Detecting Rare Genomic Copies or Events
|
|
- Godwin Floyd
- 6 years ago
- Views:
Transcription
1 Detecting Rare Genomic Copies or Events Integrated DNA Technologies Nick Downey, PhD
2 Common Diagnostics Challenges Detecting targets early with accuracy Detecting different strains (e.g., antibiotic resistance) Compiling multiplex assays to detect targets 2
3 MGB Eclipse Probes Are Now Available From IDT GMP production of minor groove binder (MGB) probes and primers For use in human in vitro diagnostic (IVD) applications FAM, HEX, or TET dyes MGB stabilizes hybridization, which raises the T m of the probe Short functional probes bases can be useful for: Allelic discrimination Designing probes in limited unique sequence space Low complexity AT rich regions 3
4 MGB Eclipse vs. ZEN Fluorescent Signal No Baseline Subtraction With Baseline Subtraction IDT FAM/ZEN IDT MGB IDT FAM/ZEN Competitor MGB IDT MGB Competitor MGB 4
5 RNase H2 Dependent PCR (rhpcr) Primer deblocking is required for PCR, which in turn requires that primers be annealed to the target DNA sequence. The enzymatic deblocking cleavage event is sensitive to base mismatch and confers added specificity to the ensuing PCR reaction. Primer-dimer formation is highly reduced. 5
6 Biased Amplification vs. Biased Signal Generation F SNP Q F rddddmx SNP As PCR occurs, signal is generated from the degradation of the probe. If multiple targets are present (which occurs in rare allele reactions) signal generation occurs only from the targeted allele, and intensity is lowered proportionally. In biased amplification, only the sequence of interest (red) is amplified, meaning that a single target can be identified in a background containing a high amount of nearly identical DNA (blue). Using this technique, rare alleles can be detected in a background of >1000-fold higher untargeted DNA. 6 Biased signal generation (PrimeTime) Biased amplification (rhpcr)
7 2 rhprimer Designs Are Possible 1st generation (GEN1): rddddmx, good for general purpose GEN1 primers are most appropriate for standard genotyping applications and for multiplexed amplification 2nd generation (GEN2): rdxxdm best specificity, but at a cost higher enzyme amounts required, and will need specific titration to application GEN2 primers are most appropriate for rare-allele detection or for applications where extremely high fidelity of template amplification is desired 7
8 8 GEN1: For General Purpose Use and Minimizing Primer- Dimer Formation GEN1 primers are most appropriate for standard genotyping applications and multiplexed amplification. This primer design is robust and works well with low levels of RNase H2 enzyme. Mismatch guideline: M base should be the same base as the template strand.
9 GEN2: For Rare Allele Genotyping Most appropriate for rare-allele detection or for applications where extremely high fidelity of template amplification is desired May require use of higher amounts of RNase H2 enzyme (range is 1 100X that needed for GEN1 primers); titration and optimization need to be performed for each GEN2 primer set For simplicity, we recommend use of GEN1 primers for most needs 9
10 Blocked Primers Provide Specificity and Sensitivity Two-step PCR 60 C anneal/extend: 30 sec 95 C melt: 10 sec 2.6 mu RNase H2 Anneal/cleavage/dissociation/polymerase extension can take place in the same timeframe as using unmodified primers and with comparable kinetics. PCR C q values are unchanged. 10 No RNase inhibitor was present in these reactions. Even though these primers have an RNA residue, non-specific cleavage by single-stranded RNases 103 (such bp synthetic as RNase amplicon, A) or alkaline run using hydrolysis 2 x 10 will 6 copies not cause template background signal or false positive amplification For AGCTCTGCCCAAAGATTACCCTG because cleavage by these routes leaves a 3 -phos, which blocks primer function. Rev CTGAGCTTCATGCCTTTACTGT Blocked-For AGCTCTGCCCAAAGATTACCCTGaCAGC-x Blocked-Rev CTGAGCTTCATGCCTTTACTGTuCCCC-x Probe: FAM-TTCTGAGGCCAACTTCCACTGCCACTTA-FQ
11 rhprimers Reduce Primer Dimer Events in HCV Assay Typically, intelligent primer design can reduce the incidence of primer-dimers and false priming events. Nevertheless, these unwanted events still occur. Sometimes, it is necessary to design primers to specific sequences as dictated by the target sequence available. This HCV assay was cited in a Roche patent (US ) relating to the problem of primer-dimer formation. Blocked primers and RNase H2 solved the problem of primer-dimer formation. 11
12 HCV Subtype 1b qpcr Assay ST280A: GCAGAAAGCGTCTAGCCATGGCGTTA ST280A rgd4 SpC3: GCAGAAAGCGTCTAGCCATGGCGTTAgTATG-x ST778AA: GCAAGCACCCTATCAGGCAGTACCACAA ST778AA rgd4 SpC3: GCAAGCACCCTATCAGGCAGTACCACAAgGCCT-x 12 Hepatitis C virus subtype 1b amplicon (242 bp): gcagaaagcgtctagccatggcgttagtatgagtgtcgtgcagcctccaggaccccccctcccgggagagccatagtggtctgcgga accggtgagtacaccggaattgccaggacgaccgggtcctttcttggactaaacccgctcaatgcctggagatttgggcgtgccccc gcgagactgctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatagggtgcttgc Cloned synthetic target 0 or 2.6 mu RNase H2 +/ Rat cdna
13 rhpcr Provides Specific Amplification Product in HCV Subtype 1b qpcr Assay Primers alone Minus RNase H2 Plus RNase H Rat cdna Target U B U B U B U B U B U B True Positive Primer dimers 25 Primers 13 Unmodified primers gave the same false products with or without target. Only blocked primers + RNase H2 correctly gave true positive products.
14 Second Generation (GEN2) Cleavable Primer Designs Improve Specificity for SNP Assays First generation (GEN1) primer design: CAGCCTCATCCAAAAGAGGAAAcAGGAM-x DDDDMx primers Second generation (GEN2) primer design: CAGCCTCATCCAAAAGAGGAAAcAxxAM DxxDM primers Non-nucleotide groups make cleavage less efficient, but more specific. Mismatch guideline: M base should be the same base as the template strand 14
15 rhpcr SNP Assay for SMAD7 (GEN1 vs. GEN2) 15
16 Detection of Rare Variants in a Mixed Sample Genomic DNAs homozygous for the 2 SMAD7 alleles were mixed at different ratios to determine the limit of detection of the rare allele in a mixed sample. 16 Input mismatch SNP Input match SNP Control (unmodified) :1000 1:10, rc-aggax rc-axxa ru-aggax ru-axxa New, second generation cleavable primers are able to distinguish the presence of 1:10,000 of the match allele in a large background of the mismatch allele. 1:100
17 Looking Deeper... Sometimes, looking at individual SNPs does not provide enough information about the sample. Next generation sequencing may be a better option. But whole sample sequencing can lead to bandwidth problems xgen Lockdown Probes provide a robust target capture system. Each oligo individually QC ed by ESI Flexibility in scale of synthesis and probe number Fast turnaround time Capture protocol available online Platform agnostic 17
18 18 How Target Capture Works
19 Probe Performance and Validation Design of T m Experiment 1, 3, or 7 bp (All T) 7 bp (All T or All C) 7 bp (All T or All C) Top strand = 121, 123, or 127 bp respectively Top strand = 134 bp 120 bp 120 bp 1 bp mismatch (G-T or T-T) 120 bp 120 bp 120 bp Ultramer Oligonucleotides had either 1, 3, or 7 G-T or T-T mismatches 120 bp 19
20 Probe Performance And Validation Conclusions 1 7 base mismatches had <5 C ΔTm 1 or base insertions had <4 C ΔTm These small changes in Tm will not affect capture Thus use of a 120mer capture probe is sufficient 20
21 xgen Lockdown Probes Rescue Panel Dropout 21
22 xgen Lockdown Probes Improve Coverage and Uniformity 22 # Reads Data from Foundation Medicine comparing results of a large set of IDT xgen Lockdown Probes with a focused Agilent SureSelect set IDT xgen Lockdown Probes: 100% >150X coverage Agilent SureSelect set: 80.7% >150X coverage
23 Case Study: Detecting and Typing Hepatitis C Compare HiSeq runs to see if xgen Lockdown probes can enrich for viral sequences. Look at how robust a panel might be in analyzing different strains. Attempt second round of design to create a more robust panel. 23
24 xgen Lockdown Probes Successfully Capture Viral DNA 24
25 A Single Panel Can Provide Data for Different Strains Case: Sample is identical to probes Case: Sample has same sub-genotype Case: Sample has different sub-genotype Case: Sample has different genotype 25 Read depth from a MiSeq run Identity of the probe sequences to the sample
26 Supplementing with xgen Lockdown Probes Improves Coverage of Low Identity Regions 26
27 Online Order Tool Allows Custom Solutions We offer several input options: For human, mouse, and rat we can process gene symbols or RefSeq IDs For other species we can process FASTA format sequence We recommend 1X tiling and probe length of 120 bases for most designs 27
28 Blocking Oligos Function Two classes of blocking oligos are needed: I. Cot1 DNA to block Alu, LINE repeat elements II. Oligonucleotide blocking oligos to block linkers/adapters 28
29 29
30 Slides to help answer questions (not shared with customers) 30
31 Percent Cleaved Detergent is ESSENTIAL for Robust P. abyssi RNase H2 Activity Percent detergent in reaction Triton-X-100 Tween-20 Tween-80 Ctab N-Lauroyl sarcosinate CTCGTGAGGTGATGcAGGAGATGGGAGGCG-3 3 -GAGCACTCCACTACGTCCTCTACCCTCCGC-5 0.1% Triton X-100 is present in dilution buffer and also in storage buffer
32 P. abyssi RNase H2 Is Only Active at Elevated Temperatures P-CTCGTGAGGTGATGcAGGAGATGGGAGGCG 3 3 GAGCACTCCACTACGTCCTCTACCCTCCGC 5
33 P. abyssi RNase H2 is Active Across a Broad Range of Mg 2+ levels Usually 3 mm Mg 2+ is recommended P-CTCGTGAGGTGATGcAGGAGATGGGAGGCG 3 3 GAGCACTCCACTACGTCCTCTACCCTCCGC 5
34 Pyrococcus abyssi RNase H2 is Very Thermostable 34 The enzyme can be incubated at 95 C for >45 minutes with little loss of activity. The enzyme will survive thermal cycling (e.g., PCR reactions).
35 Why Do We Use Pyrococcus abyssi RNase H2 Pyrococcus abyssi RNase H2 is very thermostable. The RNase H2 enzyme is inactive at low temperature. Hot start is achieved without need for a modified hot start polymerase. The enzyme is active across a wide range of magnesium concentrations, including concentrations commonly used in PCR. Most RNase enzymes cleave to leave a 3 Phosphate. P. abyssi RNase H2 cleaves to leave a 3 OH 35
Application guide for rhpcr
Application guide for rhpcr rhpcr Primers Description Terminal bases* Synthesis scale Purification rhprimer GEN1 rddddmx 100 nmol rhprimer GEN2 rdxxdm 100 nmol Standard desalting RNase H2 Enzyme and Buffer
More informationMaximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics
Maximizing your NGS sequencing with IDT Adam Chernick, PhD Field Applications Manager, Functional Genomics 1 Contents Expanding our NGS portfolio what s next? xgen technology and Lockdown probe advantages
More informationOptimizing Multiplex qpcr for Detecting Infectious Diseases
Optimizing Multiplex qpcr for Detecting Infectious Diseases Aurita Menezes Ph.D, qpcr Product Manager Integrated DNA Technologies Agenda Establishing robust multiplex assays In the context of Gene expression
More informationProcomcure Biotech. PCR Reagents
Procomcure Biotech PCR Reagents valid for 2018 VitaTaq DNA Polymerase is a standard Taq DNA polymerase suitable for all common PCR applications like colonypcr, cloning applications, high-throughput PCR
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More informationGuidelines for Developing Robust and Reliable PCR Assays
Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay
More informationPCR KIT/REAGENTS/BUFFERS/PRIMERS
PCR KIT/REAGENTS/BUFFERS/PRIMERS 114330 DNA Amplification Kit DNA amplification kit is suitable for amplification of DNA size about 100bp to 5kb. It can be also used to RAPD PCR. This kit contains all
More informationModule1TheBasicsofRealTimePCR Monday, March 19, 2007
Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More informationPolymerase Chain Reaction PCR
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. To understand principle of 2. Types 3. Applications 2. Lay Out 3 Types of Qualitative
More informationPrimeTime Pre-designed qpcr Assays
PrimeTime Pre-designed qpcr Assays nuclease assays for human, mouse, and rat PrimeTime qpcr Assays IDT now offers PrimeTime Pre-designed qpcr Assays that are guaranteed to work for human, mouse, and rat
More informationSuperiorScript III cdna Synthesis Kit Instruction Manual
SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Probe Low ROX qpcr Master Mix #K0944 For 5000 rxns Lot Expiry Date Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More informationSunScript TM One Step RT-qPCR Kit
INDEX Ordering Information...3 Kit Contents...3 Shipping and Storage...3 Handling...3 Quality Control...3 Reagents and Equipment to be Supplied by the User...3 Description...4 Protocol...4 Troubleshooting
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationTable of contents. I. Description...2. II. Principle...2. III. Kit Components...3. IV. Storage...3. V. Features...4. VI. Precautions for Operation...
Table of contents I. Description...2 II. Principle...2 III. Kit Components...3 IV. Storage...3 V. Features...4 VI. Precautions for Operation...4 VII. Protocol...4 VIII.Experiment Example...6 IX. Appendix...8
More informationRoche Molecular Biochemicals Technical Note No. LC 12/2000
Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method
More informationFrequently Asked Questions
Frequently Asked Questions VeriQuest qpcr Master Mixes VeriQuest Probe qpcr Master Mix 1. What is the VeriQuest Probe qpcr Master Mix? VeriQuest Probe qpcr Master Mix is a ready-to-use mix for real-time
More informationReal Time Quantitative PCR Assay Validation, Optimization and Troubleshooting
Real Time Quantitative PCR Assay Validation, Optimization and Troubleshooting Dr Steffen Muller Field Applications Scientist Stratagene Europe Overview The Importance of Controls Validation and Optimization
More informationMOLECULAR SOLUTIONS FOR BIOTECHNOLOGY
MOLECULAR SOLUTIONS FOR BIOTECHNOLOGY OUR PCR TECHNOLOGY OUR CAPABILITIES Over 20 years of molecular biology research has given Bioline scientists a deep understanding of the profound influence that buffer
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationBoost Your Real-Time Results
Boost Your Real-Time Results Refresh your knowledge of the fundamentals of real-time PCR Sample & Assay Technologies 1 Introduction Real-time PCR and RT-PCR are highly sensitive techniques that enable
More informationDevelopment of a new GMP TAQ polymerase for improved PCR performance. Marie-Claire Beckers, Peter Haima
Development of a new GMP TAQ polymerase for improved PCR performance Marie-Claire Beckers, Peter Haima Contents Context: Eurogentec GMP manufacturing of IVD components PCR performance issues Novel concept:
More informationMethods in virus diagnosis PCR techniques
Methods in virus diagnosis PCR techniques 450 MBIO PRACTICAL LESSON 5 Molecular Methods Methods based on the detection of viral genome are also commonly known as molecular methods. It is often said that
More informationTHUNDERBIRD SYBR qpcr Mix
Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]
More informationUSB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
More informationPlantDirect TM Multiplex PCR System
PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationSuccessful gene expression studies using validated qpcr assays. Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015
Successful gene expression studies using validated qpcr assays Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015 Agenda Requirements for high quality qpcr assays Approaches for qpcr assay validation
More informationGreenMasterMix (2X) b i o s c i e n c e. G E N A X X O N b i o s c i e n c e. High ROX (500nM)
G:\products\productflyer\pcr\polymerasen\hotstart\manu_m3052_green_en.docx GreenMasterMix (2) High RO (500nM) qpcr master mix with fluorescence dye and passive reference dye Contact & Technical support
More informationHRM Powered by Precision Melt Analysis Software
HRM Powered by Precision Melt Analysis Software Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Overview Introduction to High Resolution
More information2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire
2 march 06 Seminar on RT-PCR About Real-time PCR Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire Target DNA PCR Applications: Gene Plasmide, phage Diagnostic
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationApplication Notes
Application Notes Superior Performance and Flexibility In order to minimize errors in DNA replication during PCR, it is essential to choose a high-fidelity DNA polymerase enzyme. The introduction of errors
More informationChapter 1. Introduction
Chapter Introduction Table of Contents Introduction Page. Principles of PCR and RT-PCR...9.2 The Evolution of PCR....3 Purpose of this PCR Applications Manual...5 8 PCR Applications Manual Principles of
More informationPlexor Real-Time Quantitative PCR Systems: Multiplexed Assays Made Easy. Kyle Hooper, Ph.D. Genomics Product Manager qpcr 2005
Plexor Real-Time Quantitative PCR Systems: Multiplexed Assays Made Easy Kyle Hooper, Ph.D. Genomics Product Manager qpcr 2005 Plexor Systems Real-Time qpcr Systems: Multiplexed Assays Made Easy Plexor
More informationPolymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr
Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr review Enzyme based DNA amplification Thermal Polymerarase derived from a thermophylic bacterium DNA dependant DNA polymerase
More informationCat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da
For Research Use SYBR Fast qpcr Mix Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Storage... 5 V. Features... 6 VI. Precautions... 6 VII. Protocol...
More informationHigh Yield/ Routine Applications Problematic templates, High GC/AT High Fidelity Heat-Activated Long Products High Specificity DHPLC Compatible
Yield/ Routine Applications Problematic templates, GC/AT Fidelity Heat-Activated Long Products Specificity DHPLC Compatible Polymerases Optimised dntp/ Polymerase Mixes Introduction are essential tools
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationBEST QUALITY HIGHEST PURITY. Recombinant ENZYMES & PROTEINS
BEST QUALITY HIGHEST PURITY Recombinant ENZYMES & PROTEINS We offer a wide range of highest quality enzymes and proteins for molecular biology including DNA polymerases, reverse transcriptases, DNA ligases,
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationPCR & qpcr. Complete PCR Solutions. enzolifesciences.com
PCR & qpcr Complete PCR Solutions INTEGRATED PCR-BASED TECHNOLOGIES Polymerase chain reaction (PCR) is an essential DNA/RNA amplification and detection technique widely used in research today. Whereas
More informationSYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0803 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction [2] Components
More informationmirna QPCR Master Mix
mirna QPCR Master Mix Instruction Manual Catalog #600583 Revision B Research Use Only. Not for Use in Diagnostic Procedures. 600583-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement
More informationNextGen Sequencing Technologies Sequencing overview
Outline Conventional NextGen High-throughput sequencing (Next-Gen sequencing) technologies. Illumina sequencing in detail. Quality control. Sequence coverage. Multiplexing. FASTQ files. Shendure and Ji
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationBasics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm
Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationUtility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides
Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides Laboratory Sciences, MPI Research, A Charles River Company Amy Smith, BA, Senior Director, Bioanalytical/Analytical
More informationQUICK-Clone TM User Manual. cdna
QUICK-Clone TM User Manual cdna PT1150-1 (PR752268) Published 25 May 2007 Table of Contents I. Introduction 3 II. Applications Discussion 4 A. Primer Design 4 B. Setting up the PCR Reaction 4 C. Example
More informationFastGene Optima. Products for PCR. proof-reading. ReadyMix. cdna SNP. routine PCR. polymerase. optimized blend complex templates. N gene knock out B O
Products for PCR www.nippongenetics.eu efficiency polymerase convenience endpoint PCR incl. loading dye direct PCR incl. dntps engineered enzyme archeal type B polymerase high GC content FastGene tissuebest
More informationExperiment (5): Polymerase Chain Reaction (PCR)
BCH361 [Practical] Experiment (5): Polymerase Chain Reaction (PCR) Aim: Amplification of a specific region on DNA. Primer design. Determine the parameters that may affect he specificity, fidelity and efficiency
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Glyceraldehyde-3-phosphate dehydrogenase Gapdh Rat This gene encodes a member of
More informationIntroduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
More informationmirna QPCR Master Mix
mirna QPCR Master Mix Instruction Manual Catalog #600583 Revision D.0 For Research Use Only. Not for use in diagnostic procedures. 600583-12 LIMITED PRODUCT WARRANTY This warranty limits our liability
More informationPCR Amplifies Targeted Sequence
PCR Amplifies Targeted Sequence Target Sequence Supercoiled DNA Strand DNA Strand Double Helix DNA Strand Chromosome P C R PCR PCR = Polymerase Chain Reaction. A primer directed-extension reaction for
More informationSYBR Premix DimerEraser (Perfect Real Time)
Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.
More informationHELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)
HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) Quantitative In vitro diagnostics Instruction manual Cat. No: 8001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Applied Bio systems
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationDNA Amplification RNA Amplification Real-Time PCR Customized PCR
DNA Amplification RNA Amplification Real-Time PCR Customized PCR Selection Guide Overview AccuPower PreMix series is an innovative PCR master mix product range designed to make your PCR, reverse transcription
More informationSideStep Lysis and Stabilization Buffer
SideStep Lysis and Stabilization Buffer INSTRUCTION MANUAL Catalog #400900 Revision B.0 For Research Use Only. Not for use in diagnostic procedures. 400900-12 LIMITED PRODUCT WARRANTY This warranty limits
More information#K0262 For 1000 reactions of 25 µl Lot Exp.. Store at -20 C in the dark. V
PRODUCT INFORMATION Thermo Scientific Maxima Probe qpcr Master Mix (2X), ROX Solution provided #K0262 For 1000 reactions of 25 µl Lot Exp.. Store at -20 C in the dark. V CERTIFICATE OF ANALYSIS The absence
More informationPCR OPTIMIZATION AND TROUBLESHOOTING
PCR OPTIMIZATION AND TROUBLESHOOTING Amplification of each DNA fragment can occur only under the defined conditions which are provided by a reaction mixture. If no positive PCR result can be obtained,
More informationQuantitative Real time PCR. Only for teaching purposes - not for reproduction or sale
Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP
More information3C bioscience. ProbeSure Genotyping Master Mix User Guide. P a g e 1 ProbeSure User Guide v1.0
3C bioscience r ProbeSure Genotyping Master Mix User Guide P a g e 1 www.3crbio.com ProbeSure User Guide v1.0 Content: 1. Product details 2. Description 3. Storage and shelf Life 4. Safety warnings and
More informationBio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
More information3 r. ProbeSure Genotyping Master Mix User Guide. Cbioscience. Page 1 ProbeSure User Guide v1.4
3 r Cbioscience User Guide Page 1 www.3crbio.com User Guide v1.4 Content: 1. Product details 2. Description 3. Storage and shelf life 4. Safety warnings and precautions 5. Kit components 6. ROX compatibility
More informationSunScript One Step RT-PCR Kit
SunScript ONE STEP R T-PCR KIT HANDBOOK SunScript One Step RT-PCR Kit INDEX Legal... 4 Intended use... 4 Kit contents... 5 Shipping and storage... 5 Handling... 6 Quality control... 6 Reagents and equipment...
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationInsights from the first RT-qPCR based human transcriptome profiling based on wet lab validated assays
Slide 1 of 38 Insights from the first RT-qPCR based human transcriptome profiling based on wet lab validated assays Jan Hellemans, PhD CEO Biogazelle qpcr & NGS 2013 Freising, Germany March 19, 2013 Biogazelle
More informationMolecular Workshop. Shane Byrne Sheryl Maher
Molecular Workshop Shane Byrne Sheryl Maher Overview Background Molecular Biology Introduction to Southern Blotting and PCR Assay Design Commercial PCR Controls and Validation BREAK Setting Up a Lab Next
More informationPOLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence
POLYMERASE CHAIN REACTION PCR. (Biotechnology and Genetic Engineering) Edemhanria, Lawrence Biochemistry Unit Chemical Sciences Department Samuel Adegboyega University Ogwa, Edo State, Nigeria. Outline
More informationThe GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
More informationncounter Low RNA Input Amplification Kit
ncounter Low RNA Input Amplification Kit The ncounter Low RNA Input Amplification Kit is designed to produce sufficient target for detection in an ncounter hybridization assay. This multiplexed target
More informationSYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
More informationEncycloPCRAmplificationKit 1 Mint-2cDNA SynthesisKit 2 DuplexSpecificNuclease 4 Trimmer-2cDNA NormalizationKit 6 CombinedMint-2/Trimmer-2Package
Contents Page EncycloPCRAmplificationKit 1 Mint-2cDNA SynthesisKit 2 DuplexSpecificNuclease 4 Trimmer-2cDNA NormalizationKit 6 CombinedMint-2/Trimmer-2Package References 8 Schematic outline of Mint cdna
More informationSupplementary Methods
Supplementary Methods SMAP Assay Detailed Protocol I. Technology Description SMAP is a novel gene amplification method with high sensitivity and single-nucleotide precision, enabling rapid detection of
More informationReal-Time PCR Principles and Applications
Real-Time PCR Principles and Applications Dr Esam Ibraheem Azhar (BSc, MSc, Ph.D Molecular Medical Virology) Asst. Prof. Medical Laboratory Technology Department Objectives Real-Time PCR Principles and
More informationTargeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales
Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology
More informationHigh-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population
Research and Development Station for Bovine, Arad, Romania High-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population Daniela Elena Ilie, Ada Cean, Ioan
More informationQuantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)
Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the
More informationGoing MULTI How to Easily Achieve High Multiplexing in Real-Time PCR
qpcr Symposium 2005 - Weihenstephan Going MULTI How to Easily Achieve High Multiplexing in Real-Time PCR Dr. Andreas Missel Associate Director Research & Development Overview Introduction Multiplex real-time
More informationTECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID mcf.2 transforming sequence-like Mcf2l Mouse Description Not Available C130040G20Rik,
More informationSuperReal PreMix Plus (SYBR Green)
SuperReal PreMix Plus (SYBR Green) For fast, quantitative, real-time PCR using SYBR Green www.tiangen.com/en QP120627 SuperReal PreMix Plus (SYBR Green) Cat. no. FP205 Kit Contents Contents 2 SuperReal
More informationCHAPTER 3 DEVELOPMENT OF DENV GROUP SPECIFIC REAL TIME RT-PCR
CHAPTER 3 DEVELOPMENT OF DENV GROUP SPECIFIC REAL TIME RT-PCR 28 Dengue is diagnosed by either detecting virus or antibody to the virus in blood. Isolation of virus in cell culture or in infant mouse brain
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationINTEGRATED DNA TECHNOLOGIES. Products & Services
INTEGRATED DNA TECHNOLOGIES THE CUSTOM BIOLOGY COMPANY Products & Services CUSTOM DNA & RNA Custom DNA Synthesis Synthesis Scale Length (Tubes) (Plates) 25 nmole 15-60 bases.09/base.08/base 100 nmole 10-90
More informationAbsolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions
Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationKAPA HiFi HotStart ReadyMix PCR Kit
KAPA HiFi HotStart ReadyMix PCR Kit KR0370 v10.19 This provides product information and a detailed protocol for the KAPA HiFi HotStart ReadyMix PCR Kit. This document applies to the following kits: 07958919001,
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Color HiGreen Low ROX qpcr Master Mix #K0373 For 1250 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More informationQuant Reverse Transcriptase
1. Quant Reverse Transcriptase For first-strand cdna synthesis and two-step RT-PCR www.tiangen.com RT080530 Kit Contents Quant Reverse Transcriptase Contents Cat. no. ER103 ER103-02 25 rxns ER103-03 50
More informationPolymerase Chain Reaction-361 BCH
Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture
More informationRelative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M reactions
Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More information