1000 Insect Transcriptomes Evolution - 1KITE

NGS the subterranean realm: from RNA-seq to bait design for a groundwater isopod Danielle Stringer

NGS the subterranean realm: from RNA-seq to bait design for a groundwater isopod Danielle Stringer Michelle Guzik, Karen Meusemann, Simon Tierney, Rachael King, Steve Cooper and Andy Austin Aridification

How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018

How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018 How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing

How much sequencing do I need? Emily Crisovan Genomics Core

How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?

Next-generation sequencing technologies

Next-generation sequencing technologies Illumina: Summary https://www.youtube.com/watch?v=fcd6b5hraz8 Illumina platforms: Benchtop sequencers https://www.illumina.com/systems/sequencing-platforms.html

This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part

This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government

Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline

Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017

Plant Breeding and Agri Genomics. Team Genotypic 24 November 2012

Plant Breeding and Agri Genomics Team Genotypic 24 November 2012 Genotypic Family: The Best Genomics Experts Under One Roof 10 PhDs and 78 MSc MTech BTech ABOUT US! Genotypic is a Genomics company, which

Next Generation Bioinformatics on the Cloud

Next Generation Bioinformatics on the Cloud http://www.easygenomics.com Sifei He Director of BGI Cloud hesifei@genomics.cn Xing Xu, Ph.D Senior Product Manager EasyGenomics BGI xuxing@genomics.cn Contact

DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN

DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility

2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,

G E N OM I C S S E RV I C ES

GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through

Computational Challenges of Medical Genomics

Talk at the VSC User Workshop Neusiedl am See, 27 February 2012 [cbock@cemm.oeaw.ac.at] http://medical-epigenomics.org (lab) http://www.cemm.oeaw.ac.at (institute) Introducing myself to Vienna s scientific

The i5k a pan-arthropoda Genome Database. Chris Childers and Monica Poelchau USDA-ARS, National Agricultural Library

The i5k Workspace@NAL: a pan-arthropoda Genome Database Chris Childers and Monica Poelchau USDA-ARS, National Agricultural Library Outline Background and overview Why join the i5k Workspace? What do we

Overcome limitations with RNA-Seq

Buyer s Guide Simple, customized RNA-Seq workflows Evaluating options for next-generation RNA sequencing Overcome limitations with RNA-Seq Next-generation sequencing (NGS) has revolutionized the study

Introduction into single-cell RNA-seq. Kersti Jääger 19/02/2014

Introduction into single-cell RNA-seq Kersti Jääger 19/02/2014 Cell is the smallest functional unit of life Nucleus.ATGC.UACG. A Cell KLTSH. The complexity of biology How many cell types? How many cells?

Matthew Tinning Australian Genome Research Facility. July 2012

Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909

De novo assembly in RNA-seq analysis.

De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct

Deep Sequencing technologies

Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University

Assessing De-Novo Transcriptome Assemblies

Assessing De-Novo Transcriptome Assemblies Shawn T. O Neil Center for Genome Research and Biocomputing Oregon State University Scott J. Emrich University of Notre Dame 100K Contigs, Perfect 1M Contigs,

NextSeq 500 System WGS Solution

NextSeq 500 System WGS Solution An accessible, high-quality whole-genome sequencing solution for any species. Highlights High-Quality, High-Coverage Genome Illumina chemistry offers highest read quality

Deakin Research Online

Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data

Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data Introduction The US Food and Drug Administration (FDA) has coordinated the Sequencing Quality Control project (SEQC/MAQC-III)

'Bioinformatics in academia as related to ehealth' - including the "Genomic Virtual Lab"

'Bioinformatics in academia as related to ehealth' - including the "Genomic Virtual Lab" Dr Gareth Price Head of Computational Biology Queensland Facility of Advanced Bioinformatics From Genomes to Systems

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

Introduc)on to Databases and Resources Biological Databases and Resources

Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs

DNBseq TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing

TM SERVICE OVERVIEW Plant and Animal Whole Genome Re-Sequencing Plant and animal whole genome re-sequencing (WGRS) involves sequencing the entire genome of a plant or animal and comparing the sequence

RNA-Seq data analysis course September 7-9, 2015

RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive

FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING. From wet lab to dry lab complete sample analysis

FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING From wet lab to dry lab complete sample analysis »Progress in science depends on new techniques, new discoveries

Next Generation Sequencing

Next Generation Sequencing Complete Report Catalogue # and Service: IR16001 rrna depletion (human, mouse, or rat) IR11081 Total RNA Sequencing (80 million reads, 2x75 bp PE) Xxxxxxx - xxxxxxxxxxxxxxxxxxxxxx

Introductory Next Gen Workshop

Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview

Using New ThiNGS on Small Things. Shane Byrne

Using New ThiNGS on Small Things Shane Byrne Next Generation Sequencing New Things Small Things NGS Next Generation Sequencing = 2 nd generation of sequencing 454 GS FLX, SOLiD, GAIIx, HiSeq, MiSeq, Ion

Two Mark question and Answers

1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data

Title: High-quality genome assembly of channel catfish, Ictalurus punctatus

Author s response to reviews Title: High-quality genome assembly of channel catfish, Ictalurus punctatus Authors: Qiong Shi (shiqiong@genomics.cn) Xiaohui Chen (xhchenffri@hotmail.com) Liqiang Zhong (lqzhongffri@hotmail.com)

solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome

solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome See the Difference With a commitment to your peace of mind, Life Technologies provides a portfolio of robust and scalable

NGS developments in tomato genome sequencing

NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC

Global Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource

Global Biomolecular Information Infrastructure and Australia Graham Cameron Director The EMBL Australia Bioinformatics Resource What is bioinformatics? Methods, data, IT to exploit biomolecular information

Gene-centered resources at NCBI

COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

Applications of Next Generation Sequencing in Metagenomics Studies

Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno

Download the Lectin sequence output from

Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).

Introduction to Bioinformatics

Introduction to Bioinformatics IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Joyce Nzioki Plan for the Week Introduction to Bioinformatics Raw sanger sequence data Introduction to CLC Bio Quality Control

Surely Better Target Enrichment from Sample to Sequencer and Analysis

sureselect TARGET ENRIChment solutions Surely Better Target Enrichment from Sample to Sequencer and Analysis Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom

The Iso-Seq Method: Transcriptome Sequencing Using Long Reads

The Iso-Seq Method: Transcriptome Sequencing Using Long Reads Elizabeth Tseng, Ph.D. Senior Staff Scientist FIND MEANING IN COMPLEXITY For Research Use Only. Not for use in diagnostic procedures. Copyright

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

High quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple

High quality reference genome of the domestic sheep (Ovis aries) Yu Jiang and Brian P. Dalrymple CSIRO Livestock Industries on behalf of the International Sheep Genomics Consortium Outline of presentation

RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)

RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their

NextGen Sequencing and Target Enrichment

NextGen Sequencing and Target Enrichment Laurent FARINELLI 7 September 2010 Agilent 3rd Analytic Forum Basel, Switzerland Outline The illumina HiSEQ 2000 system Applications Target enrichment Outlook 7

De Novo Transcript Discovery using Long and Short Reads

De Novo Transcript Discovery using Long and Short Reads December 4, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com

AP BIOLOGY. Investigation #3 Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST. Slide 1 / 32. Slide 2 / 32.

New Jersey Center for Teaching and Learning Slide 1 / 32 Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris

Ensembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets

Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger

The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing

The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency

Introduction to Bioinformatics

Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

BSC 4445C Genomics Lab: Methods in Data Collection and Analysis

1 BSC 4445C: Special Topics Genomics Lab: Fall 2017 (Forsman) 4 credits Course Description The field of genomics focuses on understanding the collective function of all components encoded in an organism

RNA Sequencing. Next gen insight into transcriptomes , Elio Schijlen

RNA Sequencing Next gen insight into transcriptomes 05-06-2013, Elio Schijlen Transcriptome complete set of transcripts in a cell, and their quantity, for a specific developmental stage or physiological

User Requirement Specifications

User Requirement Specifications for the tender (AZ-2017-0155) Implementation of a LIMS system and 3 years license at subsequently mentioned as purchaser Tenderer = Contractor (AN) Page 1 of 10 Inhalt 1

Introduction to Bioinformatics

Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of

Chapter 2: Access to Information

Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

Analysis of NGS data. resources. Grid computing workshop 2015 Jan Oppelt, NCBR & CEITEC MU 1 st December, 2015

Analysis of NGS data using MetaCentrum VO resources Grid computing workshop 2015 Jan Oppelt, NCBR & CEITEC MU 1 st December, 2015 Basic introduction 12/1/2015 Jan Oppelt, NCBR & CEITEC MU 2 Introduction

Genomics. Data Analysis & Visualization. Camilo Valdes

Genomics Data Analysis & Visualization Camilo Valdes cvaldes3@miami.edu https://github.com/camilo-v Center for Computational Science, University of Miami ccs.miami.edu Today Sequencing Technologies Background

CBC Data Therapy. Metatranscriptomics Discussion

CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu

Nanopore sequencing How it works

1 Nanopore sequencing How it works Nanopore Reader DNA or RNA passes through a nano-scale hole. The fluctuations in current as it passes through are used to understand the DNA or RNA sequence. An electrically

Surely Better Target Enrichment from Sample to Sequencer

sureselect TARGET ENRICHMENT solutions Surely Better Target Enrichment from Sample to Sequencer Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom products,

The Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience

Building Excellence in Genomics and Computa5onal Bioscience Resequencing approaches Sarah Ayling Crop Genomics and Diversity sarah.ayling@tgac.ac.uk Why re- sequence plants? To iden

DNA Banking for the 21 st Century

DNA Banking for the 21 st Century A White Paper of Recommendations from the U.S. Workshop on DNA Banking The importance of DNA data to modern studies of systematics and evolution cannot be overstated.

Random matrix analysis for gene co-expression experiments in cancer cells

Random matrix analysis for gene co-expression experiments in cancer cells OIST-iTHES-CTSR 2016 July 9 th, 2016 Ayumi KIKKAWA (MTPU, OIST) Introduction : What is co-expression of genes? There are 20~30k

LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES

1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,

De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight

De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight 1 Workflow Import NGS raw data QC on reads De novo assembly Trim reads Finding Genes BLAST Sample to Insight Case Study Pseudomonas aeruginosa

User Guide: Illumina sequencing technologies RNA-Seq MASSIVELY PARALLEL SEQUENCING SERVICES. McGill University and Génome Québec Innovation Centre

DECEMBER 17, 2018 MASSIVELY PARALLEL SEQUENCING SERVICES McGill University and Génome Québec Innovation Centre User Guide: Illumina sequencing technologies RNA-Seq Version 6.1 Copyright 2018 McGill University

Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing

Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing "#$%&'()*+,"(-*."#$%&/.,"*01*0.,(%-*.&0("2*01*3,$,45,"-*4#66&*71** 3"#)(82,"-*2&9:)($*)1*"(03&"2-*#)66(*.(8$6#*;

Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013

Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification

an innovation in high throughput single cell profiling

an innovation in high throughput single cell profiling www.dolomite-bio.com Why use high throughput single cell profiling? Techniques such as high throughput scrna-seq (single cell RNA sequencing) offer

China National Grid --- BioNode. Jun Wang Beijing Genomics Institute

China National Grid --- BioNode Jun Wang Beijing Genomics Institute Core of life science and bio-tech: Getting, Mining, Applying the basic life information Old China meets New China? Sequencing, sequencing,

Session 8. Differential gene expression analysis using RNAseq data

Functional and Comparative Genomics 2018 Session 8. Differential gene expression analysis using RNAseq data Tutors: Hrant Hovhannisyan, PhD student, email: grant.hovhannisyan@gmail.com Uciel Chorostecki,

MAKER: An easy to use genome annotation pipeline. Carson Holt Yandell Lab Department of Human Genetics University of Utah

MAKER: An easy to use genome annotation pipeline Carson Holt Yandell Lab Department of Human Genetics University of Utah Introduction to Genome Annotation What annotations are Importance of genome annotations

working with scientists to advance single cell research

working with scientists to advance single cell research 4 introduction Why choose Nadia? 6 nadia instrument Nadia Instrument features Why use high throughput single cell profiling? Working with scrna-seq

Advanced RNA-Seq course. Introduction. Peter-Bram t Hoen

Advanced RNA-Seq course Introduction Peter-Bram t Hoen Expression profiling DNA mrna protein Comprehensive RNA profiling possible: determine the abundance of all mrna molecules in a cell / tissue Expression

Functional genomics to improve wheat disease resistance. Dina Raats Postdoctoral Scientist, Krasileva Group

Functional genomics to improve wheat disease resistance Dina Raats Postdoctoral Scientist, Krasileva Group Talk plan Goal: to contribute to the crop improvement by isolating YR resistance genes from cultivated

Low input RNA-seq library preparation provides higher small non-coding RNA diversity and greatly reduced hands-on time

TECHNICAL NOTE Low input RNA-seq library preparation provides higher small non-coding RNA diversity and greatly reduced hands-on time INTRODUCTION RNA-seq is a next-generation sequencing technique that

Genomes: What we know and what we don t know

Genomes: What we know and what we don t know Complete draft sequence 2001 October 15, 2007 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms!

Genomics AGRY Michael Gribskov Hock 331

Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will

ngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian

Metagenomics T TM storage genetics assembly ncrna custom genotyping RNA-seq de novo mendelian ChIP-seq exome genomics indel ngs trio prediction metagenomics SNP resequencing bioinformatics diagnostics

NGS-based innovations within the Leiden Network

NGS-based innovations within the Leiden Network A strong bridge between two partners Dr. Mark de Jong 2017-09-29 Design accurate and robust NGS tests and generate data sets essential for Diagnostics &

BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP

Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in

Using 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung

Using 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung Using 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung General microarry data analysis

Single Cell Transcriptomics scrnaseq

Single Cell Transcriptomics scrnaseq Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Purpose The sequencing of

Sequencing and assembly of the sheep genome reference sequence

Sequencing and assembly of the sheep genome reference sequence Yu Jiang Kunming Institute of Zoology, CAS, China the International Sheep Genomics Consortium (ISGC) ISGC Presentations Yu Jiang, Kunming

What is GGBN? Titelmasterformat durch Klicken bearbeiten. Textmasterformat bearbeiten. Zweite Ebene

Titelmasterformat durch Klicken bearbeiten Dritte Ebene What is GGBN? (Global» Fünfte Genome Ebene Biodiversity Network) Jonathan Coddington GGBN Executive Committee Smithsonian Institution FAPESP August

NEXT GENERATION SEQUENCING. Farhat Habib

NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp

Bioinformatics Monthly Workshop Series. Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory

Bioinformatics Monthly Workshop Series Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory Schedule for Fall, 2015 PILM Bioinformatics Web Server (09/21/2015)

www.illumina.com/hiseq www.illumina.com FOR RESEARCH USE ONLY 2012 2014 Illumina, Inc. All rights reserved. Illumina, BaseSpace, cbot, CSPro, Genetic Energy, HiSeq, Nextera, TruSeq, the pumpkin orange

MASSIVELY PARALLEL SEQUENCING SERVICES

OCTOBER 18, 2017 MASSIVELY PARALLEL SEQUENCING SERVICES McGill University and Génome Québec Innovation Centre User Guide: Illumina sequencing technologies Version 5.9 Copyright 2015 McGill University and

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

High throughput analysis of single cell transcriptomes with Dolomite Bio s Nadia Instrument

High throughput analysis of single cell transcriptomes with Dolomite Bio s Nadia Instrument Encapsulating single cells with barcoded mrna capture beads on the Nadia Instrument Version: 3.0 Issue Date:

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11

Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the

The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow

The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow Marcus Hausch, Ph.D. 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator,

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Introducing the Ion S5 and Ion S5 XL systems Now, adopting next-generation sequencing in your lab is simpler than ever. The Ion S5

Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly

Analysis Report Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly 1 Table of Contents 1. Result of Whole Genome Assembly