Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous

Size: px
Start display at page:

Download "Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous"

Transcription

1 Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-( ) (GST-coiled coil) fusion protein. For affinity purification GST and GST-coiled coil protein were prepared from bacteria and bound to glutathione-agarose beads (Sigma). (Bead preparation: suspend beads in 50 volumes of NETN (0.5% NP-40, 20 mm Tris, ph 8.0, 100 mm NaCl, 1 mm EDTA), spin down beads (1 min at 2000 rpm), add 10 volumes of NETN, incubate overnight at 4 C on rocker, spin down beads, take off supernatant and add 1 bead volume of NETN). GST-beads and GST-coiled coil beads were washed three times with 10 ml NETN buffer. Then beads were washed twice with 0.1 M borate buffer ph 8.0, once with 0.1 M borate buffer ph 9.0 and then once with 0.2 M borate buffer ph 9.0. After washing, beads were incubated in 40 mm dimethypimelinidate (dissolved in 0.2 M borate buffer ph 9.0) in a rotary shaker for 1 hour at 4 C. Beads were washed twice with 0.1 M borate buffer ph 8.0, and then incubated with 40 mm ethanolamine (in 0.1 M borate buffer ph 8.0) in a rotary shaker for 45 min at 4 C. Then beads were washed three times with cold PBS, once with 0.2 M glycine-hcl, ph 2.5, once with 1 M K 2 HPO 4, then twice with PBS. After washing, GST-beads were incubated with 4 ml of serum diluted with 4 ml of PBS containing 0.2% (w/v) Tween20 in a rotary shaker overnight at 4 C. Beads were washed three times with PBS containing 0.2% (w/v) Tween20. Thereafter, supernatant was added to GST-coiled coil coated beads and after rotation for 2 hours, were loaded onto a column and washed three times with 10 ml of PBS containing 0.2% (w/v) Tween20, then washed twice with 10 ml of PBS. Antibody was eluted with 0.2 M glycine-hcl, ph 2.5 into a microcentrifuge tube containing 1 M K 2 HPO total fractions were collected. Protein concentration was determined as described by Bradford 1 and

2 peak fractions were pooled. Antibody was dialyzed overnight against 1000 ml of PBS/glycerol (PBS:glycerol is 1:1) at 4 C. The specificity of anti-arhgap25 antibody was validated with western blot analysis of recombinant, GST-fusion fragments of ARHGAP25 (Figure S1), the overexpression of ARHGAP25R192A and ARHGAP25 in COSphoxFcγR cells (Figure 3A) and PLB-985 cells treated with ARHGAP25-specific shrna (Figure 4B). Anti-p50RhoGAP polyclonal antibody was prepared as described. 2 REFERENCES 1. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72: Sirokmany G, Szidonya L, Kaldi K, Gaborik Z, Ligeti E, Geiszt M. Sec14 homology domain targets p50rhogap to endosomes and provides a link between Rab and Rho GTPases. J Biol Chem. 2006;281(9): Figure S1. Testing of polyclonal anti-arhgap25 antibody (A) GST-fusion full-length ARHGAP25 or its indicated fragments were separated with SDS/PAGE and immunoblotted with ARHGAP25-specific anti-coiled coil antibody. In the first lane we found a strong signal at 83 kda, which is the GST-tagged full-length ARHGAP25, and some other, weaker signals at lower molecular weight, which are the proteolytic fragments of the full-length protein. The antibody also recognised specifically the GST-coiled coil domain. The PH domain and the GST protein also reacted weakly with the

3 antibody, which is caused by the presence of polyclonal anti-gst antibody contamination. (B) Specific anti-gst antibody was used as a control that recognised all samples. Figure S2. Verification of the critical arginine in ARHGAP25 Effect of full-length wild-type or mutated ARHGAP25 on in vitro [γ- 32 P]GTP-hydrolysis of Rac. Mean ± S.E.M. of three separate experiments is shown. *, p<0.05 vs. control. Figure S3. ARHGAP25 colocalizes with endogenous Rac in COS7 cells Cyan fluorescent protein-coding control vector (A-C), CFP-tagged ARHGAP25 (D-F) or CFP-ARHGAP25R192A (G-I) overexpressed by COS7 cells are shown in blue. Endogenous Rac was labelled with monoclonal anti-rac1 antibody (BD Biosciences) and detected with Alexa-488 conjugated anti-mouse-ig secondary antibody (green). C,F,I, merge. Figure S4. Enrichment of wild-type and GAP-deficient ARHGAP25 around the phagocytosed yeast particles. CFP-ARHGAP25R192A (B,E) and CFP-ARHGAP25 (C,F) shows enrichment around the phagosomes of COSphoxFcγR cells, whereas the cyan fluorescent protein localizes in the cytosol and mainly in the nucleus (A,D). The same cells are shown both in colour (A-C) and in black-and-white (D-F). In A-C p40 Phox is shown in green, wild-type or mutant CFP- ARHGAP25 (or only CFP) in blue and yeast particles in red. Enrichment of ARHGAP25 around the phagosomes is indicated by arrows. Figure S5. Neutrophilic differentiation of PLB-985 cells causes significant increase in CD11b expression

4 Non-treated (A), control shrna-treated (B) and ARHGAP25-silenced (C) PLB cells were stained with R-phycoerythrin-labelled monoclonal anti-cd11b antibody (Dako), and CD11b expression was measured by flow cytometry. Black line, non-labelled cells; blue line, nondifferentiated PLB cells labelled with anti-cd11b; red line, differentiated PLB cells labelled with anti-cd11b. Representative experiments are shown.

5 construct GST-ARHGAP25 full length GST-PH domain GST-GAP domain GST-PH+GAP domain GST-Coiled coil domain ARHGAP25R192A CFP-ARHGAP25 primer pairs CGGGATCCGTGATGACTGGCGAGCAGATGGCTG CCGCTCGAGCGAGCCTCGGTCTTGGGTCC CGGGATCCCCCATGTCCCTCGGTCAGTCGGCC GGAATTCGCCAAACAC TCCACAGGGTGTGC CGCGGATCCGCTGGCACACCCTGTGGAGTG GGAATTCTGACAGGGGTATATCCTTGGAC CGGGATCCGTGATGACTGGCGAGCAGATGGCTG GGAATTCTGACAGGGGTATATCCTTGGAC CGGGATCCAACTCTGAAACTGGGCCTGG CCGCTCGAGCCTTAAGCCTCGGTCTTGGGTTC GAAGAGGGCATCTTCGCTCTTCCTGGGCAGGAC GTCCTGCCCAGGAAGAGCGAAGATGCCCTCTTC AACTCGAGACATGTCCCTCGGTCAGTC TTGGATCCTAAGCCTCGGTCTTGGGTTC ARHGAP25 shrna/sirna 5'-3' ACCGGGAAGTTTGTCTTTGAAATTCAAGAGATTTCAAAGACAAACTTCCCTTTTTC control shrna/sirna 5'-3' ACCGGGAAGTTTGTCTTGTAAATTCAAGAGATTTACAAGACAAACTTCCCTTTTTC p50rhogap-cfp CCGCTCGAGGCCATGGATCCGCTCTCAGAGCTGCAGG GGAATTCGGAGCCCGCTGGGGTCCGGGCTTG

6 Figure S1 A B M (kda) M (kda) anti-coiled coil anti-gst

7 Figure S2 GST-Rac ]GTP (%) Protein bo ound [ 32 P 120 n = 3 GST-Rac ±S.E.M. + f.l. ARHGAP ARHGAP25R192A Time (min)

8 CFP Rac merge FigureS3 A B C D E F G H I ARHGAP25R192A ARHGAP25 control vector

9 Figure S4 control vector ARHGAP25R192A ARHGAP25 merged A B C CFP (m monochro ome) D E F

10 A non-treated PLB-985 Figure S5 non-labelled PLB non-diff. PLB+αCD11b diff. PLB+ α CD11b CD11b B control shrna treated PLB-985 non-labelled PLB non-diff. PLB+αCD11b diff. PLB+ α CD11b CD11b C ARHGAP25 shrna treated PLB-985 non-labelled PLB non-diff. PLB+αCD11b diff. PLB+ α CD11b CD11b

Cdc42 Activation Assay Kit

Cdc42 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay

More information

Glutathione Resin. (Cat. # , , , ) think proteins! think G-Biosciences

Glutathione Resin. (Cat. # , , , ) think proteins! think G-Biosciences 191PR-05 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Glutathione Resin (Cat. # 786-280, 786-310, 786-311, 786-312) think proteins! think

More information

Glutathione Resin. (Cat. # , , , ) think proteins! think G-Biosciences

Glutathione Resin. (Cat. # , , , ) think proteins! think G-Biosciences 191PR 05 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Glutathione Resin (Cat. # 786 280, 786 310, 786 311, 786 312) think proteins! think

More information

GST Elution Buffer. (Cat. # ) think proteins! think G-Biosciences

GST Elution Buffer. (Cat. # ) think proteins! think G-Biosciences 191PR-05 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name GST Elution Buffer (Cat. #786-541) think proteins! think G-Biosciences www.gbiosciences.com

More information

Rab5 Activation Assay Kit

Rab5 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product

More information

RheB Activation Assay Kit

RheB Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table

More information

Arf6 Activation Assay Kit

Arf6 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

ONE-HOUR Western TM Multiplex Kit II

ONE-HOUR Western TM Multiplex Kit II ONE-HOUR Western TM Multiplex Kit II Technical Manual No. 0256 Version 06192009 I Description... 1 II Kit Contents.. 2 III Related Products 2 IV Key Features. 2 V Storage... 2 VI ONE-HOUR Multiplex Western

More information

GST Fusion Protein Purification Kit

GST Fusion Protein Purification Kit Glutathione Resin GST Fusion Protein Purification Kit Cat. No. L00206 Cat. No. L00207 Technical Manual No. TM0185 Version 01042012 Index 1. Product Description 2. Related Products 3. Purification Procedure

More information

Immunoprecipitation (IP)

Immunoprecipitation (IP) BlueGene Biotech Co.,Ltd. Tel: 0086-21-61471242 Fax: 0086-21-61471242 ext 806 E-mail: sales@bluegene.cc tech@bluegene.cc www.elisakit.cc www.bluegene.cc Immunoprecipitation (IP) Immunoprecipitation is

More information

Gα 13 Activation Assay Kit

Gα 13 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product

More information

Gα i Activation Assay Kit

Gα i Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods Co-immunoprecipitation (Co-IP) assay Cells were lysed with NETN buffer (20 mm Tris-HCl, ph 8.0, 0 mm NaCl, 1 mm EDT, 0.5% Nonidet P-40) containing 50 mm β-glycerophosphate,

More information

RhoC Activation Assay Kit

RhoC Activation Assay Kit Product Manual RhoC Activation Assay Kit Catalog Number STA-403-C 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

Product Datasheet. Histone H4 [Dimethyl Lys20] Antibody NB SS. Unit Size: mg

Product Datasheet. Histone H4 [Dimethyl Lys20] Antibody NB SS. Unit Size: mg Product Datasheet Histone H4 [Dimethyl Lys20] Antibody NB21-2089SS Unit Size: 0.025 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Protocols, Publications, Related

More information

Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng

Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng Department of Molecular Genetics, Biochemistry and Microbiology,

More information

NHS-Activated Agarose (Dry Form)

NHS-Activated Agarose (Dry Form) 560PR-01R G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name NHS-Activated Agarose (Dry Form) For covalent binding of primary amine containing

More information

ab Ran Activation Assay Kit

ab Ran Activation Assay Kit ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last

More information

SUPPLEMENTAL DATA. Supplementary Methods

SUPPLEMENTAL DATA. Supplementary Methods SUPPLEMENTL DT Supplementary Methods TP agarose affinity chromatography Peroxisomes extracted from yeast transformed with CTS/pRS416-GPD were resuspended in solubilisation buffer [5 mm Tris-HCl ph 7.,

More information

VERIFY Tagged Antigen. Validation Data

VERIFY Tagged Antigen. Validation Data VERIFY Tagged Antigen Validation Data Antibody Validation Figure 1. Over-expression cell lysate for human STAT3 (NM_139276) was used to test 3 commercial antibodies. Antibody A shows strong antigen binding.

More information

Nascent Chromatin Capture. The NCC protocol is designed for SILAC-based massspectrometry

Nascent Chromatin Capture. The NCC protocol is designed for SILAC-based massspectrometry Extended experimental procedure Nascent Chromatin Capture. The NCC protocol is designed for SILAC-based massspectrometry analysis of nascent versus mature chromatin composition (1). It requires a large

More information

Innovation Moléculaire et Thérapeutique, Université François Rabelais, Tours, France *For correspondence:

Innovation Moléculaire et Thérapeutique, Université François Rabelais, Tours, France *For correspondence: Expression and Purification of the Eukaryotic MBP-MOS1 Transposase from sf21 Insect Cells Jérôme Jaillet, Audrey Dussaussois-Montagne, Sylvaine Renault and Corinne Augé-Gouillou * Innovation Moléculaire

More information

Kinase Reaction and Alkylation Protocol

Kinase Reaction and Alkylation Protocol Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic

More information

MagExtactor -His-tag-

MagExtactor -His-tag- Instruction manual MagExtractor-His-tag-0905 F0987K MagExtactor -His-tag- Contents NPK-701 100 preparations Store at Store at 4 C [1] Introduction [2] Components [3] Materials required [4] Protocol3 1.

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression

To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression Supplemental figures Supplemental Figure. 1. Silencing expression of Celsr3 by shrna. To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression plasmids for the shrna

More information

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 100 L,

More information

Anti-HB-EGF (Human) mab

Anti-HB-EGF (Human) mab Page 1 For Research Use Only. Not for use in diagnostic procedures. CODE No. D308-3 Anti-HB-EGF (Human) mab CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 3H4 Mouse IgG1

More information

The preparation of native chromatin from cultured human cells.

The preparation of native chromatin from cultured human cells. Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods:

SUPPLEMENTAL MATERIAL. Supplemental Methods: SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells

More information

Immunoaffinity Chromatography

Immunoaffinity Chromatography PR120 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Immunoaffinity Chromatography Teacher s Guidebook (Cat. # BE 507) think proteins! think

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were

More information

Cat. No. MG17PG-1ml XPRESSAFFINITY PROTEIN G- MAGNETIC NANOPARTICLES (MNP) FOR RESEARCH APPLICATIONS

Cat. No. MG17PG-1ml XPRESSAFFINITY PROTEIN G- MAGNETIC NANOPARTICLES (MNP) FOR RESEARCH APPLICATIONS Cat. No. MG17PG-1ml XPRESSAFFINITY PROTEIN G- MAGNETIC NANOPARTICLES (MNP) FOR RESEARCH APPLICATIONS Product Description: MagGenome s Protein G-MNP provides a fast and convenient method for affinity based

More information

Vivapure Anti-HSA/IgG Kits for Human Albumin and Human Albumin/IgG Depletion

Vivapure Anti-HSA/IgG Kits for Human Albumin and Human Albumin/IgG Depletion Vivapure Anti-HSA/IgG Kits for Human and Human /IgG Depletion Fisher Scientific Vivapure Anti-HSA/IgG Kits for Human and Human /IgG Depletion Introduction The Vivapure Anti-HSA and Anti-HSA/IgG kits are

More information

ReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit

ReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit ReliaBLOT TM Introduction: IP/Western Blot Reagents Cat. No. WB120, rabbit ReliaBLOT TM IP/Western Blot Reagents and Procedures (patent pending) provide an improved method for the detection of immunoprecipitated

More information

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17 Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,

More information

GFP as affinity tag for immunoprecipitation

GFP as affinity tag for immunoprecipitation 1/5 Preamble This document compares existing conventional antibodies against GFP in biochemical studies with the GFPTrap, a readytouse pulldown reagent derived from alpaca. What are the differences between

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Methods Protein expression and in vitro binding studies. Recombinant baculovirus carrying GST, GST-mCC, GST-mSec, GST-mSecA and GST-mSecD were generated according to the manufacturer s instructions

More information

Pierce Glutathione Magnetic Beads

Pierce Glutathione Magnetic Beads INSTRUCTIONS Pierce Glutathione Magnetic Beads 88821 88822 Number Description 88821 Pierce Glutathione Magnetic Beads, 4mL, supplied as a 25% slurry in 20% ethanol 88822 Pierce Glutathione Magnetic Beads,

More information

A sensitive direct human telomerase activity assay Scott B Cohen & Roger R Reddel

A sensitive direct human telomerase activity assay Scott B Cohen & Roger R Reddel A sensitive direct human telomerase activity assay Scott B Cohen & Roger R Reddel Supplementary figure and text: Supplementary Figure 1 Titration of the sheep polyclonal htert antibody. Supplementary Methods

More information

His-Spin Protein Miniprep

His-Spin Protein Miniprep INSTRUCTIONS His-Spin Protein Miniprep Catalog No. P2001 (10 purifications) and P2002 (50 purifications). Highlights Fast 5 minute protocol to purify His-tagged proteins from cell-free extracts Screen

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

Sarker et al. Supplementary Material. Subcellular Fractionation

Sarker et al. Supplementary Material. Subcellular Fractionation Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged

More information

5.2 Protein purification

5.2 Protein purification Purification of a His 6 -tagged Green Fluorescent Protein (GFP). Protein purification.. Purification of a His 6 -tagged Green Fluorescent Protein (GFP) Principle You can add either a N- or C-terminal His

More information

HOOK Activated Agarose (Amine Reactive)

HOOK Activated Agarose (Amine Reactive) 197PR G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name HOOK Activated Agarose (Amine Reactive) (Cat. # 786 066) think proteins! think G-Biosciences

More information

ab G alpha i Activation Assay Kit

ab G alpha i Activation Assay Kit ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version

More information

Supplementary methods

Supplementary methods Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into

More information

Ral Activation Assay Kit

Ral Activation Assay Kit Product Manual Ral Activation Assay Kit Catalog Number STA-408 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family of

More information

Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of

Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of Supplementary data Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of cell free protein lysates from WT M. tuberculosis (Rv) together with various known concentrations

More information

A General Protocol for GST Pull-down Lili Jing *

A General Protocol for GST Pull-down Lili Jing * A General Protocol for GST Pull-down Lili Jing * Department of Cell and Molecular Biology, University of Pennsylvania, Philadelphia, USA *For correspondence: lilijingcn@gmail.com [Abstract] GST pull-down

More information

Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.

Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2. Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected

More information

Fab-Streptamer Microbeads Manual

Fab-Streptamer Microbeads Manual Fab-Streptamer Microbeads Manual reversible and functional isolation of target cells using Strep-Tactin Magnetic Microbeads Last date of revision November 2010 Version PR32-0003 IBA Headquarters IBA GmbH

More information

LOABeads PrtA Magnetic bead purification of antibodies Capacity 45 mg IgG/ml

LOABeads PrtA Magnetic bead purification of antibodies Capacity 45 mg IgG/ml LOABeads PrtA Magnetic bead purification of antibodies Capacity 45 mg IgG/ml Product Manual Lab on a Bead AB Revision date 2018-05-23 Copyright 2015-2018 Lab on a Bead AB All rights reserved Table of Contents

More information

Supplementary information

Supplementary information Supplementary information The E3 ligase RNF8 regulates KU80 removal and NHEJ repair Lin Feng 1, Junjie Chen 1 1 Department of Experimental Radiation Oncology, The University of Texas M. D. Anderson Cancer

More information

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding

More information

Perform reproducible immunoprecipitation in less than 40 minutes

Perform reproducible immunoprecipitation in less than 40 minutes Perform reproducible immunoprecipitation in less than 40 minutes Dynabeads products Immunoprecipitation made easy with low nonspecific binding, high yield, and reproducibility Magnetic beads have become

More information

Attenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by

Attenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by Supplementary Methods and Figures Attenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by methylene blue for Alzheimer s disease treatment Wenchao Sun 1, Seongsoo Lee 1,2, Xiaoran

More information

Immunoprecipitation Protocol

Immunoprecipitation Protocol Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify

More information

Immobilized Streptavidin Resin

Immobilized Streptavidin Resin 438PR-01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Immobilized Streptavidin Resin (Cat. # 786-390, 786-590, 786-591, 786-592) think

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds

More information

Glutathione Agarose Resin User s Guide

Glutathione Agarose Resin User s Guide Glutathione Agarose Resin User s Guide DESCRIPTION Glutathione Agarose Resin is used to purify recombinant derivatives of glutathione S-transferases or glutathione binding proteins. Resins are products

More information

AnaTag HiLyte Fluor 488 Microscale Protein Labeling Kit

AnaTag HiLyte Fluor 488 Microscale Protein Labeling Kit AnaTag HiLyte Fluor 488 Microscale Protein Labeling Kit Revision number: 1.3 Last updated: April 2018 Catalog # AS-72048 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor

More information

ONE-HOUR Complete IP-Western Kit

ONE-HOUR Complete IP-Western Kit ONE-HOUR Complete IP-Western Kit Technical Manual No. 0218 Version 06192009 I Description.. 1 II Kit Contents.. 2 III Related Products 2 IV Key Features.. 2 V Storage.. 2 VI ONE-HOUR Western Protocol 3

More information

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression

ab GST 6XHis-tag ELISA Kit For the quantitative measurement of 6XHis-tag protein expression ab128573 GST 6XHis-tag ELISA Kit Instructions for Use For the quantitative measurement of 6XHis-tag protein expression This product is for research use only and is not intended for diagnostic use. 1 Table

More information

Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg

Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg Supplementary information Supplementary methods PCNA antibody and immunodepletion Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg extracts, one volume of protein

More information

Immobilized Protein G

Immobilized Protein G 235PR G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Immobilized Protein G (Cat. # 786 829 to 786 832, 786 834, 786 284) think proteins!

More information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration /, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing

More information

Rho activation kit. Catalog Number: ADI-EKS-465. Table of Contents

Rho activation kit. Catalog Number: ADI-EKS-465. Table of Contents Rho activation kit Catalog Number: ADI-EKS-465 Table of Contents Assay Design Page 1 Scientific Overview 2 Precautions 2 Materials Provided 3 Storage of Materials 3 Materials Required but Not Provided

More information

Ren Lab ENCODE in situ HiC Protocol for Tissue

Ren Lab ENCODE in situ HiC Protocol for Tissue Ren Lab ENCODE in situ HiC Protocol for Tissue Pulverization, Crosslinking of Tissue Note: Ensure the samples are kept frozen on dry ice throughout pulverization. 1. Pour liquid nitrogen into a mortar

More information

IMMUNOPRECIPITATION (IP)

IMMUNOPRECIPITATION (IP) 1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us

More information

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb. Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.

Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line

More information

MATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (mini-gel format). Reagents Provided in Kit

MATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (mini-gel format). Reagents Provided in Kit Lot # XXXXX MuRF1/S5a Ubiquitination Kit Cat. # K-102 MATERIAL DATA SHEET MuRF1 (Muscle-specific RING-finger protein 1) is a RING-finger E3 ligase found in striated muscle (heart and skeletal) and iris

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

OPPF-UK Standard Protocols: Insect Cell Purification

OPPF-UK Standard Protocols: Insect Cell Purification OPPF-UK Standard Protocols: Insect Cell Purification Last Updated 6 th October 2016 Joanne Nettleship joanne@strubi.ox.ac.uk OPPF-UK SOP: Insect Cell Purification Table of Contents Suggested Schedule...

More information

Human IL10RB ELISA Pair Set ( CRFB4 )

Human IL10RB ELISA Pair Set ( CRFB4 ) Human IL10RB ELISA Pair Set ( CRFB4 ) Catalog Number : SEK10945 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the

More information

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 κ 100 µl,

More information

Rap1 Activation Assay Kit

Rap1 Activation Assay Kit Product Manual Rap1 Activation Assay Kit Catalog Number STA- 406-1 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family

More information

PACKAGE INSERT Applied BioCode, Inc. - Beads. CARBOXYL BARCODED MAGNETIC BEADS (BMBs) 128-Plex - Part Number 44-B Plex - Part Number 44-B0302

PACKAGE INSERT Applied BioCode, Inc. - Beads. CARBOXYL BARCODED MAGNETIC BEADS (BMBs) 128-Plex - Part Number 44-B Plex - Part Number 44-B0302 For Coupling Nucleic Acids: PACKAGE INSERT Applied BioCode, Inc. - Beads CARBOXYL BARCODED MAGNETIC BEADS (BMBs) 128-Plex - Part Number 44-B0102 4096-Plex - Part Number 44-B0302 For Coupling Proteins:

More information

Figure S1. USP-46 is expressed in several tissues including the nervous system

Figure S1. USP-46 is expressed in several tissues including the nervous system Supplemental Figure legends Figure S1. USP-46 is expressed in several tissues including the nervous system Transgenic animals expressing a transcriptional reporter (P::GFP) were imaged using epifluorescence

More information

Protein A Agarose Immunoprecipitation Kit

Protein A Agarose Immunoprecipitation Kit Protein A Agarose Immunoprecipitation Kit Catalog Number KA0568 20 Reactions Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...

More information

Introduction to Affinity Chromatography (AC) By: Sunsanee Yoojun Bang Trading 1992 Co., Ltd.

Introduction to Affinity Chromatography (AC) By: Sunsanee Yoojun Bang Trading 1992 Co., Ltd. Introduction to Affinity Chromatography (AC) By: Sunsanee Yoojun Bang Trading 1992 Co., Ltd. Content What is affinity chromatography (AC)? What is AC used for? Principles Experimental set up Summary What

More information

Supplementary Material - Methods

Supplementary Material - Methods Novel Protein-Protein Interactions in the Schizophrenia interactome Supplementary Material - Methods Experimental validations of predicted interactions Table S1-1: Protein pairs that were validated by

More information

Mouse Factor XII Total ELISA Kit

Mouse Factor XII Total ELISA Kit Mouse Factor XII Total ELISA Kit Catalog No: IMFXIIKT-TOT Lot No: SAMPLE INTENDED USE This mouse coagulation Factor XII antigen assay is intended for the quantitative determination of total Factor XII

More information

AnaTag HiLyte Fluor 750 Microscale Protein Labeling Kit

AnaTag HiLyte Fluor 750 Microscale Protein Labeling Kit AnaTag HiLyte Fluor 750 Microscale Protein Labeling Kit Catalog # 72044 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 750 SE to proteins (e.g., IgG). It provides ample

More information

Quantifying small numbers of antibodies with a near-universal protein-dna chimera

Quantifying small numbers of antibodies with a near-universal protein-dna chimera Quantifying small numbers of antibodies with a near-universal protein-dna chimera Ian Burbulis, Kumiko Yamaguchi, Richard Yu, Orna Resnekov & Roger Brent Supplementary figures and text: Supplementary figure

More information

AnaTag HiLyte Fluor 647 Microscale Protein Labeling Kit

AnaTag HiLyte Fluor 647 Microscale Protein Labeling Kit AnaTag HiLyte Fluor 647 Microscale Protein Labeling Kit Revision number: 1.3 Last updated: May 2018 Catalog # AS-72050 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 647

More information

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2) SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca

More information

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands).

Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Methods Materials Culture media, trypsin, penicillin and streptomycin were from Invitrogen (Breda, the Netherlands). Bovine fibroblast growth factor (BFGF), thrombin, forskolin, IBMX, H-89, BAPTA-AM and

More information

Product Datasheet. Histone H3 [ac Lys4] Antibody NB SS. Unit Size: mg

Product Datasheet. Histone H3 [ac Lys4] Antibody NB SS. Unit Size: mg Product Datasheet Histone H3 [ac Lys4] Antibody NB21-1024SS Unit Size: 0.025 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Reviews: 1 Publications: 2 Protocols,

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for

More information

Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1.

Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1. GR24 (μm) 0 20 0 20 GST-ShHTL7 anti-gst His-MAX2 His-COI1 PVDF staining Supplementary information, Figure S1A ShHTL7 interacted with MAX2 but not another F-box protein COI1. Pull-down assays using GST-ShHTL7

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK

More information

Anti-p62 C-terminal pab

Anti-p62 C-terminal pab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-p62 C-terminal pab CODE No. CLONALITY Polyclonal ISOTYPE Guinea pig Ig, affinity purified QUANTITY 100 µl SOURCE IMMUNOGEN FORMURATION

More information

Rat Factor XII Total Antigen ELISA Kit

Rat Factor XII Total Antigen ELISA Kit Rat Factor XII Total Antigen ELISA Kit Catalog No: IRFXIIKT-TOT Lot No: SAMPLE INTENDED USE This rat coagulation Factor XII antigen assay is intended for the quantitative determination of total Factor

More information