Hossain_Supplemental Figure 1
|
|
- Dulcie Neal
- 6 years ago
- Views:
Transcription
1 Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT in U2OS cells. Transient transfection of GFP-Orc1-PACT into U2OS cells. (A) U2OS cells were transiently transfected with GFP-Orc1 PACT, GFP-Orc1-PACT motif I and GFP-Orc1PACT motif II for 16 hours and further incubated for 8 hours in the presence or absence of 1 µm MG132, a proteasome inhibitor. The expression levels of Orc1 PACT proteins were determined by immunoblotting with GFP antibody. Equal loading of proteins in different lanes was confirmed by tubulin immunoblot. (B) Transiently overexpressed GFP-Orc1PACT protein in U2OS cells was co-stained with (for centrosome) and pericentrin (pericentriolar matrix) antibodies. Lower panel is at higher magnification.
2 A CyclinA Cdk2 H1a CyclinA Cdk2*H1a Orc1 K i Orc1 Hossain_Supplemental Figure 2 Kʹ i CyclinA Cdk2 H1a P P Orc1^CyclinA Cdk2 H1a P Orc1^CyclinA Cdk2*H1a B CyclinE Cdk2 H1a CyclinE Cdk2*H1a Orc1 CyclinE Cdk2 H1a P K i P Orc1^CyclinE Cdk2 Fig. S2. Kinetic models for Orc1 inhibition of Cyclin-CDK kinase activities on Histone H1 substrate. (A) The inhibition of cyclin A-Cdk2 kinase activity on histone H1a phosphorylation with Orc1 behaving as a mixed, non-competitive inhibitor. (B) The inhibition of cyclin E-Cdk2 kinase activity on histone H1a phosphorylation with Orc1 behaving as a competitive inhibitor only.
3 Hossain_Supplemental Figure 3 A MW (kda) Cyclin A-CDK MW (kda) Pull Down (2%) Input (5%) -Orc1 A-A -Orc1 R15Q Cyclin E-CDK2 MW (kda) -Orc1 A-A -Orc1 R15Q WB: Cyclin A WB: Cyclin E Fig. S3. Human Orc1 Interaction with Cyclin E-CDK2 or Cyclin A-CDK2 kinase. (A) A Coomassie Brilliant Blue stained gel of purified Cyclin A-CDK2 and Cyclin E- CDK2 kinase purified from baculovirus expression system (left and middle panel). Right panel shows purified -Orc1 wild type protein as well as its mutant derivatives (F89S, R15Q and E127G) purified from bacteria. MW stands for protein molecular weight marker in kilodalton. (B) In vitro interaction between Orc1 and the kinases in a pull down assay. The resin bound -Orc1 wild type or its mutant derivatives were incubated with purified Cyclin E-CDK2 or Cyclin A-CDK2. The specific binding of the kinases was detected by western blot using antibodies against Cyclin A or Cyclin E. Recombinant protein served as control protein in the assay.
4 Hossain_Supplemental Figure 4 A. C. GFP-CID-PACT GFP-CID PACT GFP-CID PACT Pericentrin Centrin 2 CEP17 SAS-6 GFP-CID-PACT GFP-CID-PACT Pericentrin GFP-CID PACT GFP-CID PACT Centrin 2 Centrin 2 GFP-CID PACT GFP-CID PACT CEP17 SAS-6 CEP17 SAS-6 Fig. S4. Localization of GFP-Orc1.CID. PACT in U2OS cells. Overexpression of GFP-Orc1-CID-PACT in U2OS cells. (A) U2OS cells were transiently transfected with GFP-Orc1-CID-PACT and the overexpressed protein was counter stained with (for centrosome) and pericentrin (pericentriolar matrix) antibodies. Lower panel is at higher magnification. (B) Transiently overexpressed GFP-Orc1-CID-PACT protein in U2OS cells were co-stained with (for centrosome) and Centrin-2 (centriole) antibodies. Lower panel is at higher magnification. (C) The GFP-Orc1-CIDPACT transfected U2OS cells was co-stained with CEP17 (grandmother centriole marker) and SAS-6 (daughter centrioles or pro-centrioles marker). Lower panel is at higher magnification.
5 Hossain_Supplemental Figure (µm) Cyclin A/Cdk2 Cyclin E/Cdk2 - Orc1-CID - Orc1-CID-PACT Fig. S5. Inhibition of Cyclin A-CDK2 or cyclin E-CDK2 kinase. The inhibition of cyclin E-Cdk2 or cyclin A-Cdk2 kinase activity on histone H1a phosphorylation with different molar amounts (,.25,.5,.75 and 1 µm) of - Orc1-CID (1-25 aa Orc1) or -Orc1-CID-PACT. Concentrations of Cyclin-CDK2 and histone H1a in the assay were1 nm and.5 µm, respectively.
6 A. 2 INPUT (2 %) -Orc1 R15Q -Orc1 W88A Streptavidin beads Pull Down(2%) -Orc1 R15Q -Orc1 W88A -Orc1 R15Q -Orc1 W88A Hossain_Supplemental Figure 6 Biotinylated H4K2me2 Peptide (1µg) Orc1 Bound (nm) Orc1 WT Orc1 F89S Orc1 R15Q Orc1 E127G Orc1 W88A Orc1 Input (nm) Fig. S6. -Orc1 binding to H4K2me2 peptide. (A) Biotinylated H4K2me2 peptide (1µg) was bound to streptavidin beads and incubated with 1µg -Orc1 wild type or its mutant protein. (B) Different concentration of -Orc1 wild type or its mutants were titrated for binding with 1µg of H4K2me2 peptide bound to streptavidin beads. Background subtraction was done with -Orc1 proteins bound to the beads only. Bands were quantified as described in methods section.
7 Hossain_Supplemental Fig. 7 Tetracycline (µg/ml) GFP-Orc1 WT 116 * ** WB: Orc1 WB: Tubulin GFP-Orc1 R15Q 116 * ** WB: Orc1 WB: Tubulin Fig. S7. Controlled expression of the transgene from stable cell lines. Western blot of whole cell extracts of U2OS Flp-in stable cell lines expressing either GFPOrc1 WT wild type or GFP-Orc1 R15Q mutant protein. The transgenes were induced for 3 days (72hours) with the indicated amounts of tetracycline. Monoclonal antibody against Human Orc1 was used to detect endogenous as well as GFP-Orc1 proteins. -Tubulin served as a control for equal loading of each sample. Single and double asterisk marks indicates the GFP-Orc1 transgene and endogenous Orc1, respectively.
8 A. 3 Control GFP-Orc1 WT GFP-Orc1 R15Q Hossain_Supplemental Figure 8 No. of Cells (x1 5 ) Days Fold Increase Control GFP-Orc1 WT GFP-Orc1 R15Q Days Fig. S8. Cell proliferation of GFP-Orc1 stable cell lines. U2OS Flp-in stable cell lines expressing either GFPOrc1 WT wild type or GFP-Orc1 R15Q mutant protein as well as control U2OS TreX cells were induced with tetracycline (.5 µg/ml) from day. Each of the cell lines were seeded in triplicate at a density of 1x1 5 cells a day before tetracycline addition. The cells were counted using Countess Automated Cell Counter (Invitrogen). The total number of cells for each cell line was followed for 5 days (A) and fold increase in cell number compared to day (B). The experiment was done in triplicate with standard deviations.
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we
More informationsupplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
More informationSupplemental Information. Plk1/Polo Phosphorylates Sas-4 at the Onset. of Mitosis for an Efficient Recruitment
Cell Reports, Volume 25 Supplemental Information Plk1/Polo Phosphorylates Sas-4 at the Onset of Mitosis for an Efficient Recruitment of Pericentriolar Material to Centrosomes Anand Ramani, Aruljothi Mariappan,
More informationSupplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.
More informationFigure legends for supplement
Figure legends for supplement Supplemental Figure 1 Characterization of purified and recombinant proteins Relevant fractions related the final stage of the purification protocol(bingham et al., 1998; Toba
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationFigure S1. USP-46 is expressed in several tissues including the nervous system
Supplemental Figure legends Figure S1. USP-46 is expressed in several tissues including the nervous system Transgenic animals expressing a transcriptional reporter (P::GFP) were imaged using epifluorescence
More informationNature Structural & Molecular Biology: doi: /nsmb.3308
Supplementary Figure 1 Analysis of CED-3 autoactivation and CED-4-induced CED-3 activation. (a) Repeat experiments of Fig. 1a. (b) Repeat experiments of Fig. 1b. (c) Quantitative analysis of three independent
More informationpt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M
Supplementary Methods MIG6 production, purification, inhibition, and kinase assays MIG6 segment 1 (30mer, residues 334 364) peptide was synthesized using standard solid-phase peptide synthesis as described
More informationRecruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells
SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes
More informationSupplementary material for: Materials and Methods:
Supplementary material for: Iron-responsive degradation of iron regulatory protein 1 does not require the Fe-S cluster: S.L. Clarke, et al. Materials and Methods: Fe-S Cluster Reconstitution: Cells treated
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,
Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationSupplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Gillespie et al., http://www.jcb.org/cgi/content/full/jcb.200907037/dc1 repressor complex induced by p38- Gillespie et al. Figure S1. Reduced fiber size
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
More informationsupplementary information
DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or
More informationSUPPLEMENTARY INFORMATION
Figure S1 The effect of T198A mutation on p27 stability. a, Hoechst 33342 staining for nuclei (see Fig 1d). Scale bar, 100 μm. b, Densitometric analysis of wild type and mutant p27 protein levels represented
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic
More informationSupplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb54 sensitivity (+/-) 3 det- WS bri-5 BL (nm) bzr-dbri- bzr-d/ bri- g h i a b c d e f Hypcocotyl length(cm) 5 5 PAC Hypocotyl length (cm)..8..4. 5 5 PPZ - - + + + + - + - + - + PPZ - - + + +
More informationSupplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
More informationNature Structural & Molecular Biology: doi: /nsmb.1583
Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,
More informationSupplementary Materials
Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty
More informationFigure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi
Figure S1. Verification of ihog Mutation by Protein Immunoblotting Extracts from S2R+ cells, embryos, and adults were analyzed by immunoprecipitation and immunoblotting with anti-ihog antibody. The Ihog
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3562 In the format provided by the authors and unedited. Supplementary Figure 1 Glucose deficiency induced FH-ATF2 interaction. In b-m, immunoblotting or immunoprecipitation analyses were
More informationSupplementary methods Shoc2 In Vitro Ubiquitination Assay
Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the
More informationXu et al., Supplementary Figures 1-7
Xu et al., Supplementary Figures 1-7 Supplementary Figure 1. PIPKI is required for ciliogenesis. (a) PIPKI localizes at the basal body of primary cilium. RPE-1 cells treated with two sirnas targeting to
More informationSupplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10.
α-cd3 + α-cd28: Time (min): + + + + + + + + + 0 5 15 30 60 120 180 240 300 360 360 n.s. Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of. Immunoblot of lysates from Jurkat cells
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3209 Supplementary Figure 1 IR induces the association of FH with chromatin. a, U2OS cells synchronized by thymidine double block (2 mm) underwent no release (G1 phase) or release for 2
More informationSupplementary Information for. hnrnp Q mediates a phase-dependent translation-coupled mrna decay of mouse. Period3.
Supplementary Information for hnrnp Q mediates a phase-dependent translation-coupled mrna decay of mouse Period3. Do-Yeon Kim, Eunyee Kwak, Sung-Hoon Kim, Kyung-Ha Lee, Kyung-Chul Woo and Kyong-Tai Kim
More informationSupplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments
Supplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments Hongchang Li, X. Shawn Liu, Xiaoming Yang, Yingmin
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationSupplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.
Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10
More informationSupporting Information
Supporting Information Üstün and Börnke, 2015 Figure S1: XopJ does not display acetyltransferase activity. Autoacetylation activity in vitro. Acetylation reactions using MBP, MBP-XopJ, GST and GST-HopZ1a
More informationSupplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17
Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More informationMolecular basis for H3K36me3 recognition by the Tudor domain of PHF1
Supplementary information Molecular basis for H3K36me3 recognition by the Tudor domain of PHF1 Catherine A. Musselman 1, Nikita Avvakumov 2, Reiko Watanabe 3, Christopher G. Abraham 4, Marie-Eve Lalonde
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationA RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1
A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the
More informationSupplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
More informationSupplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
More informationSupplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
More informationPDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ
PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ Supplementary Material Figure S1. PDIP46 is associated with Pol isolated by immunoaffinity chromatography.
More informationSupplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after
Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for
More informationSupplementary Figure 1 a
3 min PMA 45 min PMA AnnexinV-FITC Supplementary Figure 1 5 min PMA 15 min PMA a 9 min PMA 12 min PMA 5 min FGF7 15 min FGF7 3 min FGF7 6 min FGF7 9 min FGF7 12 min FGF7 5 min control 3 min control 6 min
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSMART PROTEIN LAYERS. Quantitative and standardized protein gel and Western blot analysis
SMART PROTEIN LAYERS Quantitative and standardized protein gel and Western blot analysis The challenge There is an increasing demand for quantitative, sensitive and reliable 1D gel and Western blot (WB)
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
More informationVCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor
VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor Liang Xue 1, Emily E. Blythe 1, Elyse C. Freiberger 2, Jennifer Mamrosh 1, Alexander S. Hebert
More informationmonoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
More informationSupplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2880 Supplementary Figure 1 Sequence alignment of Deup1 and Cep63. The protein sequence alignment was generated by the Clustal X 2.0 multiple sequence alignment program using default parameters.
More informationsupplementary information
DOI: 10.1038/ncb1816 A Gal4 Gal4 B Kinase domain C (1502) N (5111191) Interaction with SIAH1 C SIAH1 SIAH1 C (182) SIAH1 N (82282) RING domain Interaction with Input GST GSTSIAH1 1a a N C Input GST GSTSIAH1
More informationSupplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical
Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional
More informationPost-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Contents: Supplementary Figure 1. Additional structural and binding data for designed tuim peptides. Supplementary Figure 2. Subcellular localization patterns of designed tuim
More informationWESTERN BLOT. BCH462- Practical
WESTERN BLOT BCH462- Practical What is Antigen [Ag]? What is Antibody [Ab]? Immunoassay: is a test that uses the highly specific and selective antigen-antibody reactions forming antibody and antigen complexes
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More information42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
More informationAttenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by
Supplementary Methods and Figures Attenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by methylene blue for Alzheimer s disease treatment Wenchao Sun 1, Seongsoo Lee 1,2, Xiaoran
More informationJournal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2579 Figure S1 Incorporation of heavy isotope-labeled amino acids and enrichment of di-glycine modified peptides. The incorporation of isotopelabeled amino acids in peptides was calculated
More informationSupplementary Information for. Coordination of multiple enzyme activities by a single PCNA in archaeal Okazaki fragment.
Supplementary Information for Coordination of multiple enzyme activities by a single PCNA in archaeal Okazaki fragment maturation Thomas R. Beattie and Stephen D. Bell Sir William Dunn School of Pathology,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full//59/ra7/dc1 Supplementary Materials for Dok-7 ctivates the Muscle Receptor Kinase MuSK and Shapes Synapse Formation kane Inoue, Kiyoko Setoguchi, Yosuke Matsubara,
More informationSupplementary Information
Supplementary Information Figure S1. Transiently overexpressed ECFP-TIAF1/EYFP-TIAF1 causes apoptosis of Mv1Lu cells. Mv1Lu cells were transfected by electroporation with ECFP, EYFP, ECFP-TIAF1, EYFP-
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationSupplementary Information
Supplementary Information stability is regulated by CK2-dependent interaction with R2TP complex Patrick von Morgen 1,2, Kamila Burdova 1, Thomas G. Flower 3, Nicola J. O'Reilly 4, Simon J. Boulton 5, Stephen
More informationRegulation of autophagic activity by ζ proteins associated with class III. phosphatidylinositol-3 kinase. Mercedes Pozuelo Rubio
ONLINE SUPPORTING INFORMATION Regulation of autophagic activity by 14-3-3ζ proteins associated with class III phosphatidylinositol-3 kinase Mercedes Pozuelo Rubio entro Andaluz de Biología Molecular y
More informationSupplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in
Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in BL2 cells. The Ponceau S staining of the membranes or
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods:
SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells
More informationComparison of different methods for purification analysis of a green fluorescent Strep-tag fusion protein. Application
Comparison of different methods for purification analysis of a green fluorescent Strep-tag fusion protein Application Petra Sebastian Meike Kuschel Stefan Schmidt Abstract This Application Note describes
More informationThe microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and
SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationSupplemental Materials
Supplemental Materials Flores-Pérez et al., Supplemental Materials, page 1 of 5 Supplemental Figure S1. Pull-down and BiFC controls, and quantitative analyses associated with the BiFC studies. (A) Controls
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More informationSupplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
More informationSequence of C-terminal tail regions of myosin heavy chains in class XI of Nicotiana benthamiana (Nb
Fig. S1 Sequence of C-terminal tail regions of myosin heavy chains in class XI of Nicotiana benthamiana (Nb myosin XI-2, -F and K) and BY-2 cell (Nt 170-kD myosin and Nt 175-kD myosin). Amino acids identical
More informationThis is the author's accepted version of the manuscript.
This is the author's accepted version of the manuscript. The definitive version is published in Nature Communications Online Edition: 2015/4/16 (Japan time), doi:10.1038/ncomms7780. The final version published
More informationSupplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids.
Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. The cells were harvested 72 h after transfection. FLAG-tagged deubiquitinases
More information3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]
L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different
More informationSUPPLEMENTARY INFORMATION
The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were
More informationseminal vesicle thymus kidney lung liver
a 1 HEK293 1 B 3 3 T GFPSMAD TGFβ (T)/ BMP (B) IB: SMAD1/3TP IB: GFP b wild type mouse tissue kidney thymus seminal vesicle liver lung brain adipose tissue muscle pancreas heart uterus spleen testis IB:
More informationSupplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct
Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct (pgl38xgli), EWS-FLI1 luciferase reporter construct (NROB1-Luc) with or without GLI1, EWS- FLI1 and cdnas respectively.
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
More informationSupplementary
Supplementary information Supplementary Material and Methods Plasmid construction The transposable element vectors for inducible expression of RFP-FUS wt and EGFP-FUS R521C and EGFP-FUS P525L were derived
More informationSupplemental Figure 1
Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were
More informationStargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
More informationSupporting Online Material for
Supporting Online Material for Spatiotemporal dynamics of Aurora B-PLK1-MCAK signaling axis orchestrates kinetochore bi-orientation and faithful chromosome segregation Hengyi Shao, Yuejia Huang, Liangyu
More informationA novel mechanism of post-translational modulation of HMGA functions by the histone chaperone nucleophosmin.
A novel mechanism of post-translational modulation of HMGA functions by the histone chaperone nucleophosmin. Laura Arnoldo 1,#, Riccardo Sgarra 1,#, Eusebio Chiefari 2, Stefania Iiritano 2, Biagio Arcidiacono
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs
More informationSupplementary Information
Supplementary Information Peroxiredoxin-2 and STAT3 form a redox relay for H 2 O 2 signaling Mirko C. Sobotta 1, Willy Liou 1, Sarah Stöcker 1, Deepti Talwar 1, Michael Oehler 1, Thomas Ruppert 2, Annette
More information