RNA:Protein Interactions
|
|
- Owen Cole
- 6 years ago
- Views:
Transcription
1 RNA:Protein Interactions
2 List of contributors Abbreviations 1. Applications of chemically synthesized RNA Michael J. Gait, David J. Earnshaw, Mark A. Farrow, Jan H. Fogg, Richard L. Grenfell, Nikolai A. Naryshkin, and Terence V. Smith 1. Basic methods of synthesis and purification of oligoribonucleotides Introduction Assembly of oligoribonucleotides Deprotection of oligoribonucleotides Purification of oligoribonucleotides 2. Incorporation of modified ribonucleotides Base analogues Ribose analogues Phosphate analogues 3. Analysis of oligoribonucleotides and analogues Capillary electrophoresis MALDI-TOF mass spectrometry Analysis of oligoribonucleotides by enzymatic digestion and reversed-phase HPLC 4. Synthetic RNA duplex models for HIV-1 Tat protein interaction Competition gel retardation assays Interference filter binding assays 5. Cross-linking of peptides and proteins to modified synthetic RNA Acknowledgements References Preparation of RNA:protein complexes for X-ray crystallography and NMR 37 Stephen R. Price, Chris Oubridge, Gabriele Varani, and Kiyoshi Nagai 1. Introduction 37
3 2. Preparation of T7 RNA polymerase In vitro transcription using oligonucleotide or plasmid templates 40 RNA synthesis by run-off transcription using oligonucleotide templates 40 In vitro transcription using plasmid templates Gel purification of transcribed RNA 51 Casting gels for preparative RNA purification 52 Extraction of RNA from polyacrylamide gels 53 Desalting RNA 55 Concentration of RNA Preparation of isotopically labelled RNA for NMR 58 Purification of isotopically labelled RNA from bacterial sources Preparation of RNA:protein complexes for crystallization and NMR analysis 66 Checking purity of RNA 66 Reconstituting the RNA:protein complex 69 Crystallization strategy of RNA:protein complexes 71 Acknowledgements 72 References Uses of site-specifically modified RNAs constructed by RNA ligation 75 Melissa J. Moore and Charles C. Query 1. Introduction 75 _ 2. Review of methods for introducing modified nucleotides into small RNAs 75 Chemical synthesis 77 Transcription with phage polymerases 77 Coupling chemical synthesis to transcription: dinucleotide primers Synthesis of long RNAs by transcription Techniques for RNA ligation T4 RNA ligase T4 DNA ligase Chemical ligation 5. Examples of cross-linking proteins to site-specifically modified RNAs Photocross-linking proteins to RNA Patch labelling Using T4 DNA ligase to incorporate single labels at internal sites in RNAs xii
4 Convertible nucleotides 98 Other photocross-linkable nucleotides 102 Determining cross-link specificity Additional uses for RNA ligation 105 References The electrophoretic mobility shift assay for RNA binding proteins 109 Douglas L. Black, Raymond Chan, Hosung Min, Jiwu Wang, and Leslie Bell 1. Introduction 109 Principle of electrophoretic mobility shift assay (EMSA) 109 General considerations Starting material: RNA and protein 111 Preparation of mammalian nuclear extracts 111 Preparing radiolabelled RNA for binding studies 113 Large scale synthesis of unlabelled RNA EMSA for protein:rna interactions 114 Binding conditions for the DCS complex " 114 Separation of RNA:protein complexes by native gel electrophoresis 115 Optimizing the binding reaction 116 The stability of an RNA:protein complex within the gel 117 Measuring the sequence specificity of binding Characterization of the proteins within a complex 120 UV cross-linking within a gel isolated complex 120 Antibody supershift and disruption experiments 123 EMSA as an assay for fractionation RNA binding analysis of purified proteins 124 EMSA with purified protein 124 Filter binding assay 125 Establishing the binding conditions 126 Determining the dissociation constant 128 Multiple binding sites and co-operativity 130 References Affinity methods for isolating RNA binding proteins 137 Ann Kaminski, Dirk H. Ostareck, Nancy M. Standart, and Richard J. Jackson 1. Introduction 137 Scope of the chapter 137 xiii
5 Overview of methods for affinity purification of RNA binding, proteins 138 Protein purification prior to affinity chromatography 139 Suggestions with regard to prioritizing approaches Large scale transcription reactions using bacteriophage RNA polymerases General recommendations for running RNA affinity columns Coupling RNA to CNBr-activated Sepharose 144 Use of affinity columns made by coupling RNA to CNBr-activated Sepharose The use of poly(a) tailed RNA affinity substrates Biotinylated RNA as an affinity matrix 150 Overview of methods for preparing biotinylated RNA affinity substrates 150 Modification of RNA by direct incorporation of biotinylated NTP 151 Two-step modification of RNA by incorporation of an amine-modified NTP, and subsequent biotinylation with biotinylated ester 153 Synthetic biotinylated oligoribonucleotides 154 Recovery of RNA binding proteins from the biotinylated RNA affinity matrix Other affinity methods for purifying RNA binding proteins The use of affinity columns for selectively removing specific RNA binding proteins from extracts 157 Acknowledgements 158 References Synthetic lethal/enhancer screening to identify snrna:protein and protein:protein interactions in yeast pre-mrna splicing i6i Francoise Stutz, Jie Tang, and Michael Rosbash 1. Introduction Ul snrna enhancer screen using a viability assay 165 General reagents and strains > 165 Protocols 166 Results and discussion of Ul snrna enhancer screen Identification of synthetic lethal mutations using the red/white sectoring assay 175 General reagents and strains 176 xiv
6 Protocols 177 Results and discussion of MUD2 synthetic lethal screen Concluding remarks 181 References Detecting RNA:protein interactions and isolating cdna clones by Northwestern screening 183 Jeffrey Wilusz 1. Introduction 183 General considerations for Northwestern detection of RNA:protein interactions 183 Probability of success Preparation of RNA probes Northwestern blots to detect RNA binding proteins Northwestern screening of cdna libraries 189 References A three-hybrid system to detect and analyse RNA:protein interactions in vivo 195 Beilin Zhang, Brian Kraemer, Dhruba Sengupta, Stanley Fields, and Marvin Wickens 1. Introduction Strategy of the three-hybrid system General considerations Potential applications Hybrid RNA molecules: general features 200 Constructing plasmids that encode hybrid RNA molecules Reporter strain The activation domain plasmid Analysing known RNA:proteiri interactions Screening for new proteins with a known RNA sequence: general strategy and considerations Perspective 215 Acknowledgements 215 References 215 xv
7 9. In vivo selection of specific RNA binding polypeptides using a transcription anti-termination reporter assay 217 Kazuo Harada and Alan D. Frankel 1. Introduction Detection of RNA:polypeptide interactions using the bacterial transcription anti-termination system Strategies in the design of combinatorial libraries 222 Library design 222 Preparation of combinatorial oligonucleotide cassettes Selection of novel peptides that bind to specific RNAs 229 Selection from randomized libraries 229 Selection from doped libraries Assessing activity 232 (3-Galactosidase solution assay 232 In vitro RNA binding gel shift assay Summary and future directions 235 References Footprinting and modification-interference analysis of binding sites on RNA 237 Chuck Merryman and Harry F. Noller 1. Introduction Experimental approach 238 General considerations 238 Footprinting 238 Modification-interference Chemical probing of RNA 240 Chemical probes 240 Probing conditions for footprinting experiments 241 Probing conditions for modification-interference experiments Protocols for chemical probing Primer extension Interpretation 249 Footprinting 249 Modification-interference 251 Concluding remarks 251 References 253 xvi
8 'Contents 11. Analysis of RNA:protein and RNA:RNA contacts between ribosomes and functional ligands using site-directed cross-linking techniques 255 Jutta Rinke-Appel and Richard Brimacombe 1. Introduction General considerations Insertion of photoreactive agents into ribosomal ligands 259 Preparation of mrna analogues containing 4-thioU by T7 polymerase 259 The use of diazirine or azide reagents for specific reaction with trna molecules at naturally modified positions 264 Modification of amino acids with TDB for in situ peptide biosynthesis Formation of ribosomal complexes for cross-linking and isolation of cross-linked material 268 Preparation of 70S ribosomes 268 Separation of cross-linked ribosomal components by sucrose gradient centrifugation 272 Affinity chromatography on oligo(dt) cellulose 273 Cross-linking yield Analysis of cross-link sites within rrna 274 Partial digestions of rrna by ribonuclease H in the presence of oligodeoxynucleotides 274 Identification of cross-link sites within rrna by primer extension Identification of cross-linked proteins Identification of cross-linked 4-thioU residues in mrna analogues 279 Identification of cross-linked 4-thioU residues from agarose-antibody complexes 279 Identification of cross-linked 4-thioU residues from ribonuclease H digests 281 Identification of 4-thioU residues cross-linked to ribosomal proteins separated after ribonuclease Tl digestion Concluding remarks 282 References In vitro selection of nucleic acid ligands 285 Richard C. Conrad, F. Maike Briick, Sabine Bell, and Andrew D. Ellington 1. Introduction 285 xvii
9 2. Overview Creation of the initial pool 288 Design of the degenerate oligonucleotide population 289 Solid state DNA synthesis 290 Amplification to generate a dsdna library 292 Conversion of the initial dsdna library to different types of pools Selection 301 Binding reaction 301 Methods for isolating target:aptamer complexes Amplification" Cycling and concluding the selection Characterizing aptamers 315 Cloning, sequencing, and structure determination 315 Binding assays 317 Acknowledgements 323 References 324 Al. List of suppliers 327 Index 335 XV1U
Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationTranscriptional Regulation in Eukaryotes
Transcriptional Regulation in Eukaryotes Concepts, Strategies, and Techniques Michael Carey Stephen T. Smale COLD SPRING HARBOR LABORATORY PRESS NEW YORK 2000 Cold Spring Harbor Laboratory Press, 0-87969-537-4
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationQuiz Submissions Quiz 4
Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationDirecte d Mutagenesis
Directe d Mutagenesis A Practical Approac h M. J. McPHERSON 1. Mutagenesis facilitated by the removal or introduction of unique restriction sites 1 P. Carte r 1. Introduction to site-directed mutagenesis
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationIntroduction to Protein Purification
Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography
More informationChapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More informationRecombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany RNA ligands that distinguish metabolite-induced conformations in the TPP riboswitch Günter Mayer, Marie-Sophie L. Raddatz, Julia D. Grunwald,
More informationChapter 3. Enzyme manipulation of DNA and RNA
Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationincluding, but not limited to:
*This Section is part of the original Request for Proposal # P08 080. The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationModule I: Introduction
Module I: Introduction 20.109 Lecture 1 3 February, 2011 Introduction to: Module Overview Fundamental concepts and techniques in molecular biology Appreciating nucleic acids (RNA in particular) as more
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationGenetic Engineering for Biofuels Production
Genetic Engineering for Biofuels Production WSE 573 Spring 2013 Greeley Beck INTRODUCTION Alternative transportation fuels are needed in the United States because of oil supply insecurity, oil price increases,
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationRNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation
RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationIndependent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationContents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationThe GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationMolecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD
Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationDo you remember. What is a gene? What is RNA? How does it differ from DNA? What is protein?
Lesson 1 - RNA Do you remember What is a gene? What is RNA? How does it differ from DNA? What is protein? Gene Segment of DNA that codes for building a protein DNA code is copied into RNA form, and RNA
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationTranscription is the first step of gene expression, in which a particular segment of DNA is copied into RNA by the enzyme, RNA polymerase.
Transcription in Bacteria Transcription in Bacteria Transcription in Bacteria Transcription is the first step of gene expression, in which a particular segment of DNA is copied into RNA by the enzyme,
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationRIBOPROBE GEMINI SYSTEM TRANSCRIPTION OF CLONED DNA
RIBOPROBE GEMINI SYSTEM TRANSCRIPTION OF CLONED DNA The protocols listed below are a modification of Melton, D.A., et al. (1984) Nucl. Acids Res. 12,7035-7056. REAGENTS 1. 5x transcription buffer 200 mm
More informationAmpliScribe T 7 Aminoallyl-RNA Transcription Kit
Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription
More informationLECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING
Page 1 of 25 Chapter 5 Notes Biochemistry 461 Fall 2010 CHAPTER 5, EXPLORING GENES: LECTURE TOPICS 1) RESTRICTION ENZYMES 2) GEL ELECTROPHORESIS OF DNA 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationRapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationKinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)
Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More information2. From the first paragraph in this section, find three ways in which RNA differs from DNA.
Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationThe Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationEukaryotic Transcription
Eukaryotic Transcription I. Differences between eukaryotic versus prokaryotic transcription. II. (core vs holoenzyme): RNA polymerase II - Promotor elements. - General Pol II transcription factors (GTF).
More informationAmino-allyl Dye Coupling Protocol
Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationLecture 8: Affinity Chromatography-III
Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationChapter Fundamental Molecular Genetic Mechanisms
Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationProtein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationBundle 6 Test Review
Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic
More informationChapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationTRANSCRIPTION AND TRANSLATION
TRANSCRIPTION AND TRANSLATION Bell Ringer (5 MINUTES) 1. Have your homework (any missing work) out on your desk and ready to turn in 2. Draw and label a nucleotide. 3. Summarize the steps of DNA replication.
More informationEnzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationSensitivity vs Specificity
Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More information