GENOME ANALYSIS AND BIOINFORMATICS

Size: px
Start display at page:

Download "GENOME ANALYSIS AND BIOINFORMATICS"

Transcription

1

2 GENOME ANALYSIS AND BIOINFORMATICS

3 GENOME ANALYSIS AND BIOINFORMATICS A Practical Approach T.R. Sharma Principal Scientist (Biotechnology) National Research Centre on Plant Biotechnology IARI Campus, Pusa, New Delhi , India I.K. International Publishing House Pvt. Ltd. NEW DELHI BANGALORE

4 Published by I.K. International Publishing House Pvt. Ltd. S-25, Green Park Extension Uphaar Cinema Market New Delhi (India) ik_in@vsnl.net ISBN I.K. Publishing House Pvt. Ltd. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or any means: electronic, mechanical, photocopying, recording, or otherwise, without the prior written permission from the publisher. Published by Krishan Makhijani for I.K. International Publishing House Pvt. Ltd., S-25, Green Park Extension, Uphaar Cinema Market, New Delhi and Printed by Rekha Printers Pvt. Ltd., Okhla Industrial Area, Phase II, New Delhi

5 Dedicated to my mother and my wife

6 Foreword The research in biological sciences is undergoing tremendous change because of the availability of numerous genomics tools. Major impetus in genome research came with the decoding of human genome for which draft sequence was published in June Simultaneously, genomes of many microbes, mammals, fungi and plant species are being sequenced in different laboratories of the world. Now more than 4000 organisms genomes have been decoded and sequences are available in public domain. To make use of this massive sequence information, and discover the hidden knowlege, extensive analysis of this sequence inforamation, and discover the hidden knowledge, extensive analysis of this sequence information is highly desirable. Post-genomics era will witness complete transformation, the research is being conducted in different species. Bioinformatics tools would be helpful in locating DNA sequences in the GenBank simply from their accession numbers, making alignments of two or more than two sequences, performing similarity searches for unknown sequences in the GenBank, assembling short sequence reads and developing consensus sequences, finding genes and markers in sillico and in performing comparative genome analysis. The book entitled, Genome Analysis and Bioinformatics A Practical Approach has been written in such a way so that the teachers, scientists and student, both in computer and biology should understand the basic principles of sequences analysis and bioinformatics. In this era of information technology and biotechnology, sharing and dissemination of information has relatively become easy. The author, Dr. T.R. Sharma has put some complex issues related to genomics and bioinformatics in a very simple and understandable language. I am sure it will go a long way in making an impact on biological research and teaching in the country. (MANGALA RAI) Seceratary, Department of Agricultural Research & Education and Director General, Indian Council of Agricultural Research Ministry of Agriculture, Krishi Bhavan, New Delhi

7 Preface With the decoding of complete genome sequence of many organisms like human, mouse, rice Arabidopsis and many microorganisms new vistas of research have started not only in these species but also in related species by comparative and functional genomics approaches. The published data on genome sequence of these organisms reveals a comprehensive picture of the DNA codes and positions and distribution of all the genes, repetitive sequences and centromeres in the genome. Determination of individual DNA components in the form of ATGC base pairs by using various sequencing techniques and parallel advances in recombinant DNA technology helped in the study of an organism at whole genome level. DNA sequence information is becoming an indispensable tool in modern biology. However, efficient use of this information can only be performed by understanding basics of genomics and bioinformatics. For the application of genome sequence information for the benefits of human being, trained human resource is required. Being associated with the sequencing of rice genome under International Rice Genome Sequencing Project from 2000 to 2005, I was supposed to learn basics of high throughput genome sequencing, sequence assembly, annotation and performing comparative genome analysis at the National Research Centre on Plant Biotechnology (NRCPB), IARI, New Delhi and at the Cold Spring Harbor Laboratory, NY, USA as part of my Training on High throughput DNA Sequencing and bioinformatics. It was indeed a great challenge to understand and then apply genomics and bioinformatics techniques in the rice genome analysis. It was also an opportunity to read extensively many good books on molecular biology and bioinformatics. Subsequently, I got an opportunity to design and teach a course on Bioinformatics for the Post Graduate School of the Indian Agricultural Research Institute, New Delhi. During these years, I was using various books and web resources as reading and teaching material. Though I found various interesting and very good books on genomics, molecular biology and bioinformatics, many times it was difficult to understand basics of important topics and then explaining those to the students.

8 x Preface I was always looking for a book which includes basic topics on genomics and bioinformatics in a very simple communicable language so that any beginner can start these subjects without any difficulty. To achieve this objective a hybrid book on Genome Analysis and Bioinformatics : A Practical Approach was planned. It will definitely act as beginner guide to both biologists who are interested in bioinformatics and to the computer experts who want to make career in bioinformatics. An effort has been made to explain various aspects in a simplest possible manner using well labeled diagrams and figures. For the application of bioinformatics tools, wherever necessary, practical exercises have been included along with different steps so that one can use basic minimum bioinformatics tools without any difficulty. It would be a basic book for researchers and students of B.Tech/M.Tech (Bioinformatics & Biotechnology), all post-graduate students of biology, genetics, genomics & biotechnology and even for MCAs etc. At this moment, I would like to thank various individuals who inspired and encouraged me at one or other occasions during my academic life. First of all, I am really very thankful to my teacher, Prof. B.M. Singh, Former Dean, College of Agriculture, Agricultural University, Palampur from whom I have learnt to put my thoughts in a very simple manner. I am grateful to Dr. N.K. Singh, Principal Scientist, NRCPB, with whom I am involved in sequencing rice, tomato and Pigeonpea genomes and shared very good research experiences. I am also very much thankful to the former and present Project Director of NRCPB, for their whole-hearted support and also providing me very congenial teaching and research environment. For the preparation of this book many Research Associates and Research Fellows working in my different projects have helped me in the initial phase of collection of reading material. I thank all of them for their help. However, I am specially thankful to Mr. D.K. Gupta and Ms H. Sonah for collecting material on chapters related to sequence alignment, phylogeny analysis and DNA marker analysis, respectively. I also thank Mr. Jitender Pareek for the redrawing of various figures included in this book. I am also grateful to many anonymous individuals who have provided very good reading material on the World Wide Web and also to various genome centres that are making genome sequences available in the public domain. I would like to place on record my special thanks to my wife Mrs. Madhu Sharma, daughter Asuda and son Akshaj for their full co-operation and endurance during these past few years since, 1 could not spare much time for them because of my pressing academic commitments. I would also like to thank my parents and brothers who were the main source of inspiration and support for me to reach upto this level. I wish that this book should reach to all parts of the country so that students, researchers and teachers can make best use of it and give their feedback for its further improvement. T.R. Sharma

9 Contents Foreward... v Preface... vii Abbreviations... xv 1. Introduction High Throughput Genome Sequencing... 6 Dideoxy Methods of DNA Sequencing... 6 Chemical method of DNA sequencing... 8 Pyrosequencing High Throughput Genome Sequencing Whole genome shotgun method...11 Hierarchical sequencing method Construction of Physical Maps Shotgun Cloning Methods of Generating Random DNA Fragments Sonication Nebulization Hydroshearing Size-selection of Fragmented DNA Using Electrophoresis DNA Ligation Transformation Criteria Quality Check of a Shotgun Library Template preparation for sequencing Automated DNA Sequencing... 17

10 xii Contents 3. Genome Assembly and Finishing Genome Assembly Softwares used for Genome Assembly and their Applications Trimming vector sequences Determination of sequence quality Sequence assembly Assembly view Common Problems in the Draft Sequence and Genome Finishing Physical gaps Sequence gaps Genome finishing Different methods used for genome finishing Transposon method Custom primer method PCR method Final Verification of the Assembly Genome Databases What is a Database? Types of Databases Flat-file database Relation database Hierarchical database Database Management System Relational database management system Data processing Architecture used for application development MVC architecture Working of MVC Architecture Biological Databases Divisions of DNA databases Divisions of protein databases Different Classes of Plant Genome Databases Two Important Plant Genome Databases Arabidopsis thaliana genome databases Oryza sativa genome databases Pair-wise Sequence Alignment Basic Process of Alignment Sequence Alignment Algorithms... 50

11 Genome Analysis and Bioinformatics : A Practical Approach 25% OFF Publisher : IK International ISBN : Author : T R Sharma Type the URL : Get this ebook

GENOME ANALYSIS AND BIOINFORMATICS: A PRACTICAL APPROACH BY T.R. SHARMA

GENOME ANALYSIS AND BIOINFORMATICS: A PRACTICAL APPROACH BY T.R. SHARMA Read Online and Download Ebook GENOME ANALYSIS AND BIOINFORMATICS: A PRACTICAL APPROACH BY T.R. SHARMA DOWNLOAD EBOOK : GENOME ANALYSIS AND BIOINFORMATICS: A PRACTICAL Click link bellow and free register

More information

COURSES OFFERED FOR Ph.D. CURRICULUM

COURSES OFFERED FOR Ph.D. CURRICULUM COURSES OFFERED FOR Ph.D. CURRICULUM July 2017 onwards Department of Biochemistry Faculty of Interdisciplinary and Applied Sciences University of Delhi South Campus Benito Juarez Road New Delhi-110021

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

M.Sc. Biochemistry (Colleges) onwards BHARATHIAR UNUIVERSITY, COIMBATORE

M.Sc. Biochemistry (Colleges) onwards BHARATHIAR UNUIVERSITY, COIMBATORE Page 1 of 5 SCAA Dt. 24.04.2015 BHARATHIAR UNUIVERSITY, COIMBATORE 654 046. M.SC. BIOCHEMISTRY (Revised papers for the candidates admitted from the academic year 2015-16 onwards) Note: The revised syllabi

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

13-2 Manipulating DNA Slide 1 of 32

13-2 Manipulating DNA Slide 1 of 32 1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study

More information

Course summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects.

Course summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects. Goals Organization Labs Project Reading Course summary DNA sequencing. Genome Projects. Today New DNA sequencing technologies. Obtaining molecular data PCR Typically used in empirical molecular evolution

More information

Molecular Biology: DNA sequencing

Molecular Biology: DNA sequencing Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides

More information

INDUSTRIAL BIOTECHNOLOGY Problems and Remedies

INDUSTRIAL BIOTECHNOLOGY Problems and Remedies INDUSTRIAL BIOTECHNOLOGY Problems and Remedies By the same Author Environmental Biotechnology Basic Concepts and Applications Environmental biotechnology is a rapidly growing field with increasing relevance

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

T h i r d e d i t i o n For Instructors

T h i r d e d i t i o n For Instructors T h i r d e d i t i o n For Instructors I n t r o d u c t i o n t o P l a n t B i o t e c h n o l o g y H. S. C h a w l a Introduction to Plant Biotechnology Third Edition T h i r d Edition I n t r o

More information

Course Syllabus for FISH/CMBL 7660 Fall 2008

Course Syllabus for FISH/CMBL 7660 Fall 2008 Course Syllabus for FISH/CMBL 7660 Fall 2008 Course title: Molecular Genetics and Biotechnology Course number: FISH 7660/CMBL7660 Instructor: Dr. John Liu Room: 303 Swingle Hall Lecture: 8:00-9:15 a.m.

More information

Data Mining and Applications in Genomics

Data Mining and Applications in Genomics Data Mining and Applications in Genomics Lecture Notes in Electrical Engineering Volume 25 For other titles published in this series, go to www.springer.com/series/7818 Sio-Iong Ao Data Mining and Applications

More information

2 Gene Technologies in Our Lives

2 Gene Technologies in Our Lives CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?

More information

Mate-pair library data improves genome assembly

Mate-pair library data improves genome assembly De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate

More information

Short summary of the main features

Short summary of the main features Michael, D., and Yarden, A. (2007). Genetic engineering: from principles and methods to research and applications (A student text, and an internet site http://stwww.weizmann.ac.il/g-bio/geneengine/animations.html,

More information

ESSENTIAL BIOINFORMATICS

ESSENTIAL BIOINFORMATICS ESSENTIAL BIOINFORMATICS Essential Bioinformatics is a concise yet comprehensive textbook of bioinformatics that provides a broad introduction to the entire field. Written specifically for a life science

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology FM.indd i 6/7/2010 5:56:51 PM Recombinant DNA Technology Prof. Sardul Singh Sandhu M.Sc., M. Phill., Ph. D. & D. Sc. Director Centre of Scientific Research and Development (CSRD)

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

Indira s OBJECTIVE AGRICULTURAL BIOTECHNOLOGY

Indira s OBJECTIVE AGRICULTURAL BIOTECHNOLOGY Indira s OBJECTIVE AGRICULTURAL BIOTECHNOLOGY 2nd Edition Dr. R.L. Arya Senior Scientist Central Tobacco Research Institute Research Station, Dinhata, Coochbehar (W.B.) Sonam Arya Ph.D. Research Scholar

More information

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided. AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing

More information

Genome Projects. Part III. Assembly and sequencing of human genomes

Genome Projects. Part III. Assembly and sequencing of human genomes Genome Projects Part III Assembly and sequencing of human genomes All current genome sequencing strategies are clone-based. 1. ordered clone sequencing e.g., C. elegans well suited for repetitive sequences

More information

Chapter 15 The Human Genome Project and Genomics. Chapter 15 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning

Chapter 15 The Human Genome Project and Genomics. Chapter 15 Human Heredity by Michael Cummings 2006 Brooks/Cole-Thomson Learning Chapter 15 The Human Genome Project and Genomics Genomics Is the study of all genes in a genome Relies on interconnected databases and software to analyze sequenced genomes and to identify genes Impacts

More information

Genome Biology and Biotechnology

Genome Biology and Biotechnology Genome Biology and Biotechnology Functional Genomics Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

ZOO 4926 Special Topics: Genomics and Biotechnology

ZOO 4926 Special Topics: Genomics and Biotechnology ZOO 4926 Special Topics: Genomics and Biotechnology Description Big data and genomics are prominent in the medical and agricultural life-sciences. Students will be introduced to modern next-generation

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

bioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5

bioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5 Bioinformatica 1 / 5 2 / 5 3 / 5 Bioinformatica Bioinformatics is the name given to these mathematical and computing approaches used to glean understanding of biological processes. Common activities in

More information

Genomics and Bioinformatics GMS6231 (3 credits)

Genomics and Bioinformatics GMS6231 (3 credits) Genomics and Bioinformatics GMS6231 (3 credits) COURSE DESCRIPTION: Principles of genomic characterization and bioinformatic analysis of eukaryotes, including an overview of analytical platforms, computational

More information

Molecular Techniques in Crop Improvement

Molecular Techniques in Crop Improvement Molecular Techniques in Crop Improvement Molecular Techniques in Crop Improvement Edited by S. Mohan Jain International Atomic Energy Agency, FAO/IAEA Joint Division, Vienna, Austria D.S. Brar International

More information

7 Gene Isolation and Analysis of Multiple

7 Gene Isolation and Analysis of Multiple Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple

More information

Name Date Class CHAPTER 13. DNA Fingerprinting

Name Date Class CHAPTER 13. DNA Fingerprinting Real-World Biology: Analysis DNA Fingerprinting Genetic Prints Help Solve Mystery of Girls Switched at Birth. Murder Conviction Overturned by DNA Testing: Prisoner Released. Headlines such as these have

More information

10. BIOTECHNOLOGY (Code No. 045)

10. BIOTECHNOLOGY (Code No. 045) 10. BIOTECHNOLOGY (Code No. 045) An unprecedented growth of human knowledge in the field of Biological Sciences coupled with equally significant developments in the field of technology have brought significant

More information

B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).

B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases). Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Quickstart Molecular Biology

Quickstart Molecular Biology Quickstart Molecular Biology An Introduction for Mathematicians, Physicists, and Computational Scientists ALSO FROM COLD SPRING HARBOR LABORATORY PRESS A Genetic Switch, Third Edition, Phage Lambda Revisited

More information

Division of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi

Division of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi Circular ICAR--HRM Training Programme for Scientific Staff ICAR 2017--18 2017 Genomics--Assisted Breeding Genomics for Crop Improvement (March 1-21, 2018) Programme Director: Dr. Ashok K. Singh Division

More information

Unit 8: Genomics Guided Reading Questions (150 pts total)

Unit 8: Genomics Guided Reading Questions (150 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 18 The Genetics of Viruses and Bacteria Unit 8: Genomics Guided

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases

More information

Properties and Applications of Metals and Alloys

Properties and Applications of Metals and Alloys ENGINEERING MATERIALS Properties and Applications of Metals and Alloys C.P. Sharma ENGINEERING MATERIALS Properties and Applications of Metals and Alloys C.P. SHARMA Department of Metallurgical Engineering

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms

More information

Bioinformatics Course AA 2017/2018 Tutorial 2

Bioinformatics Course AA 2017/2018 Tutorial 2 UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it

More information

Genome Sequencing-- Strategies

Genome Sequencing-- Strategies Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

Thank you. Arun Kumar

Thank you. Arun Kumar Thank you for choosing a Shuchita Product! If you have any comment, observation or feedback, I would like to personally hear from you. Please write to me at arun@shuchita.com. Arun Kumar i For any complaint/suggestion,

More information

Genetics and Biotechnology. Section 1. Applied Genetics

Genetics and Biotechnology. Section 1. Applied Genetics Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section

More information

DNA sequencing. Course Info

DNA sequencing. Course Info DNA sequencing EECS 458 CWRU Fall 2004 Readings: Pevzner Ch1-4 Adams, Fields & Venter (ISBN:0127170103) Serafim Batzoglou s slides Course Info Instructor: Jing Li 509 Olin Bldg Phone: X0356 Email: jingli@eecs.cwru.edu

More information

CHAPTER 21 GENOMES AND THEIR EVOLUTION

CHAPTER 21 GENOMES AND THEIR EVOLUTION GENETICS DATE CHAPTER 21 GENOMES AND THEIR EVOLUTION COURSE 213 AP BIOLOGY 1 Comparisons of genomes provide information about the evolutionary history of genes and taxonomic groups Genomics - study of

More information

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September

More information

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome

Studying the Human Genome. Lesson Overview. Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome THINK ABOUT IT Just a few decades ago, computers were gigantic machines found only in laboratories and universities. Today, many of us carry small, powerful

More information

GM Crops Information Sharing- Needs and Challenges

GM Crops Information Sharing- Needs and Challenges GM Crops Information Sharing- Needs and Challenges Dr. T. R. Sharma Genoinformatics Lab National Research Center on Plant Biotechnology IARI, New Delhi-110012 www.nrcpb.org Email: trsharma@nrcpb.org Need

More information

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts

More information

3) This diagram represents: (Indicate all correct answers)

3) This diagram represents: (Indicate all correct answers) Functional Genomics Midterm II (self-questions) 2/4/05 1) One of the obstacles in whole genome assembly is dealing with the repeated portions of DNA within the genome. How do repeats cause complications

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Chapter 14: Biotechnology and Genomics

Chapter 14: Biotechnology and Genomics Chapter 14: Biotechnology and Genomics AP Curriculum Alignment Biotechnology is extremely important to humans. Human desires for improvements in our food, environment and health have driven this field

More information

Dna Technology And Genomics Study Guide READ ONLINE

Dna Technology And Genomics Study Guide READ ONLINE Dna Technology And Genomics Study Guide READ ONLINE AP Biology - Chapter 20 ( DNA Technology and - Vocabulary words for AP Biology - Chapter 20 (DNA Technology and Genomics). The systematic study of the

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS

Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS Chapter 15 THE HUMAN GENOME PROJECT AND GENOMICS Chapter Summary Mapping of human genes means identifying the chromosome and the position on that chromosome where a particular gene is located. Initially

More information

The GMO Handbook. Genetically Modified Animals, Microbes, and Plants in Biotechnology. Edited by. Sarad R. Parekh, PhD

The GMO Handbook. Genetically Modified Animals, Microbes, and Plants in Biotechnology. Edited by. Sarad R. Parekh, PhD The GMO Handbook The GMO Handbook Genetically Modified Animals, Microbes, and Plants in Biotechnology Edited by Sarad R. Parekh, PhD Dow AgroSciences, Indianapolis, IN * Springer Science+Business Media,

More information

Science Academies Lecture Workshop From Knowing Biology to Solving Problems

Science Academies Lecture Workshop From Knowing Biology to Solving Problems Science Academies Lecture Workshop From Knowing Biology to Solving Problems held at PSG College of Technology, Coimbatore, 5 th & 6 th January, 2015 Conclusion Report The Science Academies Lecture Workshop

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Ch.15 Section 4 Regulation of Gene Expression pgs Complete the attached Active Reading Guides for the above sections.

Ch.15 Section 4 Regulation of Gene Expression pgs Complete the attached Active Reading Guides for the above sections. AP Biology 2018-2019 Summer Assignment Due Wednesday 9/5/2018 Text Book Reading Ch.13 The Molecular Basis of Life pgs. 245-267 Ch.15 Section 4 Regulation of Gene Expression pgs. 307-309 Active Reading

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Introduction to Molecular Biology

Introduction to Molecular Biology Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve

More information

T. A. Brown. Gene Cloning. & DNA Analysis. An Introduction. Seventh Edition

T. A. Brown. Gene Cloning. & DNA Analysis. An Introduction. Seventh Edition T. A. Brown Gene Cloning & DNA Analysis An Introduction Seventh Edition GENE CLONING AND DNA ANALYSIS GENE CLONING AND DNA ANALYSIS An Introduction T.A. BROWN University of Manchester Manchester Seventh

More information

Department of Biotechnology & Genetics

Department of Biotechnology & Genetics Department of Biotechnology & Genetics Year of establishment B. Sc Biotechnology 2000 B. Sc Genetics - 2000 Vision of the Department The department envisions to impart quality education, train the students

More information

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Biochemistry. Dr. Shariq Syed. Shariq AIKC/FinalYB/2014

Biochemistry. Dr. Shariq Syed. Shariq AIKC/FinalYB/2014 Biochemistry Dr. Shariq Syed Shariq AIKC/FinalYB/2014 What is DNA Sequence?? Our Genome is made up of DNA Biological instructions are written in our DNA in chemical form The order (sequence) in which nucleotides

More information

Gene Cloning and DNA Analysis: An introduction

Gene Cloning and DNA Analysis: An introduction Gene Cloning and DNA Analysis: An introduction T. A. Brown. 6th edition 2010 Published by Blackwell Science Ltd & 140.128.147.174/yclclass/ =>2011 Part I The Basic Principles of Gene Cloning and DNA Analysis

More information

BIO 202 Midterm Exam Winter 2007

BIO 202 Midterm Exam Winter 2007 BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive

More information

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Recombinant DNA Libraries and Forensics

Recombinant DNA Libraries and Forensics MIT Department of Biology 7.014 Introductory Biology, Spring 2005 A. Library construction Recombinant DNA Libraries and Forensics Recitation Section 18 Answer Key April 13-14, 2005 Recall that earlier

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

Extracting Database Properties for Sequence Alignment and Secondary Structure Prediction

Extracting Database Properties for Sequence Alignment and Secondary Structure Prediction Available online at www.ijpab.com ISSN: 2320 7051 Int. J. Pure App. Biosci. 2 (1): 35-39 (2014) International Journal of Pure & Applied Bioscience Research Article Extracting Database Properties for Sequence

More information

LIFE CYCLE RELIABILITY ENGINEERING

LIFE CYCLE RELIABILITY ENGINEERING LIFE CYCLE RELIABILITY ENGINEERING Life Cycle Reliability Engineering. Guangbin Yang Copyright 2007 John Wiley &Sons, Inc. ISBN: 978-0-471-71529-0 LIFE CYCLE RELIABILITY ENGINEERING Guangbin Yang Ford

More information

Workshop Dates: June 21-24, 2010

Workshop Dates: June 21-24, 2010 Workshop Dates: June 21-24, 2010 Biotechnology and Biomanufacturing with Middle Grades in Mind is a four day workshop designed for participants that teach middle grades Exploring Biotechnology or middle

More information

Analysis in Forensic Science

Analysis in Forensic Science Chapter 16 Gene Cloning & DNA Analysis in Forensic Science 1. DNA analysis in identification of crime suspects 2. Studying kinship by DNA profiling 3. Sex identification by DNA analysis Forensic science

More information

Course Competencies Template Form 112

Course Competencies Template Form 112 ` Course Competencies Template Form 112 GENERAL INFORMATION Course Prefix/Number: BSC-2426 Number of Credits: 3 Degree Type Course Title: Biotechnology Methods and Applications-I B.A. B.S. B.A.S A.A. A.S.

More information

Course Competencies Template Form 112

Course Competencies Template Form 112 ` Course Competencies Template Form 112 GENERAL INFORMATION Course Prefix/Number: BSC-2426 Number of Credits: 3 Degree Type Course Title: Biotechnology Methods and Applications-I B.A. B.S. B.A.S A.A. A.S.

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

Sequencing the Human Genome

Sequencing the Human Genome The Biotechnology 339 EDVO-Kit # Sequencing the Human Genome Experiment Objective: In this experiment, DNA sequences obtained from automated sequencers will be submitted to Data bank searches using the

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

A. McDermott R. H. Burdon A. E. Smith C. Jones P. Cohen R. Denton, C. I. Pogson D. M. Moore L. M. Cook H. H. Rees

A. McDermott R. H. Burdon A. E. Smith C. Jones P. Cohen R. Denton, C. I. Pogson D. M. Moore L. M. Cook H. H. Rees LIST OF TITLES Already published Cell Differentiation Functions of Biological Membranes Cellular Development Brain Biochemistry Immunochemistry The Selectivity of Drugs Biomechanics Molecular Virology

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

BIOTECHNOLOGY. Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS

BIOTECHNOLOGY. Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS BIOTECHNOLOGY Biotechnology is the process by which living organisms are used to create new products THE ORGANISMS Bacteria: are prokaryotic organisms that contain circular DNA and no organelles. They

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

MICROSATELLITE MARKER AND ITS UTILITY

MICROSATELLITE MARKER AND ITS UTILITY Your full article ( between 500 to 5000 words) - - Do check for grammatical errors or spelling mistakes MICROSATELLITE MARKER AND ITS UTILITY 1 Prasenjit, D., 2 Anirudha, S. K. and 3 Mallar, N.K. 1,2 M.Sc.(Agri.),

More information

Biosc10 schedule reminders

Biosc10 schedule reminders Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,

More information

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information