Detecting Rare Genomic Copies or Events

Size: px

Start display at page:

Download "Detecting Rare Genomic Copies or Events"

Godwin Floyd
6 years ago
Views:

1 Detecting Rare Genomic Copies or Events Integrated DNA Technologies Nick Downey, PhD

2 Common Diagnostics Challenges Detecting targets early with accuracy Detecting different strains (e.g., antibiotic resistance) Compiling multiplex assays to detect targets 2

MGB Eclipse Probes Are Now Available From IDT GMP production of minor groove binder (MGB) probes and primers For use in human in vitro diagnostic (IVD) applications FAM, HEX, or TET dyes MGB

3 MGB Eclipse Probes Are Now Available From IDT GMP production of minor groove binder (MGB) probes and primers For use in human in vitro diagnostic (IVD) applications FAM, HEX, or TET dyes MGB stabilizes hybridization, which raises the T m of the probe Short functional probes bases can be useful for: Allelic discrimination Designing probes in limited unique sequence space Low complexity AT rich regions 3

4 MGB Eclipse vs. ZEN Fluorescent Signal No Baseline Subtraction With Baseline Subtraction IDT FAM/ZEN IDT MGB IDT FAM/ZEN Competitor MGB IDT MGB Competitor MGB 4

The enzymatic deblocking cleavage event is sensitive to base mismatch and

5 RNase H2 Dependent PCR (rhpcr) Primer deblocking is required for PCR, which in turn requires that primers be annealed to the target DNA sequence. The enzymatic deblocking cleavage event is sensitive to base mismatch and confers added specificity to the ensuing PCR reaction. Primer-dimer formation is highly reduced. 5

6 Biased Amplification vs. Biased Signal Generation F SNP Q F rddddmx SNP As PCR occurs, signal is generated from the degradation of the probe. If multiple targets are present (which occurs in rare allele reactions) signal generation occurs only from the targeted allele, and intensity is lowered proportionally. In biased amplification, only the sequence of interest (red) is amplified, meaning that a single target can be identified in a background containing a high amount of nearly identical DNA (blue). Using this technique, rare alleles can be detected in a background of >1000-fold higher untargeted DNA. 6 Biased signal generation (PrimeTime) Biased amplification (rhpcr)

7 2 rhprimer Designs Are Possible 1st generation (GEN1): rddddmx, good for general purpose GEN1 primers are most appropriate for standard genotyping applications and for multiplexed amplification 2nd generation (GEN2): rdxxdm best specificity, but at a cost higher enzyme amounts required, and will need specific titration to application GEN2 primers are most appropriate for rare-allele detection or for applications where extremely high fidelity of template amplification is desired 7

8 GEN1: For General Purpose Use and Minimizing Primer- Dimer Formation GEN1 primers are most appropriate for standard genotyping applications and multiplexed

8 8 GEN1: For General Purpose Use and Minimizing Primer- Dimer Formation GEN1 primers are most appropriate for standard genotyping applications and multiplexed amplification. This primer design is robust and works well with low levels of RNase H2 enzyme. Mismatch guideline: M base should be the same base as the template strand.

of RNase H2 enzyme (range is 1 100X that needed for GEN1 primers); titration and optimization need

9 GEN2: For Rare Allele Genotyping Most appropriate for rare-allele detection or for applications where extremely high fidelity of template amplification is desired May require use of higher amounts of RNase H2 enzyme (range is 1 100X that needed for GEN1 primers); titration and optimization need to be performed for each GEN2 primer set For simplicity, we recommend use of GEN1 primers for most needs 9

10 Blocked Primers Provide Specificity and Sensitivity Two-step PCR 60 C anneal/extend: 30 sec 95 C melt: 10 sec 2.6 mu RNase H2 Anneal/cleavage/dissociation/polymerase extension can take place in the same timeframe as using unmodified primers and with comparable kinetics. PCR C q values are unchanged. 10 No RNase inhibitor was present in these reactions. Even though these primers have an RNA residue, non-specific cleavage by single-stranded RNases 103 (such bp synthetic as RNase amplicon, A) or alkaline run using hydrolysis 2 x 10 will 6 copies not cause template background signal or false positive amplification For AGCTCTGCCCAAAGATTACCCTG because cleavage by these routes leaves a 3 -phos, which blocks primer function. Rev CTGAGCTTCATGCCTTTACTGT Blocked-For AGCTCTGCCCAAAGATTACCCTGaCAGC-x Blocked-Rev CTGAGCTTCATGCCTTTACTGTuCCCC-x Probe: FAM-TTCTGAGGCCAACTTCCACTGCCACTTA-FQ

11 rhprimers Reduce Primer Dimer Events in HCV Assay Typically, intelligent primer design can reduce the incidence of primer-dimers and false priming events. Nevertheless, these unwanted events still occur. Sometimes, it is necessary to design primers to specific sequences as dictated by the target sequence available. This HCV assay was cited in a Roche patent (US ) relating to the problem of primer-dimer formation. Blocked primers and RNase H2 solved the problem of primer-dimer formation. 11

12 HCV Subtype 1b qpcr Assay ST280A: GCAGAAAGCGTCTAGCCATGGCGTTA ST280A rgd4 SpC3: GCAGAAAGCGTCTAGCCATGGCGTTAgTATG-x ST778AA: GCAAGCACCCTATCAGGCAGTACCACAA ST778AA rgd4 SpC3: GCAAGCACCCTATCAGGCAGTACCACAAgGCCT-x 12 Hepatitis C virus subtype 1b amplicon (242 bp): gcagaaagcgtctagccatggcgttagtatgagtgtcgtgcagcctccaggaccccccctcccgggagagccatagtggtctgcgga accggtgagtacaccggaattgccaggacgaccgggtcctttcttggactaaacccgctcaatgcctggagatttgggcgtgccccc gcgagactgctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatagggtgcttgc Cloned synthetic target 0 or 2.6 mu RNase H2 +/ Rat cdna

rhpcr Provides Specific Amplification Product in HCV Subtype 1b qpcr Assay 250 150 100 50 Primers alone Minus RNase H2 Plus RNase H2 - - - - + + - - - - + + Rat cdna - - + + + + - - + + + + Target U

13 rhpcr Provides Specific Amplification Product in HCV Subtype 1b qpcr Assay Primers alone Minus RNase H2 Plus RNase H Rat cdna Target U B U B U B U B U B U B True Positive Primer dimers 25 Primers 13 Unmodified primers gave the same false products with or without target. Only blocked primers + RNase H2 correctly gave true positive products.

14 Second Generation (GEN2) Cleavable Primer Designs Improve Specificity for SNP Assays First generation (GEN1) primer design: CAGCCTCATCCAAAAGAGGAAAcAGGAM-x DDDDMx primers Second generation (GEN2) primer design: CAGCCTCATCCAAAAGAGGAAAcAxxAM DxxDM primers Non-nucleotide groups make cleavage less efficient, but more specific. Mismatch guideline: M base should be the same base as the template strand 14

15 rhpcr SNP Assay for SMAD7 (GEN1 vs. GEN2) 15

16 Detection of Rare Variants in a Mixed Sample Genomic DNAs homozygous for the 2 SMAD7 alleles were mixed at different ratios to determine the limit of detection of the rare allele in a mixed sample. 16 Input mismatch SNP Input match SNP Control (unmodified) :1000 1:10, rc-aggax rc-axxa ru-aggax ru-axxa New, second generation cleavable primers are able to distinguish the presence of 1:10,000 of the match allele in a large background of the mismatch allele. 1:100

17 Looking Deeper... Sometimes, looking at individual SNPs does not provide enough information about the sample. Next generation sequencing may be a better option. But whole sample sequencing can lead to bandwidth problems xgen Lockdown Probes provide a robust target capture system. Each oligo individually QC ed by ESI Flexibility in scale of synthesis and probe number Fast turnaround time Capture protocol available online Platform agnostic 17

18 18 How Target Capture Works

19 Probe Performance and Validation Design of T m Experiment 1, 3, or 7 bp (All T) 7 bp (All T or All C) 7 bp (All T or All C) Top strand = 121, 123, or 127 bp respectively Top strand = 134 bp 120 bp 120 bp 1 bp mismatch (G-T or T-T) 120 bp 120 bp 120 bp Ultramer Oligonucleotides had either 1, 3, or 7 G-T or T-T mismatches 120 bp 19

20 Probe Performance And Validation Conclusions 1 7 base mismatches had <5 C ΔTm 1 or base insertions had <4 C ΔTm These small changes in Tm will not affect capture Thus use of a 120mer capture probe is sufficient 20

21 xgen Lockdown Probes Rescue Panel Dropout 21

22 xgen Lockdown Probes Improve Coverage and Uniformity 22 # Reads Data from Foundation Medicine comparing results of a large set of IDT xgen Lockdown Probes with a focused Agilent SureSelect set IDT xgen Lockdown Probes: 100% >150X coverage Agilent SureSelect set: 80.7% >150X coverage

23 Case Study: Detecting and Typing Hepatitis C Compare HiSeq runs to see if xgen Lockdown probes can enrich for viral sequences. Look at how robust a panel might be in analyzing different strains. Attempt second round of design to create a more robust panel. 23

24 xgen Lockdown Probes Successfully Capture Viral DNA 24

25 A Single Panel Can Provide Data for Different Strains Case: Sample is identical to probes Case: Sample has same sub-genotype Case: Sample has different sub-genotype Case: Sample has different genotype 25 Read depth from a MiSeq run Identity of the probe sequences to the sample

26 Supplementing with xgen Lockdown Probes Improves Coverage of Low Identity Regions 26

27 Online Order Tool Allows Custom Solutions We offer several input options: For human, mouse, and rat we can process gene symbols or RefSeq IDs For other species we can process FASTA format sequence We recommend 1X tiling and probe length of 120 bases for most designs 27

28 Blocking Oligos Function Two classes of blocking oligos are needed: I. Cot1 DNA to block Alu, LINE repeat elements II. Oligonucleotide blocking oligos to block linkers/adapters 28

29 29

30 Slides to help answer questions (not shared with customers) 30

31 Percent Cleaved Detergent is ESSENTIAL for Robust P. abyssi RNase H2 Activity Percent detergent in reaction Triton-X-100 Tween-20 Tween-80 Ctab N-Lauroyl sarcosinate CTCGTGAGGTGATGcAGGAGATGGGAGGCG-3 3 -GAGCACTCCACTACGTCCTCTACCCTCCGC-5 0.1% Triton X-100 is present in dilution buffer and also in storage buffer

32 P. abyssi RNase H2 Is Only Active at Elevated Temperatures P-CTCGTGAGGTGATGcAGGAGATGGGAGGCG 3 3 GAGCACTCCACTACGTCCTCTACCCTCCGC 5

33 P. abyssi RNase H2 is Active Across a Broad Range of Mg 2+ levels Usually 3 mm Mg 2+ is recommended P-CTCGTGAGGTGATGcAGGAGATGGGAGGCG 3 3 GAGCACTCCACTACGTCCTCTACCCTCCGC 5

34 Pyrococcus abyssi RNase H2 is Very Thermostable 34 The enzyme can be incubated at 95 C for >45 minutes with little loss of activity. The enzyme will survive thermal cycling (e.g., PCR reactions).

35 Why Do We Use Pyrococcus abyssi RNase H2 Pyrococcus abyssi RNase H2 is very thermostable. The RNase H2 enzyme is inactive at low temperature. Hot start is achieved without need for a modified hot start polymerase. The enzyme is active across a wide range of magnesium concentrations, including concentrations commonly used in PCR. Most RNase enzymes cleave to leave a 3 Phosphate. P. abyssi RNase H2 cleaves to leave a 3 OH 35

Application guide for rhpcr

Application guide for rhpcr rhpcr Primers Description Terminal bases* Synthesis scale Purification rhprimer GEN1 rddddmx 100 nmol rhprimer GEN2 rdxxdm 100 nmol Standard desalting RNase H2 Enzyme and Buffer