Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory

Size: px
Start display at page:

Download "Gene Regulation in Eukaryotes. Dr. Syahril Abdullah Medical Genetics Laboratory"

Transcription

1 Gene Regulation in Eukaryotes Dr. Syahril Abdullah Medical Genetics Laboratory

2 Lecture Outline 1. The Genome 2. Overview of Gene Control 3. Cellular Differentiation in Higher Eukaryotes 4. The Regulation of Gene Expression 4.1. Genomic Level Control 4.2. Transcriptional Level Control 4.3. mrna Processing & Nuclear Transport Control 4.4. Translational Level Control 4.5. Post-Translational Level Control 5. Review A darn difficult topic You better stay awake! syahril@medic.upm.edu.my

3 The Genome 1. Bacteria e.g. E. coli has genome of 4 x 10 6 base pairs gene products 2. Human genome: 3,200,000,000 (3 billion) bp (haploid) - but only 20,000-25,000 gene products - i.e % of human genome do not have direct genetic function!! - hence redundancy of eukaryotic genome Organism Type Organism Genome Size (bp) Amoeba Amoeba dubia 670,000,000,000 Nematode Caenorhabditis elegans 100,300,000 Insect Apis mellifera (honey bee) 1,770,000,000 Fish Protopterus aethiopicus 130,000,000,000 C-value Enigma there is no correlation between complexity of an organism and its genome size!! syahril@medic.upm.edu.my

4 Overview of Gene Control 1. There are many different cell types in a multicellular organism (white blood cells, neurons, epithelial cells etc) 2. Each cell type arises from the selective expression of a subset of genes in the genome. 3. In many cases, the genetic program that predetermines a cell to be a certain cell type can be re-programmed to become another type of cell. 4. In cloning Dolly the sheep, the researcher took the nucleus from a lamb s udder and placed it into an egg of which the nucleus has been removed - the transplanted nucleus regenerated the whole lamb.

5 Overview of Gene Control 5. Many biochemical processes are common to all cell types, and thus a majority of genes are expressed in all cell types (e.g., glycolytic pathway enzymes, actin, etc.) 6. Other biochemical processes are specific to certain cells (e.g. hemoglobin in red blood cells). 7. In many cases, these tissue-specific genes are highly expressed in one or a few types of cells and not expressed at all in others.

6 Cellular Differentiation in Higher Eukaryotes 1. Each mammalian cell contains the same complete set of genome, regardless of which tissues or organs they are from (two copies except haploid cells). Nucleus contains all the necessary information, encoded in DNA, to control the formation of a whole organism 2. Yet different types of mammalian cells express widely different proteins even though each cell has the same complement of genes

7 Cellular Differentiation in Higher Eukaryotes 3. In addition, the same type of cells can have different patterns of protein synthesis during different developmental stages, for example the globin genes Different members of the globin gene family are are transcribed at different stages of human development

8 The Regulation of Gene Expression 1. Genomic Level Control - involves silencing or expression at chromatin structure or at DNA level. 2. Transcriptional Level Control - involves turning on or off the gene expression - most important point of control for most genes 3. mrna Processing & Nuclear Transport Control - controlling how the primary RNA transcript is spliced or processed - some RNAs are selectively transported to the cytoplasm 4. Translational Level Control - selecting which mrnas are translated by ribosomes - control of mrna stability 5. Post-Translational Processing - at level of protein - may be modified by various mechanisms like phosphorylation, ligand binding and etc. - affected by the rates of protein degradation, or its subcellular localization

9

10 1. Genomic Level Control 1. There are transcriptionally active and inactive regions through out the genome. 2. How are these regions controlled? A. Methylation of cytosine residues in DNA B. Histone modifications i. Histone Acetylation ii. Histone Methylation C. Chromatin Remodeling 3. These are the types of Epigenetics What is epigenetics? Changes in phenotype (appearance) or gene expression caused by mechanisms other than changes in the underlying DNA sequence, hence the name epi- (Greek: over; above) -genetics. Changes may remain through cell divisions for the remainder of the cell's life and may also last for multiple generations.

11 1. Genomic Level Control : (A) Methylation of Cytosine in DNA a. CpG rich region is a short stretch of DNA in which the frequency of CG sequence is higher than other regions in the genome (p=phosphodiester bond). b % all all CpGs are methylated in mammals c. Unmethylated CpGs are known as CpG island located in promoter regions d. DNA methylation can switch off gene expression i. By impeding the binding of transcriptional proteins (i.e. RNA pol, transcription factors). DNA methyltransferase ii. Methylated DNA bound by methyl-cpg-binding domain proteins (MBDs) recruits additional proteins.remodel histones next slides e. Active gene (expressed gene) is undermethylated; Inactive (silent) gene is hypermethylated f. Loss of methyl-cpg-binding protein 2 (MeCP2) = Rett syndrome MBD2 causes transcriptional silencing of hypermethylated genes in cancer

12 1. Genomic Level Control : (B) Histone Modifications i. Histone Acetylation 1. Histone acetyltransferase (HAT) acetylate histone proteins = genes transcriptionally active 2. From previous slide: MBDs bound to methylated CpG, recruits histone deacytelases (HDAC) takes away the acetyl group = genes transcriptionally inactive.

13 1. Genomic Level Control : (B) Histone Modifications Transcriptionally inactive Transcriptionally active Chromatin: DNA + Histones i. Euchromatin = loosely packed, active genes ii. Heterochromatin = condensed region, genes transcriptionally silent. At centromeres

14 1. Genomic Level Control Transcription Transcription Factors RNA Pol Acetylation Association between CpG methylation and histone acetylations DNA Methyltransferase 5-methyl-C 1. Silencing due to the chromatin compaction. 2. Interfere with the entry of transcription factors. Methyl CpG Binding Proteins Histone Deacetylase NO Transcription Deacetylation Transcription factors Chromatin Compaction Transcriptional Silencing

15 1. Genomic Level Control : (B) Histone Modifications ii. Histone Methylation 1. Addition of methyl groups to the tail of histone proteins 2. Activation or repression depending on which amino acids in the tail are methylated. 3. For activation of transcription: - Addition of methyl at lysine 4 in the tail of H3 histone protein (H3K4me3) - Frequently found in promoters of transcriptionally active genes. (NURF) = Nucleosome Remodeling Factor H3K4me 4. For repression of transcription - Addition of methyl at lysine 9 in the tail of H3 histone protein (H3K9me3) H3K9me

16 1. Genomic Level Control : (C) Chromatin Remodeling 1. Some transcription factors & regulatory proteins alter chromatin structure without altering the chemical structure of the histones directly. 2. Known as: Chromatin Remodeling Complex. 3. They bind directly to particular sites on DNA and reposition nucleosomes, allowing trascription factors to bind to promoters.

17 1. Genomic Level Control : DNase I Hypersensitivity How do we know if the genes are transcriptionally active? The regions around the genes become highly sensitive to the action of DNase I Regions known as: DNase I Hypersensitive Sites Develops about 1kb upstream from the transcription start site Indicates that these regions adopt a more open configuration.

18 1. Genomic Level Control Epigenetic Inheritance? How histone modifications, nucleosome positioning & other types of epigenetic marks might be maintained is still unclear

19 2. Transcriptional Level Control Promoter Start of translation: AUG Enhancers/ Silencers Upstream Elements TATA Box -1 kb -25/-30 bp +1 bp Promoters: A DNA sequence to which RNA Pol binds prior to initiation of transcription. Contains a sequence called TATA box (7 bp consensus sequence 5 -TATA[A/T]A [A/T]-3 ). Enhancers: To stimulate/increase the activity of the promoters Orientation and position independent Silencers: Inhibits transcription Also orientation and position independent Transcription Factors (TFs): Bind to regulatory DNA sequences (promoters, enhancers) to regulate transcription Two types: (i) Basal TFs (eg. TFIIA, TFIIB)- bind at promoters, assisting RNA pol (ii) Specific TFs (eg. Sp1, C-Jun) bind at specific enhancers

20 2. Transcriptional Level Control

21 2. Transcriptional Level Control Hormonal Effects on Enhancer Human metallothionein protein 1. Regulation of zinc (Zn) & copper (Cu) in blood, detoxification of heavy metals, function of immune system, neuronal development. Synthesized in kidney and liver. 2. Usually expressed at very low level 3. Gene expression can be activated by cadmium(cd), copper(cu) ions or by glucocorticoid hormone. When glucocorticoid hormone is released, it binds to the glucocorticoid receptor (a kind of specific TF) protein Glucocorticoid receptor protein (+glucocorticoid) recognizes a specific enhancer called Glucocorticoid Response Element (GRE) in the metallothionein gene and binds to it -- this activates expression of the metallothionein gene. Response elements function in response to transient increase in the level of a substance or a regulatory hormone

22 2. Transcriptional Level Control Insulator 1. Also known as boundary element 2. What it is? DNA sequences that block or insulate the effect of enhancers in positiondependent manner

23 3. mrna Processing and Nuclear Transport Control 1. Splicing: The process of cutting the pre-mrna to remove the introns and joining together the exons. 2. Alternative splicing: is a process that occurs in which the splicing process of a pre-mrna transcribed from one gene can lead to different mature mrna molecules and therefore to different protein." Fibronectin Gene Exon EIIIB Exon EIIIA Primary mrna transcript of fibronectin gene 5 3 Fibroblast mrna Liver mrna - exons EIIIA and EIIIB are spliced out in liver mrna transcript A single gene can code for two or more related proteins, depending on how the exons/ introns are spliced

24 3. mrna Processing and Nuclear Transport Control 1. Speed of Transport of mrna Through the Nuclear Pores Evidence suggests that this time may vary. 2. Longevity of mrna mrna can last a long time. For example, mammalian red blood cells eject their nucleus but continue to synthesize hemoglobin for several months. This indicates that mrna is available to produce the protein even though the DNA is gone. Ribonucleases are enzymes that destroy mrna. mrna has noncoding nucleotides at either end of the molecule contain info about the number of times mrna is transcribed before being destroyed by ribonucleases. Poly A tail stabilizes mrna transcripts. Hormones can stabilize certain mrna transcripts Prolactin Prevents Digestion Gene for Casein mrna Casein Milk DNA Ribonuclease Ribonuclease Digest

25 4. Translational Level Control 5 Untranslated Region (5 UTR) Starts from transcription start site to just before the initiation codon (ATG) Contains sequence that regulate translation efficiency i. Binding site for proteins that may effect the translation e.g. Iron responsive elements (also in 3 UTR) regulate gene expression in response to iron. ii. Kozak sequence RccAUGG, where R is a purine (A or G) 3 bases upstream of the start codon, follow by another G. Translation more efficient with Kozak sequence. 3 Untranslated Region (3 UTR) Starts from stop codon, end before poly A tail. Contains regulatory sequence for efficient translation i. For cystoplasmic localization of mrna ii. Binding site for : SECIS elements direct ribosome to translate codon UGA as selenocysteines. MicroRNA (a type of RNAi)

26 4. Translational Level Control A bit about RNA interference (RNAi) 1. From DNA, transcribed but not translated 2. About 30% of human genes regulated by RNA interference 3. In eukaryotes, fungi, plants, animals RNAi syahril@medic.upm.edu.my

27 4. Translational Level Control : RNAi Mechanisms 1. RNA Cleavage 2. Inhibition of Translation 3. Transcriptional Silencing RISC: RNA-induced silencing complex RITS: RNA-induced transcriptional silencing

28 5. Post-Translational Processing These mechanisms act after the protein has been produced 1. Protein cleavage and/or splicing. The initial polypeptide can be cut into different functional pieces, with different patterns of cleavage occurring in different tissues. In some cases, different pieces may be spliced together. e.g. Bovine proinsulin is a precursor to the hormone insulin. It must be cleaved into 2 polypeptide chains and about 30 amino acids must be removed to form insulin.

29 5. Post-Translational Processing 2. Chemical modification. Protein function can be modified by addition of methyl, acetyl, alkyl, phosphoryl, or glycosyl groups. E.g. How can phosphorylation control enzyme activity? Addition of phosphate causes conformational changes to the protein. Opens up the active site for catalytic process.

30 Review

31 The End

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:

More information

CHAPTER 13 LECTURE SLIDES

CHAPTER 13 LECTURE SLIDES CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )

More information

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer

Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling

More information

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a true nucleus. Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Epigenetics. Medical studies in English, Lecture # 12,

Epigenetics. Medical studies in English, Lecture # 12, Epigenetics Medical studies in English, 2018. Lecture # 12, Epigenetics Regulation of gene activity in eukaryotes Correlation of chromatin structure with transcription stably heritable phenotype resulting

More information

Differential Gene Expression

Differential Gene Expression Biology 4361 - Developmental Biology Differential Gene Expression June 18, 2009 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Regulation of Gene Expression

Regulation of Gene Expression Slide 1 Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s

GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have

More information

BIOLOGY. Chapter 16 GenesExpression

BIOLOGY. Chapter 16 GenesExpression BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

DNA Transcription. Dr Aliwaini

DNA Transcription. Dr Aliwaini DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger

More information

Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics

Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Epigenetics represents the science for the studying heritable

More information

Gene Regulation in Eukaryotes

Gene Regulation in Eukaryotes Gene Regulation in Eukaryotes The latest estimates are that a human cell, a eukaryotic cell, contains 20,000 25,000 genes. Some of these are expressed in all cells all the time. These so-called housekeeping

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Chromatin Structure and its Effects on Transcription

Chromatin Structure and its Effects on Transcription Chromatin Structure and its Effects on Transcription Epigenetics 2014 by Nigel Atkinson The University of Texas at Austin From Weaver 4th edition and Armstrong 1st edition What is the point? DNA is not

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles

More information

Chapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license.

Chapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license. Chapter 16: Gene Expression from Biology by OpenStax College is licensed under a Creative Commons Attribution 3.0 Unported license. 2013, Rice University. CHAPTER 16 GENE EXPRESSION 429 16 GENE EXPRESSION

More information

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.

More information

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin NUCLEUS Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion. Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents some linear molecules

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Eukaryotic Gene Structure

Eukaryotic Gene Structure Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and

More information

Chapter 5 DNA and Chromosomes

Chapter 5 DNA and Chromosomes Chapter 5 DNA and Chromosomes DNA as the genetic material Heat-killed bacteria can transform living cells S Smooth R Rough Fred Griffith, 1920 DNA is the genetic material Oswald Avery Colin MacLeod Maclyn

More information

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long

TRANSCRIPTION COMPARISON OF DNA & RNA TRANSCRIPTION. Umm AL Qura University. Sugar Ribose Deoxyribose. Bases AUCG ATCG. Strand length Short Long Umm AL Qura University TRANSCRIPTION Dr Neda Bogari TRANSCRIPTION COMPARISON OF DNA & RNA RNA DNA Sugar Ribose Deoxyribose Bases AUCG ATCG Strand length Short Long No. strands One Two Helix Single Double

More information

Regulation of Gene Expression in Eukaryotes

Regulation of Gene Expression in Eukaryotes 12 Regulation of Gene Expression in Eukaryotes WORKING WITH THE FIGURES 1. In Figure 12-4, certain mutations decrease the relative transcription rate of the -globin gene. Where are these mutations located,

More information

Structure/function relationship in DNA-binding proteins

Structure/function relationship in DNA-binding proteins PHRM 836 September 22, 2015 Structure/function relationship in DNA-binding proteins Devlin Chapter 8.8-9 u General description of transcription factors (TFs) u Sequence-specific interactions between DNA

More information

Chapter 10: Gene Expression and Regulation

Chapter 10: Gene Expression and Regulation Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must

More information

Differential Gene Expression

Differential Gene Expression IBS 8102 Cell, Molecular, and Developmental Biology Differential Gene Expression January 22, 2008 Differential Gene Expression Chromatin structure Gene anatomy Gene sequences Control of gene transcription

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Chapter 24: Promoters and Enhancers

Chapter 24: Promoters and Enhancers Chapter 24: Promoters and Enhancers A typical gene transcribed by RNA polymerase II has a promoter that usually extends upstream from the site where transcription is initiated the (#1) of transcription

More information

MCDB 1041 Class 21 Splicing and Gene Expression

MCDB 1041 Class 21 Splicing and Gene Expression MCDB 1041 Class 21 Splicing and Gene Expression Learning Goals Describe the role of introns and exons Interpret the possible outcomes of alternative splicing Relate the generation of protein from DNA to

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation

More information

Chapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome

Chapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome Chapter 14 Control of Eukaryotic Genome How many genes? Genes only ~3% of human genome protein-coding sequences 1% of human genome non-protein coding genes 2% of human genome trna ribosomal RNAs sirnas

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

Mechanism of action-1

Mechanism of action-1 Mechanism of action-1 receptors: mediators of hormone action, membrane associated vs. intracellular receptors: measurements of receptor - ligand interactions, regulation mechanisms surface - receptors:

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Name Class Date. Practice Test

Name Class Date. Practice Test Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.

More information

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may

More information

Read and take notes on pages

Read and take notes on pages Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have

More information

EUKARYOTIC REGULATION C H A P T E R 1 3

EUKARYOTIC REGULATION C H A P T E R 1 3 EUKARYOTIC REGULATION C H A P T E R 1 3 EUKARYOTIC REGULATION Every cell in an organism contains a complete set of DNA. But it doesn t use all of the DNA it receives Each cell chooses different DNA sequences

More information

What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed

What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed RNA Section 3.1 What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed Used to direct the production of proteins that determines an organisms characteristics

More information

What is Epigenetics? Watch the video

What is Epigenetics? Watch the video EPIGENETICS What is Epigenetics? The study of environmental factors on gene expression in DNA. The molecule is called methylation controls when genes are turned on. Methylation turns off genes. Acetylation

More information

Spring 2006 Biochemistry 302 Exam 2

Spring 2006 Biochemistry 302 Exam 2 Name Spring 2006 Biochemistry 302 Exam 2 Directions: This exam has 45 questions/problems totaling 110 points. Check to make sure you have seven pages. Some questions have multiple parts so read each one

More information

Gene Expression Transcription

Gene Expression Transcription Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College RNA and Protein Synthesis Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that

More information

NOTES Gene Expression ACP Biology, NNHS

NOTES Gene Expression ACP Biology, NNHS Name Date Block NOTES Gene Expression ACP Biology, NNHS Model 1: Transcription the process of genes in DNA being copied into a messenger RNA 1. Where in the cell is DNA found? 2. Where in the cell does

More information

DNA and RNA. Chapter 12

DNA and RNA. Chapter 12 DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

From Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Chromatin and Transcription

Chromatin and Transcription Chromatin and Transcription Chromatin Structure Chromatin Represses Transcription Nucleosome Positioning Histone Acetylation Chromatin Remodeling Histone Methylation CHIP Analysis Chromatin and Elongation

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

DNA Transcription. Visualizing Transcription. The Transcription Process

DNA Transcription. Visualizing Transcription. The Transcription Process DNA Transcription By: Suzanne Clancy, Ph.D. 2008 Nature Education Citation: Clancy, S. (2008) DNA transcription. Nature Education 1(1) If DNA is a book, then how is it read? Learn more about the DNA transcription

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic

More information

Neurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants

Neurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are

More information

RNA and PROTEIN SYNTHESIS. Chapter 13

RNA and PROTEIN SYNTHESIS. Chapter 13 RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

Classes of eukaryotic cellular RNAs

Classes of eukaryotic cellular RNAs Classes of eukaryotic cellular RNAs ribosomal RNA (rrna) 18S (small subunit) 28S (large subunit) 5.8S (large subunit) 5S (large subunit) transfer RNA (trna) messenger RNA (mrna) heterogeneous nuclear RNA

More information

Developmental Biology BY1101 P. Murphy

Developmental Biology BY1101 P. Murphy Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision

More information

Eukaryotic & Prokaryotic Transcription. RNA polymerases

Eukaryotic & Prokaryotic Transcription. RNA polymerases Eukaryotic & Prokaryotic Transcription RNA polymerases RNA Polymerases A. E. coli RNA polymerase 1. core enzyme = ββ'(α)2 has catalytic activity but cannot recognize start site of transcription ~500,000

More information

Information Readout: Transcription and Post-transcriptional Processing Translation

Information Readout: Transcription and Post-transcriptional Processing Translation Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase

More information

Chapter 9-II - Transcriptional Control of Gene Expression

Chapter 9-II - Transcriptional Control of Gene Expression Chapter 9-II - Transcriptional Control of Gene Expression Transcriptional Control of Gene Expression 9.3 RNA Polymerase II Promoters and General Transcription Factors Three types of promoter sequences

More information

RNA Structure and the Versatility of RNA. Mitesh Shrestha

RNA Structure and the Versatility of RNA. Mitesh Shrestha RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Exam 2 BIO200, Winter 2012

Exam 2 BIO200, Winter 2012 Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12

More information

Chapter 10 - Molecular Biology of the Gene

Chapter 10 - Molecular Biology of the Gene Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),

More information

Lecture 9 Controlling gene expression

Lecture 9 Controlling gene expression Lecture 9 Controlling gene expression BIOLOGY Campbell, Reece and Mitchell Chapter 18 334- (352-356) Every cell in your body contains the same number of genes approximately 35, 000 DNA is wound around

More information