Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1
|
|
- Maurice Sullivan
- 6 years ago
- Views:
Transcription
1 Introduction to Bioinformatics for Medical Research Gideon Greenspan TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics
2 Introduction to Bioinformatics What is Bioinformatics? Why do we need it? Development timeline Journals, books, websites How to access bioinformatics tools? Why is bioinformatics hard? PubMed and OMIM databases 2
3 Bioinformatics: What? NCBI: Research, development, or application of computational tools and approaches for expanding the use of biological, medical, behavioral or health data, including those to acquire, store, organize, archive, analyze, or visualize such data. Lincoln Stein: Biologists using computers, or the other way around. Martin Gerstel (Compugen): Bioinformatics is a name which will probably disappear with time. 3
4 Bioinformatics: Why? Storing large quantity of data Sequencing Crystallography DNA chips Enabling fast retrieval Database searching Data mining and analysis Integrate diverse sources 4
5 Human Genome Project Initiated in 1988, declared complete 2003 Major goals Determine base pairs Identify ~30,000 genes Computational tasks Storage and indexing Building contigs Scanning for genes 5
6 Human Genome Progress Source: EMBL Genome Monitoring Table 6
7 IBM s Blue Gene Task: in-silico protein folding Announced 1999 Expanded in ,000 times faster than Pentium IV Aim: Fold one protein per year 7
8 Bioinformatics: When? Watson and Crick DNA model 1955 Sanger sequences insulin protein N-W sequence alignment ARPANET (early Internet) PDB (Protein Data Bank) Sanger dideoxy DNA sequencing GenBank database PCR (Polymerase Chain Reaction) 8
9 USA s NCBI FASTA algorithm 1990 SWISS-PROT database Human Genome Initiative BLAST algorithm WWW (World Wide Web) 1995 Israel s INN Europe s EBI Celera Genomics 2000 First human genome draft 9
10 GenBank Growth Source: NCBI 10
11 PubMed Growth 14,000,000 12,000,000 Articles in Database 10,000,000 8,000,000 6,000,000 4,000,000 2,000,
12 Bioinformatics: Where? Journals 12
13 Books David W. Mount, Bioinformatics: Sequence and Genome Analysis Cynthia Gibas, Developing Bioinformatics Computer Skills Bryan P. Bergeron, Bioinformatics Computing 13
14 World Wide Web USA National Center for Biotechnology Information: European Bioinformatics Institute: ExPASy Molecular Biology Server: Israeli National Node: inn.org.il Open source news: bioinformatics.org German directory: bioinformatik.de 14
15 Bioinformatics: How? Pre-packaged tools Majority on World Wide Web Some require downloading Most are free to use Beginning development Mostly Unix environment Perl programming language 15
16 The Trouble with Nature Hard to represent Understanding still incomplete Some problems insoluble? 16
17 The Trouble with Man Confusing choice of tools Developed independently Written by and for nerds 17
18 Making it Simpler 18
19 PubMed MEDLINE publication database Over 17,000 journals Some other citations Papers from 1960s Over 12,000,000 entries Alerting services
20 A PubMed Entry Journal reference Volume, number, date, pages Title, authors, affiliation Abstract Cancer 2003 May 1;97(9): Links Related articles Full text (sometimes) Database entries Pregnancy and early-stage melanoma. Daryanani D, Plukker JT, De Hullu JA, Kuiper H, Nap RE, Hoekstra HJ. Division of Surgical Oncology, University Medical Center, Groningen, The Netherlands. BACKGROUND: Cutaneous melanomas are aggressive tumors with an unpredictable 20
21 Searching PubMed Structureless searches Automatic term mapping Structured searches Field names, e.g. [au], [ta], [dp], [ti] Boolean operators, e.g. AND, OR, NOT, () Additional features Subsets, limits Clipboard, history 21
22 OMIM Online Mendelian Inheritance in Man Genes and genetic disorders Edited by team at Johns Hopkins Updated daily Entries single-loci phenotypes (*) 1294 multi-loci phenotypes (#) 2415 unclassified phenotypes 22
23 An OMIM Entry Phenotype description Clinical features Diagnosis and treatment Molecular genetics Inheritance Model Mapping history Genetic locus/loci CYSTIC FIBROSIS; CF Alternative titles; symbols MUCOVISCIDOSIS Gene map locus 7q31.2 DESCRIPTION References Manifestations relate not only to the disruption of exocrine function of the pancreas 23
24 Searching OMIM Search Fields Disease name, e.g. hypertension Cytogenetic location, e.g. 1p31.6 Inheritance, e.g. autosomal dominant Browsing Interfaces Alphabetical by disease Genetic map Additional features like PubMed 24
Types of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationOnline Mendelian Inheritance in Man (OMIM)
HUMAN MUTATION 15:57 61 (2000) MDI SPECIAL ARTICLE Online Mendelian Inheritance in Man (OMIM) Ada Hamosh, Alan F. Scott,* Joanna Amberger, David Valle, and Victor A. McKusick McKusick-Nathans Institute
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationIntroduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools
Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationWorksheet for Bioinformatics
Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research
More informationCompiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology
Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four
More informationGenetic databases. Anna Sowińska-Seidler, MSc, PhD Department of Medical Genetics
Genetic databases Anna Sowińska-Seidler, MSc, PhD seidler@ump.edu.pl Department of Medical Genetics Genetic databases what to start with? www.ncbi.nml.nih.gov NCBI National Center for Biotechnology Information
More informationComputational Biology and Bioinformatics
Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management
More informationG4120: Introduction to Computational Biology
G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics
More informationB I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
More informationBioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
More informationbioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5
Bioinformatica 1 / 5 2 / 5 3 / 5 Bioinformatica Bioinformatics is the name given to these mathematical and computing approaches used to glean understanding of biological processes. Common activities in
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationSequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationProtein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationBioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
More informationIntroduc)on to Databases and Resources Biological Databases and Resources
Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationShort summary of the main features
Michael, D., and Yarden, A. (2007). Genetic engineering: from principles and methods to research and applications (A student text, and an internet site http://stwww.weizmann.ac.il/g-bio/geneengine/animations.html,
More informationCystic Fibrosis: A Trilogy Of Biochemistry, Physiology, And Therapy (Subject Collection From Cold Spring Harbor Perspectives In Medicine) READ ONLINE
Cystic Fibrosis: A Trilogy Of Biochemistry, Physiology, And Therapy (Subject Collection From Cold Spring Harbor Perspectives In Medicine) READ ONLINE If searching for the book Cystic Fibrosis: A Trilogy
More informationPractical Bioinformatics for Biologists (BIOS 441/641)
Practical Bioinformatics for Biologists (BIOS 441/641) - Course overview Yanbin Yin MO444 1 Room and computer access Room entry code: 2159 Computer access: user poduser 2 Compared to BIOS 443/643 and 646
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationCS 177 Introduction to Bioinformatics
CS 177 to Dr. Tom Wilke Department of Microbiology and Tropical Medicine e-mail: mtmtxw@gwumc.edu Tel.: 202 994 3635 Prof. Rahul Simha? School of Engineering and Applied Science (SEAS) e-mail: simha@seas.gwu.edu
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com
More informationDatabases in Bioinformatics. Molecular Databases. Molecular Databases. NCBI Databases. BINF 630: Bioinformatics Methods
Databases in Bioinformatics BINF 630: Bioinformatics Methods Iosif Vaisman Email: ivaisman@gmu.edu Molecular Databases Molecular Databases Nucleic acid sequences: GenBank, DNA Data Bank of Japan, EMBL
More informationBioinformatics for Cell Biologists
Bioinformatics for Cell Biologists Rickard Sandberg Karolinska Institutet 13-17 May 2013 OUTLINE INTRODUCTION Introduce yourselves HISTORY MODERN What is bioinformatics today? COURSE ONLINE LEARNING OPPORTUNITIES
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationRetrieval of gene information at NCBI
Retrieval of gene information at NCBI Some notes 1. http://www.cs.ucf.edu/~xiaoman/fall/ 2. Slides are for presenting the main paper, should minimize the copy and paste from the paper, should write in
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationChapter 5. Structural Genomics
Chapter 5. Structural Genomics Contents 5. Structural Genomics 5.1. DNA Sequencing Strategies 5.1.1. Map-based Strategies 5.1.2. Whole Genome Shotgun Sequencing 5.2. Genome Annotation 5.2.1. Using Bioinformatic
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationWhat is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.
What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationDiscover the Microbes Within: The Wolbachia Project. Bioinformatics Lab
Bioinformatics Lab ACTIVITY AT A GLANCE "Understanding nature's mute but elegant language of living cells is the quest of modern molecular biology. From an alphabet of only four letters representing the
More informationSequencing the Human Genome
The Biotechnology 339 EDVO-Kit # Sequencing the Human Genome Experiment Objective: In this experiment, DNA sequences obtained from automated sequencers will be submitted to Data bank searches using the
More informationBioinformatics Databases
Bioinformatics Databases Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com Agenda
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationPractical Bioinformatics for Biologists (BIOS493/700)
Practical Bioinformatics for Biologists (BIOS493/700) - Course overview Yanbin Yin Spring 2013 MO444 1 BIOS 643 and 646 Minimum theoretical intro A LOT of practical applications Goal: enhance the use of
More informationRESEARCH METHODOLOGY, BIOSTATISTICS AND IPR
MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy
More informationGenome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
More informationThis practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.
PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,
More informationMARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305
MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What
More informationKlinisk kemisk diagnostik BIOINFORMATICS
Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,
More informationIntroduction on Several Popular Nucleic Acids Databases
Introduction on Several Popular Nucleic Acids Databases Changmin Liao Library, China West Normal University, Nanchong City, P. R. liaochangminlxh@yahoo.com.cn Abstract-Nucleic acids are major biological
More informationSoftware review. Bioinformatics software resources
Bioinformatics software resources Keywords: bioinformatics software archives, web hyperlink catalogues, bioinformatics news Abstract This review looks at internet archives, repositories and lists for obtaining
More informationONLINE BIOINFORMATICS RESOURCES
Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower
More informationLesson Overview. Studying the Human Genome. Lesson Overview Studying the Human Genome
Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful
More informationINTRODUCTION TO BIOINFORMATICS. SAINTS GENETICS Ian Bosdet
INTRODUCTION TO BIOINFORMATICS SAINTS GENETICS 12-120522 - Ian Bosdet (ibosdet@bccancer.bc.ca) Bioinformatics bioinformatics is: the application of computational techniques to the fields of biology and
More informationDatabases/Resources on the web
Databases/Resources on the web Jon K. Lærdahl jonkl@medisin.uio.no A lot of biological databases available on the web... MetaBase, the database of biological databases (1801 entries) - h p://metadatabase.org
More informationAAGTGCCACTGCATAAATGACCATGAGTGGGCACCGGTAAGGGAGGGTGATGCTATCTGGTCTGAAG. Protein 3D structure. sequence. primary. Interactions Mutations
Introduction to Databases Lecture Outline Shifra Ben-Dor Irit Orr Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information
More informationBioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
More informationMicroarrays & Gene Expression Analysis
Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed
More informationThe Gene Gateway Workbook
The Gene Gateway Workbook A collection of activities derived from the tutorials at Gene Gateway, a guide to online data sources for learning about genetic disorders, genes, and proteins. To view the chromosomes
More informationProteomics: New Discipline, New Resources. Fred Stoss, University at Buffalo, NERM 2004, Rochester, NY
Proteomics: New Discipline, New Resources Fred Stoss, University at Buffalo, NERM 2004, Rochester, NY What is Proteomics? Systematic analysis of protein expression of normal and diseased tissues that involves
More informationNiemann-Pick Type C Disease Gene Variation Database ( )
NPC-db (vs. 1.1) User Manual An introduction to the Niemann-Pick Type C Disease Gene Variation Database ( http://npc.fzk.de ) curated 2007/2008 by Dirk Dolle and Heiko Runz, Institute of Human Genetics,
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics 260.602.01 September 1, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Teaching assistants Hugh Cahill (hugh@jhu.edu) Jennifer Turney (jturney@jhsph.edu) Meg Zupancic
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationProfessor Jane Farrar School of Genetics & Microbiology, TCD.
Lecture 1 Genetics An Overview Professor Jane Farrar School of Genetics & Microbiology, TCD. CAMPBELL BIOLOGY Campbell, Reece and Mitchell CONCEPTS OF GENTICS Klug and Cummings A Whistle-Stop Tour of 150
More informationBasics in Genetics. Teruyoshi Hishiki
Basics in Genetics Teruyoshi Hishiki Advanced Bioinformatics 10/Apr/2017 1 Contents 1. Human Genetics: an application A case study of Familial Mediterranean Fever (FMF) patients 2. Introduction to human
More informationExamination Assignments
Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationGrundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationOverview of Health Informatics. ITI BMI-Dept
Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational
More informationCSC 121 Computers and Scientific Thinking
CSC 121 Computers and Scientific Thinking Fall 2005 Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors
More informationBIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1
BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1 Bioinformatics Databases http://bioboot.github.io/bioinf525_w17/module1/#1.1 Dr. Barry Grant Jan 2017 Overview: The purpose of this lab session is
More informationBIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM)
BIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM) Note: This material is adapted from Web-based Bioinformatics Tutorials: Exploring Genomes by
More informationBioInformatics at FSU what it is, who s doing it, and why it needs to be done now. Steve Thompson
BioInformatics at FSU what it is, who s doing it, and why it needs to be done now. Steve Thompson Florida State University School of Computational Science and Information Technology (CSIT) Introductory
More informationCommunity-assisted genome annotation: The Pseudomonas example. Geoff Winsor, Simon Fraser University Burnaby (greater Vancouver), Canada
Community-assisted genome annotation: The Pseudomonas example Geoff Winsor, Simon Fraser University Burnaby (greater Vancouver), Canada Overview Pseudomonas Community Annotation Project (PseudoCAP) Past
More informationFACULTY OF LIFE SCIENCES
FACULTY OF LIFE SCIENCES SYLLABUS FOR Interdisciplinary Course Biotechnology (UG & PG) (Under Credit Based Continuous Evaluation Grading System) Examinations: 2015-16 GURU NANAK DEV UNIVERSITY AMRITSAR
More informationEuropean Genome phenome Archive at the European Bioinformatics Institute. Helen Parkinson Head of Molecular Archives
European Genome phenome Archive at the European Bioinformatics Institute Helen Parkinson Head of Molecular Archives What is EMBL-EBI? International, non-profit research institute Part of the European Molecular
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationWhat You NEED to Know
What You NEED to Know Major DNA Databases NCBI RefSeq EBI DDBJ Protein Structural Databases PDB SCOP CCDC Major Protein Sequence Databases UniprotKB Swissprot PIR TrEMBL Genpept Other Major Databases MIM
More informationBIOINFORMATICS IN BIOCHEMISTRY
BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and
More informationCourse Syllabus for FISH/CMBL 7660 Fall 2008
Course Syllabus for FISH/CMBL 7660 Fall 2008 Course title: Molecular Genetics and Biotechnology Course number: FISH 7660/CMBL7660 Instructor: Dr. John Liu Room: 303 Swingle Hall Lecture: 8:00-9:15 a.m.
More informationDatabases in genomics
Databases in genomics Search in biological databases: The most common task of molecular biologist researcher, to answer to the following ques7ons:! Are they new sequences deposited in biological databases
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in
More informationDOWNLOAD OR READ : UNDERSTANDING BIOINFORMATICS PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : UNDERSTANDING BIOINFORMATICS PDF EBOOK EPUB MOBI Page 1 Page 2 understanding bioinformatics understanding bioinformatics pdf understanding bioinformatics Bioinformatics / ËŒ b aéª. oêš
More informationFUNDAMENTALS OF GENETICS A.PPT [READ-ONLY] - BERGENFIELD
PDF S A.PPT [READ-ONLY] - BERGENFIELD (PDF) S - RESEARCHGATE 1 / 5 2 / 5 3 / 5 fundamentals of genetic pdf Fundamentals of Genetics Chapter 9. Heredity: the transmission of genetic information from one
More informationBig picture and history
Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the
More informationNUCLEIC ACIDS. DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides.
NUCLEIC ACIDS DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides. Base Adenine Guanine Cytosine Uracil Thymine Abbreviation A G C U T DNA RNA 2
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 8
More informationGlobal Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource
Global Biomolecular Information Infrastructure and Australia Graham Cameron Director The EMBL Australia Bioinformatics Resource What is bioinformatics? Methods, data, IT to exploit biomolecular information
More informationSince 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL
Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality
More informationPolymorphisms in Population
Computational Biology Lecture #5: Haplotypes Bud Mishra Professor of Computer Science, Mathematics, & Cell Biology Oct 17 2005 L4-1 Polymorphisms in Population Why do we care about variations? Underlie
More informationSequence Variations. Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms. NCBI SNP Primer:
Sequence Variations Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms NCBI SNP Primer: http://www.ncbi.nlm.nih.gov/about/primer/snps.html Overview Mutation and Alleles Linkage Genetic variation
More information