Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory
|
|
- Clifford Johnson
- 6 years ago
- Views:
Transcription
1 Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory
2 Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes 4. The Regulation of Gene Expression 4.1. Genomic Level Control 4.2. Transcriptional Level Control 4.3. mrna Processing & Nuclear Transport Control 4.4. Translational Level Control 4.5. Post-Translational Level Control 5. Review A darn difficult topic You better stay awake! syahril@medic.upm.edu.my
3 The Genome 1. Bacteria e.g. E. coli has genome of 4 x 10 6 base pairs gene products 2. Human genome: 3,200,000,000 (3 billion) bp (haploid) - but only 20,000-25,000 gene products - i.e % of human genome do not have direct genetic function!! - hence redundancy of eukaryotic genome Organism Type Organism Genome Size (bp) Amoeba Amoeba dubia 670,000,000,000 Nematode Caenorhabditis elegans 100,300,000 Insect Apis mellifera (honey bee) 1,770,000,000 Fish Protopterus aethiopicus 130,000,000,000 C-value Enigma there is no correlation between complexity of an organism and its genome size!! syahril@medic.upm.edu.my
4 Overview of Gene Control 1. There are many different cell types in a multicellular organism (white blood cells, neurons, epithelial cells etc) 2. Each cell type arises from the selective expression of a subset of genes in the genome. 3. In many cases, the genetic program that predetermines a cell to be a certain cell type can be re-programmed to become another type of cell. 4. In cloning Dolly the sheep, the researcher took the nucleus from a lamb s udder and placed it into an egg of which the nucleus has been removed - the transplanted nucleus regenerated the whole lamb.
5 Overview of Gene Control 5. Many biochemical processes are common to all cell types, and thus a majority of genes are expressed in all cell types (e.g., glycolytic pathway enzymes, actin, etc.) 6. Other biochemical processes are specific to certain cells (e.g. hemoglobin in red blood cells). 7. In many cases, these tissue-specific genes are highly expressed in one or a few types of cells and not expressed at all in others.
6 Cellular Differentiation in Higher Eukaryotes 1. Each mammalian cell contains the same complete set of genome, regardless of which tissues or organs they are from (two copies except haploid cells). Nucleus contains all the necessary information, encoded in DNA, to control the formation of a whole organism 2. Yet different types of mammalian cells express widely different proteins even though each cell has the same complement of genes
7 Cellular Differentiation in Higher Eukaryotes 3. In addition, the same type of cells can have different patterns of protein synthesis during different developmental stages, for example the globin genes Different members of the globin gene family are are transcribed at different stages of human development
8 The Regulation of Gene Expression 1. Genomic Level Control - involves silencing or expression at chromatin structure or at DNA level. 2. Transcriptional Level Control - involves turning on or off the gene expression - most important point of control for most genes 3. mrna Processing & Nuclear Transport Control - controlling how the primary RNA transcript is spliced or processed - some RNAs are selectively transported to the cytoplasm 4. Translational Level Control - selecting which mrnas are translated by ribosomes - control of mrna stability 5. Post-Translational Processing - at level of protein - may be modified by various mechanisms like phosphorylation, ligand binding and etc. - affected by the rates of protein degradation, or its subcellular localization
9
10 1. Genomic Level Control 1. There are transcriptionally active and inactive regions through out the genome. 2. How are these regions controlled? A. Methylation of cytosine residues in DNA B. Histone modifications i. Histone Acetylation ii. Histone Methylation C. Chromatin Remodeling 3. These are the types of Epigenetics What is epigenetics? Changes in phenotype (appearance) or gene expression caused by mechanisms other than changes in the underlying DNA sequence, hence the name epi- (Greek: over; above) -genetics. Changes may remain through cell divisions for the remainder of the cell's life and may also last for multiple generations.
11 1. Genomic Level Control : (A) Methylation of Cytosine in DNA a. CpG rich region is a short stretch of DNA in which the frequency of CG sequence is higher than other regions in the genome (p=phosphodiester bond). b % all all CpGs are methylated in mammals c. Unmethylated CpGs are known as CpG island located in promoter regions d. DNA methylation can switch off gene expression i. By impeding the binding of transcriptional proteins (i.e. RNA pol, transcription factors). DNA methyltransferase ii. Methylated DNA bound by methyl-cpg-binding domain proteins (MBDs) recruits additional proteins.remodel histones next slides e. Active gene (expressed gene) is undermethylated; Inactive (silent) gene is hypermethylated f. Loss of methyl-cpg-binding protein 2 (MeCP2) = Rett syndrome MBD2 causes transcriptional silencing of hypermethylated genes in cancer
12 1. Genomic Level Control : (B) Histone Modifications i. Histone Acetylation 1. Histone acetyltransferase (HAT) acetylate histone proteins = genes transcriptionally active 2. From previous slide: MBDs bound to methylated CpG, recruits histone deacytelases (HDAC) takes away the acetyl group = genes transcriptionally inactive.
13 1. Genomic Level Control : (B) Histone Modifications Transcriptionally inactive Transcriptionally active Chromatin: DNA + Histones i. Euchromatin = loosely packed, active genes ii. Heterochromatin = condensed region, genes transcriptionally silent. At centromeres
14 1. Genomic Level Control Transcription Transcription Factors RNA Pol Acetylation Association between CpG methylation and histone acetylations DNA Methyltransferase 5-methyl-C 1. Silencing due to the chromatin compaction. 2. Interfere with the entry of transcription factors. Methyl CpG Binding Proteins Histone Deacetylase NO Transcription Deacetylation Transcription factors Chromatin Compaction Transcriptional Silencing
15 1. Genomic Level Control : (B) Histone Modifications ii. Histone Methylation 1. Addition of methyl groups to the tail of histone proteins 2. Activation or repression depending on which amino acids in the tail are methylated. 3. For activation of transcription: - Addition of methyl at lysine 4 in the tail of H3 histone protein (H3K4me3) - Frequently found in promoters of transcriptionally active genes. (NURF) = Nucleosome Remodeling Factor H3K4me 4. For repression of transcription - Addition of methyl at lysine 9 in the tail of H3 histone protein (H3K9me3) H3K9me
16 1. Genomic Level Control : (C) Chromatin Remodeling 1. Some transcription factors & regulatory proteins alter chromatin structure without altering the chemical structure of the histones directly. 2. Known as: Chromatin Remodeling Complex. 3. They bind directly to particular sites on DNA and reposition nucleosomes, allowing trascription factors to bind to promoters.
17 1. Genomic Level Control : DNase I Hypersensitivity How do we know if the genes are transcriptionally active? The regions around the genes become highly sensitive to the action of DNase I Regions known as: DNase I Hypersensitive Sites Develops about 1kb upstream from the transcription start site Indicates that these regions adopt a more open configuration.
18 1. Genomic Level Control Epigenetic Inheritance? How histone modifications, nucleosome positioning & other types of epigenetic marks might be maintained is still unclear
19 2. Transcriptional Level Control Promoter Start of translation: AUG Enhancers/ Silencers Upstream Elements TATA Box -1 kb -25/-30 bp +1 bp Promoters: A DNA sequence to which RNA Pol binds prior to initiation of transcription. Contains a sequence called TATA box (7 bp consensus sequence 5 -TATA[A/T]A [A/T]-3 ). Enhancers: To stimulate/increase the activity of the promoters Orientation and position independent Silencers: Inhibits transcription Also orientation and position independent Transcription Factors (TFs): Bind to regulatory DNA sequences (promoters, enhancers) to regulate transcription Two types: (i) Basal TFs (eg. TFIIA, TFIIB)- bind at promoters, assisting RNA pol (ii) Specific TFs (eg. Sp1, C-Jun) bind at specific enhancers
20 2. Transcriptional Level Control
21 2. Transcriptional Level Control Hormonal Effects on Enhancer Human metallothionein protein 1. Regulation of zinc (Zn) & copper (Cu) in blood, detoxification of heavy metals, function of immune system, neuronal development. Synthesized in kidney and liver. 2. Usually expressed at very low level 3. Gene expression can be activated by cadmium(cd), copper(cu) ions or by glucocorticoid hormone. When glucocorticoid hormone is released, it binds to the glucocorticoid receptor (a kind of specific TF) protein Glucocorticoid receptor protein (+glucocorticoid) recognizes a specific enhancer called Glucocorticoid Response Element (GRE) in the metallothionein gene and binds to it -- this activates expression of the metallothionein gene. Response elements function in response to transient increase in the level of a substance or a regulatory hormone
22 2. Transcriptional Level Control Insulator 1. Also known as boundary element 2. What it is? DNA sequences that block or insulate the effect of enhancers in positiondependent manner
23 3. mrna Processing and Nuclear Transport Control 1. Splicing: The process of cutting the pre-mrna to remove the introns and joining together the exons. 2. Alternative splicing: is a process that occurs in which the splicing process of a pre-mrna transcribed from one gene can lead to different mature mrna molecules and therefore to different protein." Fibronectin Gene Exon EIIIB Exon EIIIA Primary mrna transcript of fibronectin gene 5 3 Fibroblast mrna Liver mrna - exons EIIIA and EIIIB are spliced out in liver mrna transcript A single gene can code for two or more related proteins, depending on how the exons/ introns are spliced
24 3. mrna Processing and Nuclear Transport Control 1. Speed of Transport of mrna Through the Nuclear Pores Evidence suggests that this time may vary. 2. Longevity of mrna mrna can last a long time. For example, mammalian red blood cells eject their nucleus but continue to synthesize hemoglobin for several months. This indicates that mrna is available to produce the protein even though the DNA is gone. Ribonucleases are enzymes that destroy mrna. mrna has noncoding nucleotides at either end of the molecule contain info about the number of times mrna is transcribed before being destroyed by ribonucleases. Poly A tail stabilizes mrna transcripts. Hormones can stabilize certain mrna transcripts Prolactin Prevents Digestion Gene for Casein mrna Casein Milk DNA Ribonuclease Ribonuclease Digest
25 4. Translational Level Control 5 Untranslated Region (5 UTR) Starts from transcription start site to just before the initiation codon (ATG) Contains sequence that regulate translation efficiency i. Binding site for proteins that may effect the translation e.g. Iron responsive elements (also in 3 UTR) regulate gene expression in response to iron. ii. Kozak sequence RccAUGG, where R is a purine (A or G) 3 bases upstream of the start codon, follow by another G. Translation more efficient with Kozak sequence. 3 Untranslated Region (3 UTR) Starts from stop codon, end before poly A tail. Contains regulatory sequence for efficient translation i. For cystoplasmic localization of mrna ii. Binding site for : SECIS elements direct ribosome to translate codon UGA as selenocysteines. MicroRNA (a type of RNAi)
26 4. Translational Level Control A bit about RNA interference (RNAi) 1. From DNA, transcribed but not translated 2. About 30% of human genes regulated by RNA interference 3. In eukaryotes, fungi, plants, animals RNAi syahril@medic.upm.edu.my
27 4. Translational Level Control : RNAi Mechanisms 1. RNA Cleavage 2. Inhibition of Translation 3. Transcriptional Silencing RISC: RNA-induced silencing complex RITS: RNA-induced transcriptional silencing
28 5. Post-Translational Processing These mechanisms act after the protein has been produced 1. Protein cleavage and/or splicing. The initial polypeptide can be cut into different functional pieces, with different patterns of cleavage occurring in different tissues. In some cases, different pieces may be spliced together. e.g. Bovine proinsulin is a precursor to the hormone insulin. It must be cleaved into 2 polypeptide chains and about 30 amino acids must be removed to form insulin.
29 5. Post-Translational Processing 2. Chemical modification. Protein function can be modified by addition of methyl, acetyl, alkyl, phosphoryl, or glycosyl groups. E.g. How can phosphorylation control enzyme activity? Addition of phosphate causes conformational changes to the protein. Opens up the active site for catalytic process.
30 Review
31 The End
Differential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationCHAPTER 13 LECTURE SLIDES
CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationChapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".
Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationEpigenetics. Medical studies in English, Lecture # 12,
Epigenetics Medical studies in English, 2018. Lecture # 12, Epigenetics Regulation of gene activity in eukaryotes Correlation of chromatin structure with transcription stably heritable phenotype resulting
More informationDifferential Gene Expression
Biology 4361 - Developmental Biology Differential Gene Expression June 18, 2009 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationRegulation of Gene Expression
Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationGENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s
GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationDivision Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationChapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationLecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics
Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Epigenetics represents the science for the studying heritable
More informationGene Regulation in Eukaryotes
Gene Regulation in Eukaryotes The latest estimates are that a human cell, a eukaryotic cell, contains 20,000 25,000 genes. Some of these are expressed in all cells all the time. These so-called housekeeping
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationChromatin Structure and its Effects on Transcription
Chromatin Structure and its Effects on Transcription Epigenetics 2014 by Nigel Atkinson The University of Texas at Austin From Weaver 4th edition and Armstrong 1st edition What is the point? DNA is not
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles
More informationChapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license.
Chapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license. 2013, Rice University. CHAPTER 16 GENE EXPRESSION 429 16 GENE EXPRESSION
More informationGene Expression and Heritable Phenotype. CBS520 Eric Nabity
Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.
More informationNUCLEUS. Fig. 2. Various stages in the condensation of chromatin
NUCLEUS Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion. Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents some linear molecules
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationEukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
More informationChapter 5 DNA and Chromosomes
Chapter 5 DNA and Chromosomes DNA as the genetic material Heat-killed bacteria can transform living cells S Smooth R Rough Fred Griffith, 1920 DNA is the genetic material Oswald Avery Colin MacLeod Maclyn
More informationTRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long
Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double
More informationRegulation of Gene Expression in Eukaryotes
12 Regulation of Gene Expression in Eukaryotes WORKING WITH THE FIGURES 1. In Figure 12-4, certain mutations decrease the relative transcription rate of the -globin gene. Where are these mutations located,
More informationStructure/function relationship in DNA-binding proteins
PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationDifferential Gene Expression
IBS 8102 Cell, Molecular, and Developmental Biology Differential Gene Expression January 22, 2008 Differential Gene Expression Chromatin structure Gene anatomy Gene sequences Control of gene transcription
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationChapter 24: Promoters and Enhancers
Chapter 24: Promoters and Enhancers A typical gene transcribed by RNA polymerase II has a promoter that usually extends upstream from the site where transcription is initiated the (#1) of transcription
More informationMCDB 1041 Class 21 Splicing and Gene Expression
MCDB 1041 Class 21 Splicing and Gene Expression Learning Goals Describe the role of introns and exons Interpret the possible outcomes of alternative splicing Relate the generation of protein from DNA to
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationREGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes
REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation
More informationChapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome
Chapter 14 Control of Eukaryotic Genome How many genes? Genes only ~3% of human genome protein-coding sequences 1% of human genome non-protein coding genes 2% of human genome trna ribosomal RNAs sirnas
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationMechanism of action-1
Mechanism of action-1 receptors: mediators of hormone action, membrane associated vs. intracellular receptors: measurements of receptor - ligand interactions, regulation mechanisms surface - receptors:
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationGenes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology
Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may
More informationRead and take notes on pages
Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have
More informationEUKARYOTIC REGULATION C H A P T E R 1 3
EUKARYOTIC REGULATION C H A P T E R 1 3 EUKARYOTIC REGULATION Every cell in an organism contains a complete set of DNA. But it doesn t use all of the DNA it receives Each cell chooses different DNA sequences
More informationWhat is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed
RNA Section 3.1 What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed Used to direct the production of proteins that determines an organisms characteristics
More informationWhat is Epigenetics? Watch the video
EPIGENETICS What is Epigenetics? The study of environmental factors on gene expression in DNA. The molecule is called methylation controls when genes are turned on. Methylation turns off genes. Acetylation
More informationSpring 2006 Biochemistry 302 Exam 2
Name Spring 2006 Biochemistry 302 Exam 2 Directions: This exam has 45 questions/problems totaling 110 points. Check to make sure you have seven pages. Some questions have multiple parts so read each one
More informationGene Expression Transcription
Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction
More informationRNA and Protein Synthesis
Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College RNA and Protein Synthesis Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that
More informationNOTES Gene Expression ACP Biology, NNHS
Name Date Block NOTES Gene Expression ACP Biology, NNHS Model 1: Transcription the process of genes in DNA being copied into a messenger RNA 1. Where in the cell is DNA found? 2. Where in the cell does
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationChromatin and Transcription
Chromatin and Transcription Chromatin Structure Chromatin Represses Transcription Nucleosome Positioning Histone Acetylation Chromatin Remodeling Histone Methylation CHIP Analysis Chromatin and Elongation
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationCHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES
CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationDNA Transcription. Visualizing Transcription. The Transcription Process
DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More information1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic
More informationNeurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants
Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationClasses of eukaryotic cellular RNAs
Classes of eukaryotic cellular RNAs ribosomal RNA (rrna) 18S (small subunit) 28S (large subunit) 5.8S (large subunit) 5S (large subunit) transfer RNA (trna) messenger RNA (mrna) heterogeneous nuclear RNA
More informationDevelopmental Biology BY1101 P. Murphy
Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision
More informationEukaryotic & Prokaryotic Transcription. RNA polymerases
Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000
More informationInformation Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
More informationChapter 9-II - Transcriptional Control of Gene Expression
Chapter 9-II - Transcriptional Control of Gene Expression Transcriptional Control of Gene Expression 9.3 RNA Polymerase II Promoters and General Transcription Factors Three types of promoter sequences
More informationRNA Structure and the Versatility of RNA. Mitesh Shrestha
RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationExam 2 BIO200, Winter 2012
Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationLecture 9 Controlling gene expression
Lecture 9 Controlling gene expression BIOLOGY Campbell, Reece and Mitchell Chapter 18 334- (352-356) Every cell in your body contains the same number of genes approximately 35, 000 DNA is wound around
More information