Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio
|
|
- Silvia Clark
- 6 years ago
- Views:
Transcription
1 2013 Plant Management Network. Accepted for publication 18 December Published. Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio John R. Fisher, Ohio Department of Agriculture, Plant Health Diagnostic Laboratory, Plant Health Division, Reynoldsburg, OH Corresponding author: John R. Fisher. jfisher@agri.ohio.gov Fisher, J. R Identification of a Cucumber mosaic virus subgroup II strain associated with virus-like symptoms on Hosta in Ohio. Online. Plant Health Progress doi: /php BR. Cucumber mosaic virus (CMV) is the type species of the Cucumovirus genus in the Family Bromoviridae. The virus is distributed worldwide, has a very broad host range infecting over 1000 species in more than 85 plant families, and is transmitted by more than 80 aphid species in 30 genera in a non-persistent fashion. The viral genome is positive sense, single-stranded RNA divided among three segments which encode five proteins. RNAs 1 and 2 encode 3 proteins with methyl transferase/helicase, replicase, and suppression of RNA silencing functions. The movement protein (MP) gene is expressed directly from the 5 half of RNA 3, and the coat protein (CP) gene is expressed from the 3 half via a subgenomic RNA, referred to as RNA 4. CMV is divided into two subgroups based on serological and nucleotide sequence relatedness. Some isolates are also reported to harbor small satellite (sat) RNAs (3). In the spring of 2012, a Hosta sp. Cynthia sample displaying virus-like symptoms, including mottle and spotting (Fig. 1), was submitted to the Ohio Plant Diagnostic Network as part of a Farm Bill funded survey of perennial viruses. The sample tested positive for CMV and negative for the Potyvirus group, Alfalfa mosaic, Arabis mosaic, Impatiens necrotic spot, Tobacco mosaic, Tobacco ringspot, Tobacco streak, Tomato mosaic, Tomato ringspot, and Tomato spotted wilt viruses by ELISA using commercially available antibodies (Agdia Inc., Elkhart, IN). The sample also tested negative for Tobacco rattle virus by reverse transcription (RT) PCR.
2 Fig. 1. Mottle and spotting symptoms observed on Hosta sp. Cynthia plants. Double-stranded (ds) RNA was purified from leaf tissue as previously described (4), resulting in a dsrna banding profile atypical for CMV (Fig. 2). cdnas were synthesized from a dsrna template and used to amplify the MP and CP regions of the genome by PCR as previously described (1,2). The cdnas were also used in PCR with primers designed to amplify satrna (1). The MP and CP primers amplified strong, clear products of the expected size, approximately 1200 and 1000 bp, respectively (Fig. 3). The amplicons were excised from the gel, purified, and ligated into pgem-t vector as previously described (1,2). Colonies were screened for an insert by PCR using M13 primers, and the plasmid DNA was purified and subsequently sequenced (Plant Microbe Genomics Facility, The Ohio State University). Vector sequences were trimmed from raw sequences (Chromas v. 2.33), assembled, and subjected to pairwise and multiple sequence alignments (Vector NTI Advance 11.5, Invitrogen) as previously described (1,2).
3 Fig. 2. dsrna profiles obtained from (Lane 1) Hosta sp. Cynthia leaf tissue and (Lane 2) CMV-Vinca N1-03 isolate from tobacco tissue. CMV dsrnas 1-4 and satellite dsrna are indicated to the right. M = 1 Kb DNA ladder ( bp markers indicated to the left). Electrophoresis was done in 1% agarose at 100 volts for 90 min in 1X TAE buffer. Gel was stained with ethidium bromide.
4 Fig. 3. PCR detection of CMV from cdnas synthesized from dsrna template with MP-specific (Lane 1), CP-specific (Lane 2), and satrna-specific (Lane 3) primers. Water controls with MP (Lane 4), CP (Lane 5), and satrna (Lane 6) primers. CMV-Vinca CP (Lane 7) and satrna (Lane 8) clones used as positive PCR controls with CP and satrna primers (Lanes 7 and 8 respectively). M = 1 Kb DNA ladder (250, 500, 750, 1000, and 1500 bp markers indicated). Electrophoresis was done in 0.8% agarose at 100 volts for 60 min in 1X TAE buffer. Gel was stained with ethidium bromide. Three MP and four CP amplicon clones were sequenced and the processed sequences deposited in GenBank (accession nos. JX JX898520). All of the MP clones were 1196 nucleotides (nt), with the MP open reading frame (ORF) being 840 nt. All of the CP clones were 973 nt, with the CP ORF being 657 nt. BLASTn searches of the NCBI database using the MP and CP ORF sequences produced matches with 99% nt identities; notably the CMV subgroup II strain LS (accession no. AF ) and a subgroup II isolate we recently reported from Vinca minor (accession nos. JF , JF ) (1). These results represent the first confirmed report of CMV infecting Hosta spp. in Ohio. The CMV-Hosta isolate described here is clearly a subgroup II strain closely related to strain LS, as well as one found in Vinca minor in Ohio. Further, the CMV-Hosta isolate did not have detectable satrna associated with it based on dsrna and PCR results. The dsrna profile obtained from the CMV-Hosta isolate was atypical in that none of the genomic dsrnas were visible when subjected to agarose gel electrophoresis (Fig. 2), yet cdnas synthesized from purified dsrna template amplified strong products with the MP and CP markers demonstrating the presence of RNA 3 in the sample extract and suggesting the genomic dsrna titre was too low to detect visually. These results expand the known host range for CMV in Ohio to include Hosta spp. and benefit Hosta growers by increasing awareness of the virus as a current threat, especially since the symptoms initially observed on Hosta Cynthia disappeared over the course of the growing season.
5 Literature Cited 1. Fisher, J. R Identification of three distinct classes of satellite RNAs associated with two Cucumber mosaic virus serotypes from the ornamental groundcover Vinca minor. Online. Plant Health Progress doi: /php rs. 2. Fisher, J. R First report of Tobacco rattle virus associated with ring spot and line pattern disease of peony in Ohio. Online. Plant Health Progress doi: /php br. 3. King, A. M. Q., Adams, M. J., Carstens, E. B., and Lefkowitz, E. J Virus Taxonomy, Ninth Report of the International Committee on Taxonomy of Viruses. Bromoviridae. Pages Elsevier Academic Press, Waltham, MA. 4. Valverde, R. A., Nameth, S. T., and Jordan, R. L Analysis of double-stranded RNA for plant virus diagnosis. Plant Dis. 74:
Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio
2013 Plant Management Network. Accepted for publication 21 December 2012. Published. Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio
More informationIdentification of Two Tobacco rattle virus Variants Associated with Line Pattern Disease of Bleeding Heart in Ohio
2013 Plant Management Network. Accepted for publication 19 December 2012. Published. Identification of Two Tobacco rattle virus Variants Associated with Line Pattern Disease of Bleeding Heart in Ohio John
More informationJohn R. Fisher, Ohio Department of Agriculture, Plant Health Diagnostic Laboratory, Plant Health Division, Reynoldsburg, OH 43068
2012 Plant Management Network. Accepted for publication 1 February 2012. Published. Identification of Three Distinct Classes of Satellite RNAs Associated With Two Cucumber mosaic virus Serotypes from the
More informationTECHNICAL SHEET No. 23. Virus Detection: Potato virus Y (PVY) and PVY N
TECHNICAL SHEET No. 23 Virus Detection: Potato virus Y (PVY) and PVY N Method: RT-PCR General Virus detected: PVY from potato tubers and leaf. General method is reverse transcription PCR (RT-PCR). Developed
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationTECHNICAL SHEET No. 21. Virus Detection: Potato virus Y (PVY)
TECHNICAL SHEET No. 21 Virus Detection: Potato virus Y (PVY) Method: Immunocapture RT-PCR, RFLP Immunocapture RT-PCR General Virus detected: PVY from potato General method: IC-RT-PCR, RFLP-IC-RT-PCR Developed
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationAntisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability
Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability Riaaz Lalani, Nathaniel Susilo, Elisa Xiao, Andrea Xu
More informationDETECTION OF HEPATITIS C VIRUS RNA USING REVERSE TRANSCRIPTION PCR
Chapter 10 XA9846743 10.1. INTRODUCTION DETECTION OF HEPATITIS C VIRUS RNA USING REVERSE TRANSCRIPTION PCR S.F. Yap Department of Allied Health Sciences, Faculty of Medicine, University of Malaya, Kuala
More informationINCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH CULTIVARS IN MONTENEGRO
INCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH CULTIVARS IN MONTENEGRO Zindović J., 1 Božović V., 1 Miladinović Z., 2 Rubies Autonell C. 3, Ratti C. 3 1 2 3 Peach production in Montenegro Stone fruit
More informationChapter 10 (Part II) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the
More informationGenOMe ORGanIZaTIOn and SeQUenCe DIVeRSITY Of a novel blackberry ampelovirus
GenOMe ORGanIZaTIOn and SeQUenCe DIVeRSITY Of a novel blackberry ampelovirus T. Thekke-Veetil 1, S. Sabanadzovic 2, K.e. Keller 3, R.R. Martin 3, I.e. Tzanetakis 1* 1 Department of Plant Pathology, Division
More informationDevelopment of Positive Control for Hepatitis B Virus
Human Journals Research Article December 2015 Vol.:2, Issue:2 All rights are reserved by Saurabh Bandhavkar et al. Development of Positive Control for Hepatitis B Virus Keywords: Hepatitis B virus, pbluescript,
More informationPlants viruses as biological vectors
Plants viruses as biological vectors Virus very small infectious particles composed of a protein coat and a nucleic acid core. Most viruses have at least 3 genes: One (or more) concerned with replication
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationDiAGSure Mycobacterium tuberculosis (MTB) Detection Kitit
DiAGSure Mycobacterium tuberculosis (MTB) Detection Kitit Description: Tuberculosis (TB) is caused by the acid-fast bacterium Mycobacterium tuberculosis. Although Mycobacterium tuberculosis most commonly
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationThe Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
More informationINTRODUCTION DEVELOPMENT OF DIAGNOSTICS FOR SWEETPOTATO FEATHERY MOTTLE VIRUS. Productivity of sweet potato is very low in India (8 tonnes/ ha)
DEVELOPMENT OF DIAGNOSTICS FOR SWEETPOTATO FEATHERY MOTTLE VIRUS Ganga Prasanth, Vinayaka Hegde, Makeshkumar.T, Jeeva M.L. and Edison.S INTRODUCTION Sweet potato ( Ipomoea batas L,) is an important starchy
More informationVirus-induced gene complementation reveals a transcription factor network in modulation of tomato fruit ripening
Supplementary Information Virus-induced gene complementation reveals a transcription factor network in modulation of tomato fruit ripening Tao Zhou 2,3, Hang Zhang 2,4, Tongfei Lai 1, Cheng Qin 1, Nongnong
More informationAmplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :
Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and
More informationPlants Fight it out Intrinsic defence mechanism The magic world of Gene silencing
I LOVE YOU Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing Over expression of Chalcone synthase gene to get Purple Petunias Napoli, Lemieux & Jorgensen,1990 Desired Effect
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationOmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells
OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)
More informationRegulation of enzyme synthesis
Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example
More informationTexas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I) We have made considerable progress in our analysis of the gene for
More informationBiology 4100 Minor Assignment 1 January 19, 2007
Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on
More informationINNOVAPI WP3 Activity 3 Health Parameters
Harmonization of methods for measuring viral load and bio-markers of aging Stage1 : Quality check of extracted RNA in Torino A qpcr on 18S gene showed that the extracted samples also contain genomic DNA.
More informationNational Plant Diagnostic Network Virus Diagnostics workshop. dsrna analysis. Virus Detection Methods
National Plant Diagnostic Network Virus Diagnostics workshop dsrna analysis Virus Detection Methods An early step in any approach to treat and manage viral diseases involves detection and identification
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationPolymerase Chain Reaction
Polymerase Chain Reaction Variations of PCR in the Diagnostic Lab The most common variations of standard PCR used in the diagnostic laboratory are: Reverse Transcriptase PCR (RT-PCR) Nested PCR (n-pcr)
More informationNUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE
NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE COMPANY PROFILE Since its founding in 1998,, Inc. has been at the forefront of nucleic acid purification by offering products
More information5 min dsrna Extraction Kit
5 min dsrna Extraction Kit Most plant viruses have RNA genomes that can be single stranded or double stranded. During replication of viruses in plant, high molecular weight double-stranded ribonucleic
More informationMOLECULAR CLONING OF THE PHILIPPINE ISOLATE OF BANANA BUNCHY TOP VIRUS (BBTV)
Trans. Natl. Acad.Sci. Tech. Philippines 21: 287-291 (1999). ISSN 0 J J 5-8848 MOLECULAR CLONING OF THE PHILIPPINE ISOLATE OF BANANA BUNCHY TOP VIRUS (BBTV) VERMANDO M. AQUINO I, HUI WANG2, EVELYN MAE
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationCHAPTER FOUR. Characterization of parasporal genes in. Paenibacillus popilliae and Paenibacillus lentimorbus. Abstract
CHAPTER FOUR Characterization of parasporal genes in Paenibacillus popilliae and Paenibacillus lentimorbus Abstract The parasporal gene, cry18aa1, was cloned and sequenced by Zhang et al. (4) from the
More informationDig System for Starters
Dig System for Starters Content 1. Powerful and Versatile DIG System 2. Labeling Nucleic Acids using the DIG System 3. Critical Hints for PCR Labeling 1 2 3 1. Powerful and Versatile DIG System Powerful
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationMochamad Nurcholis. Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013
Mochamad Nurcholis Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013 Microbial Identification Type Conventional Identification DNA Hybridization PCR Amplification DNA
More informationNote Name Sequence F1-DCL1 AAAAACTAGTCTGGGCCCGT Dcl1 KO F1-DCL1-
Table S1: Primers used in this study. Primer Note Name Sequence F1-DCL1 AAAAACTAGTCTGGGCCCGT Dcl1 KO F1-DCL1- Dcl1 KO nested GGCTGGAGCATTTCACATTGG F2-DCL1 ACCCAATTCGCCCTATAGTGAGTCGTATGAACAGACGATGGCGGAC
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More information7.012 Problem Set 5. Question 1
Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationDevelopment of a Multiplex Reverse Transcription-Polymerase Chain Reaction Assay for the Simultaneous Detection of Three Viruses in Leguminous Plants
식물병연구 Res. Plant Dis. 24(4): 348-352 (2018) Note Open Access https://doi.org/10.5423/rpd.2018.24.4.348 Development of a Multiplex Reverse Transcription-Polymerase Chain Reaction Assay for the Simultaneous
More informationGeneral Product Insert. End-Point PCR/RT-PCR Kit Product# EPxxxxx
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com End-Point PCR/RT-PCR Kit Product# EPxxxxx General Product Insert
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra
More informationCHAPTER 3 DEVELOPMENT OF DENV GROUP SPECIFIC REAL TIME RT-PCR
CHAPTER 3 DEVELOPMENT OF DENV GROUP SPECIFIC REAL TIME RT-PCR 28 Dengue is diagnosed by either detecting virus or antibody to the virus in blood. Isolation of virus in cell culture or in infant mouse brain
More informationHop Latent Viroid (HLVd) End-Point RT-PCR Kit Product# EP38700
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Hop Latent Viroid (HLVd) End-Point RT-PCR Kit Product# EP38700
More informationEdexcel (B) Biology A-level
Edexcel (B) Biology A-level Topic 7: Modern Genetics Notes Using Gene Sequencing Genome = all of an organism s DNA, including mitochondrial/chloroplast DNA. Polymerase chain reaction (PCR) is used to amplify
More informationTaxonomy. Classification of microorganisms 3/12/2017. Is the study of classification. Chapter 10 BIO 220
Taxonomy Is the study of classification Organisms are classified based on relatedness to each other Chapter 10 BIO 220 Fig. 10.1 1 Species Binomial nomenclature for species identification A eukaryotic
More informationGenerated by Foxit PDF Creator Foxit Software For evaluation only. Biotechnology in Plant Pathology
Biotechnology in Plant Pathology Plant Biotechnology Definition: The use of tissue culture & genetic engineering techniques to produce genetically modified plants that show improved desirable characteristics.
More informationSensitivity vs Specificity
Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome
More informationUser Manual. Version 5. Published February Catalog No. K1021 ~
GeneFishing TM DEG Premix Kit User Manual Version 5 Published February 2005 Catalog No. K1021 ~ 1026 Table of Contents 1. Notices to Customers 1.1 Product Warranty and Liability------------------------------------
More informationUnderstanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University
Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene Andrew ElBardissi, The Pennsylvania State University Abstract: Hong Ma, The Pennsylvania State University The Excess Microsporocytes
More informationA 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells
Plant Cell, Tissue and Organ Culture (PCTOC) A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Anna Týcová a,b, Rajen J. J. Piernikarczyk c, Michael
More informationSupporting Information
Supporting Information SI Materials and Methods RT-qPCR The 25 µl qrt-pcr reaction mixture included 1 µl of cdna or DNA, 12.5 µl of 2X SYBER Green Master Mix (Applied Biosystems ), 5 µm of primers and
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationUser Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only
DNA Walking SpeedUp TM Kit SpeedUp Sequencing SpeedUp BAC Clone Sequencing SpeedUp Genome Walking SpeedUp Transgene Location Detection SpeedUp Deletion/ Insertion/ Isoform Detection User Manual Version
More informationHCV Genotype Primer Kit
Instruction Manual for HCV Genotype Primer Kit HCV Genotype Determination Kit for Research Purpose Thoroughly read this instruction manual before use of this kit Background Study of nucleotide sequence
More information10X ligation buffer ligase 1 vector DNA insert DNA H 2 O. 10 µl Total Volume. 10X ligation buffer ligase 1 vector DNA insert DNA
Biol/Chem 475 S07 Study problems for quiz 1 See also questions posed in lab handouts including ligase handout Answers to questions 1&2 included at the end of this document. 1. You plan to clone a 1.0 kb
More informationPREDICT Host DNA Barcoding Guide
PREDICT Host DNA Barcoding Guide Contents: 1. Rationale for Barcoding.. Page 2 2. Implementation... Page 2 3. PCR Protocols.... Page 3 4. Data Interpretation... Page 5 5. Data Entry into EIDITH.... Page
More informationHammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection
Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection Md. Shamim Akhter et al. Online Supplementary Materials Supplementary methods Preparation
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationNOTES - CH 15 (and 14.3): DNA Technology ( Biotech )
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationBiol/Chem 475 Spring 2007
Biol/Chem 475 Spring 2007 Goal of lab: For most of the quarter, we will be exploring a gene family that was first discovered in fruitlfies and then found to be present in humans and worms and fish and
More informationPolymerase Chain Reaction
Polymerase Chain Reaction Problem Suppose you have a patient with an infection or a heritable disease. You want to know which infection or disease it is and.. you want to know it fast and... from as little
More informationChapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
More informationCitrus tristeza virus (CTV) diagnosis and strain typing by PCR-based methods
Citrus tristeza virus (CTV) diagnosis and strain typing by PCR-based methods Nolasco G. in D'Onghia A.M. (ed.), Menini U. (ed.), Martelli G.P. (ed.). Improvement of the citrus sector by the setting up
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationBSCI410-Liu/Spring 09/Feb 26 Exam #1 Your name:
1. (20 points) Give the name of a mutagen that could cause the following damages to DNA: a) Thymidine dimers UV b) Breakage of DNA backbone X-Ray c) 2 bp insertion (frameshift mutation) proflavin, acridine
More informationDNA REPLICATION & BIOTECHNOLOGY Biology Study Review
DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up
More information7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key
MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 Spring 2005 RDM Exam Study Questions 7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key
More informationInt.J.Curr.Res.Aca.Rev.2016; 4(10):
International Journal of Current Research and Academic Review ISSN: 2347-3215 Volume 4 Number 10 (October-2016) pp. 109-116 Journal home page: http://www.ijcrar.com doi: http://dx.doi.org/10.20546/ijcrar.2016.410.013
More informationGel Electrophoresis: Quantitative length and mass measurements of DNA
BIO440 Genetics Lab Humboldt State University Gel Electrophoresis: Quantitative length and mass measurements of DNA Electrophoresis, and in particular agarose gel electrophoresis, is an integral analysis
More informationOptimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design
Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid
More informationBiotechnology. Biotechnology is difficult to define but in general it s the use of biological systems to solve problems.
MITE 2 S Biology Biotechnology Summer 2004 Austin Che Biotechnology is difficult to define but in general it s the use of biological systems to solve problems. Recombinant DNA consists of DNA assembled
More information3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905)
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com FHV End-Point PCR Kit Product# EP44300 Product Insert Intended
More informationFirst record of Tomato chlorotic spot virus in the USA
Tropical Plant Pathology, vol. 37(5):333-338, 2012 Copyright by the Brazilian Phytopathological Society. Printed in Brazil. www.sbfito.com.br SHORT COMMUNICATION / COMUNICAÇÃO First record of Tomato chlorotic
More informationCSSV transmission and detection
CSSV transmission and detection Andy Wetten School of Biological Sciences University of Reading 10 April 2011 Summary CSSV characteristics Transmission routes Universal PCR-based screening CSSV DNA sequencing
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationSuperiorScript III cdna Synthesis Kit Instruction Manual
SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationCharacterization of resistance to Clover yellow vein virus in pea. Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA
Characterization of resistance to Clover yellow vein virus in pea Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA Graduated school of Agriculture Hokkaido University Sapporo, Japan
More informationCHAPTER THREE RESULTS
CHAPTER THREE RESULTS 3.1 PCR-SSP In this study, the PCR SSP technique was used to amplify the GYP hybrid gene from the genomic DNA samples and detect GP.Mur, GP.Bun, GP.Hop (148 bp), GP.HF and GP.Hut
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationUser Manual. For Research Use Only. Catalog No. FMLP Storage Conditions: -20 o C. Version 1.0 Published January 2004
Forever Multi-Ladder Personalizer I User Manual Version 1.0 Published January 2004 Catalog No. FMLP-2004 Storage Conditions: -20 o C For Research Use Only Product Warranty and Liability Seegene warrants
More informationPolymerase chain reaction: advantages and drawbacks
Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2015 Polymerase chain reaction: advantages and drawbacks Favrot, C Posted at
More informationMycobacterium tuberculosis End-Point PCR Kit Product# EP42100
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Mycobacterium tuberculosis End-Point PCR Kit Product# EP42100
More information