Cornell University Data generation Sequencing Platforms Short reads: Illumina Long reads: PacBio; Oxford Nanopore Contiging/Scaffolding
More information