sides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer
|
|
- Jordan Perkins
- 6 years ago
- Views:
Transcription
1 Supplemental Data. Gómez et al. (2009). The maize transcription factor MRP-1 (Myb-Related-Protein-1) is a key regulator of the differentiation of transfer cells. Supplemental Figure 1. Expression analyses of the AL-9 gene. A, the promoter of the AL-9 gene directs the expression of the GUS reporter to the aleurone layer (at 25 DAP in the image). Note that the promoter activity labels the upper, adgerminal and abgerminal sides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer (BETL). B, An antisense AL-9 probe labels the aleurone cells at the abgerminal side of the kernel, in this case at 16 DAP. Cells of the BETL do not express AL-9 and the expression of the BETL marker BETL-9 (C) is perfectly complementary to that of AL-9. SE, starchy endosperm; Em, embryo; PCH, placento-chalaza. Bars indicate 4 mm in A and 300 μm in B and C. 1
2 Supplemental Figure 2. Interpretation of the transformation of endosperm epithelial cells into transfer cells, induced by the expression of MRP-1. The basal membrane of this epithelium is indicated by a green bar. The figures are orientated so that the upper and basal sides of the endosperm coincide with the upper and lower sides of the diagram. The aleurone layer (A, gray cells) covers all the endosperm surface except for the basal part, where cells facing the maternal phloem terminals differentiate into several layers of TCs (C, dark blue cells). The BETL cells are longer than aleurone cells and appear densely covered by CWIs, especially, but not only, on the basal side. The expression of MRP-1 at the abgerminal region of the aleurone (B) transforms aleurone cells into TCs (light blue), which are also elongated and develop CWIs, although to a lesser extent than in the cells of the BETL. The yellow cells in A, B and C represent starchy endosperm cells; these are round and much larger than the epithelial cells due to the endo-reduplication process they undergo. 2
3 Supplemental Figure 3. The ectopic expression of MRP-1 induces the expression of BETL-1. Immunodetection of BETL-1 (black color, greyish in areas that accumulate less protein) in both the BETL (A) and the EETL (B) in a 12 DAP transgenic seed. BETL-1 is produced in the transfer cells and EETL, and also accumulates, although to a lesser extent than BETL-2, in the adjacent maternal tissue. Pd, pedicel. Bars indicate 50 μm. 3
4 Supplemental Figure 4. Reduced expression of MRP-1 in the abgerminal aleurone at 17 DAP. A, B, Expression analyses of MRP-1 in the abgerminal region of 17 DAP transgenic (A) or non-transgenic (B) sibling kernels using a MRP-1 antisense probe. The bright spots concentrating at the external cell layer in A indicate accumulation of the transcript in the otherwise morphologically normal aleurone cells. The expression level is reduced as compared with that observed at earlier developmental stages; compare A with Figure 1C and Figure 1D in the manuscript. Bars denote 50 m. 4
5 Supplemental Figure 5. Morphological analysis of the mature endosperm epidermis. ProAL-9:MRP-1 transgenic (A, B, C) and non-transgenic (D, E, F) mature kernels were imbibed for 72 hours, fixed and wax-embedded. A, D, The transfer cell layer (TCL) appears to be nearly obliterated between the embryo (Em) and the placentochalaza (PCH) in all cases. B, E, the abgerminal aleurone (Al) showing slightly elongated aleurone cells. C, F, Images of the upper part of the kernel with a typical aleurone layer formed by a single layer of cubic cells. Sections were stained with azure-b. P, pericarp; SE, starchy endosperm. Bars indicate 500 μm. 5
6 Supplemental Figure 6. The presence of the MRP-1 coding sequence decreases the expression efficiency of reporter constructs in transient expression experiments. ProAL-9:GUS (A, C), ProAL-9:MRP1:GUS (B, D) or ProMRP-1:GUS constructs (E) were used to transiently transform sagitally dissected 10 DAP maize kernels (A, B) or the abaxial surface of immature V. faba cotyledons (C, D, E) by particle bombardment. Tissues were then histochemically assayed for GUS activity. Experimental details: Comparisons were made of the expression of constructs containing either the GUS reporter gene or a fusion MRP-1:GUS coding sequence (both under the control of the AL- 9 promoter) in biolistically-transformed 10 DAP maize kernels. As expected, the ProAL- 6
7 9:GUS construct labeled the aleurone layer intensively and exclusively (mean number of spots per section 7.35±0.92) in sagittally dissected maize kernels (A). The construct expressing the fusion protein MRP-1:GUS from the AL-9 promoter produced significantly fewer spots per kernel (1.2±0.57, B), but again, exclusively in the aleurone cells. These results suggest that the presence of the MRP-1 coding sequence reduces either the stability or the translation of the whole MRP-1:GUS transcript in aleurone cells. Alternatively, this particular construct might not be efficiently expressed (a non-obvious design problem), or the fusion protein it encodes might have reduced enzymatic activity compared to the GUS protein alone. To test these possibilities, both constructs were introduced into the abaxial epidermis of Vicia faba cotyledons by biolistic bombardment. The abaxial epidermis consists of TCs (Offler et al., 1997; Weber et al., 1997) able to express the MRP-1 promoter (E) but also the AL-9 promoter (albeit at a lower level) (compare C and D with E). In this system, ProAL-9:GUS (C) and ProAL-9:MRP-1:GUS (D) produced equivalent results in terms of the number of spots per section, and both constructs yielded a similar spotting pattern to that obtained with the promoter of MRP-1 fused to the reporter gene (E). This indicates that the ProAL-9:MRP-1:GUS construct is efficiently processed and translated into an active GUS protein in cotyledon epithelial TCs capable of expressing the MRP-1 promoter (which has been shown to be TC-specific [Barrero et al., 2009]). 7
8 Supplemental Figure 7. Expression analyses in miniature-1 and wild-type kernels Real time RT-PCR expression analyses of MRP-1, the transfer cell specific gene BETL-1 and the aleurone marker AL-9 in RNA extracted from miniature-1 mutant kernels (min-1) or wild-type kernels (WT) at the indicated developmental stages. Relative expression levels refer to the expression level of BETL-1 in wild-type kernels at 11 DAP. Values are means + SD of two technical replicates. 8
9 Supplemental Figure 8. Expression pattern of the aleurone marker gene AL-9 in young kernels. A, B, wild-type maize seed sections at 3 DAP (A) or 6 DAP (B) were reacted with an antisense riboprobe for AL-9. Note the absent (A) or weak (B) hybridization signals obtained with this aleurone-specific marker on the abgerminal side of the endosperm. AB, abgerminal, Em, embryo; BETL, basal endosperm transfer cell layer. Bars denote 0.5 mm in A and 1 mm in B. 9
10 Supplemental Figure 9. A model explaining how maternal signals might be perceived by the abgerminal side of the endosperm during its initial developmental stages. The picture shows the immunolocalization of the BETL-2 protein in a 6 DAP wild-type kernel. The protein is localized in the future TC layer and the corresponding area of the placento-chalaza (brown color). TC development is induced at the base of the endosperm by the expression of MRP-1 (this work), very likely in response to direct induction by maternally produced signals (yellow arrows). A large area of the basal part of the nucellus is exposed to products (red arrows) released from the phloem terminals 10
11 (Ph), and might therefore influence the development of the abgerminal side of the endosperm. Note that the germinal side would not perceive these hypothetical signals. The subsequent growth of the endosperm crushes the nucellus cells and allows the endosperm to completely occupy the basal part of the kernel by DAP; the exposure of the abgerminal side of the endosperm to maternally-derived products would therefore cease. Bar indicates 1mm. 11
12 Supplemental Table 1. Oligonucleotides used for quantitative RT-PCR. Gene Amplicon size (bp) MRP BETL-1 93 BETL BETL TCRR INCW AL ESR-6 90 FKBP Primers (5-3 ) GACTACAGATGAGCACAG*GAATTTC GCATGGCTAGAGATCTGCA CAGCACAATCGTCGCGCTT TTCTTGGGTTTCCCGATGC*AGC TGCACGCACAACAAGTG*GGC AGCATGGCCCGTCGTCATT TCCTTGTGGCCTATCGT*GCG GCTCATGCATGGGCCGTGAT ATTGGAATTCTTAGATGCG*AAC CGATTC*CTTCACTTCCCTAA GACCCTACCAA*GTCGTCCCTGA CGACCGGTCGA*TCAGGCTTC CTATGTTTGCCATAGGCTCTCATGC GCTGGAACCTTGTAGC*TTCCG GCCATAACCATGCCGTCCT TGCAGACGCATCCATTC*CGA GGGTGCTGTTGTTGAAG*TCA GCAATAA*CTTCCTCTTCATCG Expression domain Transfer cells Transfer cells Transfer cells Transfer cells Transfer cells Transfer cells Aleurone Embryo surrounding region Ubiquitous The sequences of the sense and antisense oligonucleotides are indicated along with the size of the resulting amplicon and the target expression domain of the marker. The asterisks denote the position site of introns in the corresponding genomic sequences. 12
Pattern Formation via Small RNA Mobility SUPPLEMENTAL FIGURE 1 SUPPLEMENTAL INFORMATION. Daniel H. Chitwood et al.
SUPPLEMENTAL INFORMATION Pattern Formation via Small RNA Mobility Daniel H. Chitwood et al. SUPPLEMENTAL FIGURE 1 Supplemental Figure 1. The ARF3 promoter drives expression throughout leaves. (A, B) Expression
More informationSupplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
More informationSupplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
More informationFig. S1. Molecular phylogenetic analysis of AtHD-ZIP IV family. A phylogenetic tree was constructed using Bayesian analysis with Markov Chain Monte
Fig. S1. Molecular phylogenetic analysis of AtHD-ZIP IV family. A phylogenetic tree was constructed using Bayesian analysis with Markov Chain Monte Carlo algorithm for one million generations to obtain
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Wang et al., http://www.jcb.org/cgi/content/full/jcb.201405026/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Generation and characterization of unc-40 alleles. (A and
More informationSupplemental Data. Meng et al. (2011). Plant Cell /tpc B73 CML311 CML436. Gaspé Flint
Gaspé Flint B73 CML311 CML436 A B C D 10 th leaf 10 th leaf 10 th leaf Supplemental Figure 1. Whole plant images of the four varieties used in this study (A) Extreme early flowering temperate line Gaspé
More informationSupplemental Figure S1. Validation of auxin-related gene expression from Fig. 1A. Relative gene expression in 2x and 3x seeds 6 days after
Supplemental Figure S1. Validation of auxin-related gene expression from Fig. 1A. Relative gene expression in 2x and 3x seeds 6 days after pollination (6 DAP), as determined by RT-qPCR for YUC10 (A), YUC11
More informationCereal endosperm; lessons learnt from molecular biology, cell biology, genomics and transcriptomics analysis.
Cereal endosperm; lessons learnt from molecular biology, cell biology, genomics and transcriptomics analysis. Odd-Arne Olsen Department of plant sciences Norwegian university of life sciences The cereal
More informationSupplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients
Developmental Cell, Volume 43 Supplemental Information Boundary Formation through a Direct Threshold-Based Readout of Mobile Small RNA Gradients Damianos S. Skopelitis, Anna H. Benkovics, Aman Y. Husbands,
More informationSupplementary Information. c d e
Supplementary Information a b c d e f Supplementary Figure 1. atabcg30, atabcg31, and atabcg40 mutant seeds germinate faster than the wild type on ½ MS medium supplemented with ABA (a and d-f) Germination
More informationSupplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.
Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)
More informationSupplemental Data. Benstein et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,
More informationSupplemental Data. Farmer et al. (2010) Plant Cell /tpc
Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is
More informationA Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
More informationSupplemental Figure 1. Immunoblot analysis of wild-type and mutant forms of JAZ3
Supplemental Data. Chung and Howe (2009). A Critical Role for the TIFY Motif in Repression of Jasmonate Signaling by a Stabilized Splice Variant of the JASMONATE ZIM-domain protein JAZ10 in Arabidopsis.
More informationSupplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
More informationPoly-A signals. amirna. pentr/d-topo for Gateway cloning
popon inducible system A Poly-A signals CaMV 35S minimal promoter TMV omega translational enhancer HYG KAN RR 35S 35S LhGR GUS Ω pop6 Ω Gene construct B - Dex + Dex CACC prs300 (mir319a) CACC amirna pentr/d-topo
More informationSupplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
More informationSupplementary Information. The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato
Supplementary Information The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato Uri Krieger 1, Zachary B. Lippman 2 *, and Dani Zamir 1 * 1. The Hebrew University of Jerusalem Faculty
More informationSupplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
More informationSupplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
More informationJung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
More informationSupplemental Data. Guo et al. (2015). Plant Cell /tpc
Supplemental Figure 1. The Mutant exb1-d Displayed Pleiotropic Phenotypes and Produced Branches in the Axils of Cotyledons. (A) Branches were developed in exb1-d but not in wild-type plants. (B) and (C)
More informationSupplemental Fig. 1. Mcr alleles show defects in tracheal tube size and luminal protein accumulation. (A-F) Confocal projections of living stage 15
Supplemental Fig. 1. Mcr alleles show defects in tracheal tube size and luminal protein accumulation. (A-F) Confocal projections of living stage 15 embryos expressing GFP and Verm-RFP in tracheal cells
More informationSupplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
More informationSperm cells are passive cargo of the pollen tube in plant fertilization
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 17079 Sperm cells are passive cargo of the pollen tube in plant fertilization Jun Zhang 1, Qingpei
More informationSupplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
More informationSupplemental Materials
Supplemental Materials Flores-Pérez et al., Supplemental Materials, page 1 of 5 Supplemental Figure S1. Pull-down and BiFC controls, and quantitative analyses associated with the BiFC studies. (A) Controls
More informationSupplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
More informationNature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
More informationSUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Ihh interacts preferentially with its upstream neighboring gene Nhej1. Genes are indicated by gray lines, and Ihh and Nhej1 are highlighted in blue. 4C seq performed in E14.5 limbs
More informationSupplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis seedlings expressing ERF109pro-GUS. The GUS staining
More informationSupplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding
Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding sites in the G1 domain. Multiple sequence alignment was performed with DNAMAN6.0.40. Secondary structural
More informationSupplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice.
Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice. A B Supplemental Figure 1. Expression of WOX11p-GUS WOX11-GFP
More informationSupplemental Data. Liu et al. (2013). Plant Cell /tpc
Supplemental Figure 1. The GFP Tag Does Not Disturb the Physiological Functions of WDL3. (A) RT-PCR analysis of WDL3 expression in wild-type, WDL3-GFP, and WDL3 (without the GFP tag) transgenic seedlings.
More informationSupplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationS156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
More informationSupplemental Data. Dai et al. (2013). Plant Cell /tpc Absolute FyPP3. Absolute
A FyPP1 Absolute B FyPP3 Absolute Dry seeds Imbibed 24 hours Dry seeds Imbibed 24 hours C ABI5 Absolute Dry seeds Imbibed 24 hours Supplemental Figure 1. Expression of FyPP1, FyPP3 and ABI5 during seed
More information7.012 Problem Set 5. Question 1
Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much
More information(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the
Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark
More informationFigure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for t
Figure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for the pcloa genes of zebrafish, green spotted puffer (listed
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationSupplemental Data. Bai et al. Plant Cell. (2012) /tpc A
A B Unconserved Conserved AIF4 AIF2 AIF3 AIF1 UPB1 IBH1 Supplemental Figure 1. IBH1, UPB1 and AIFs belong to the same HLH family. (A), Part of a phylogenetic tree constructed using conserved domains shows
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationA CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish
Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationRevised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
More informationSupplemental Information
Supplemental Information Supplemental Figure 1. The Heterologous Yeast System for Screening of Arabidopsis JA Transporters. (A) Exogenous JA inhibited yeast cell growth. Yeast cells were diluted to various
More informationSupplemental Figure 1. Alignment of the NbGAPC amino acid sequences with their Arabidopsis homologues.
Supplemental Figure 1. Alignment of the NbGAPC amino acid sequences with their Arabidopsis homologues. Homologs from N. benthamiana (NbGAPC1, NbGAPC2, NbGAPC3), Arabidopsis (AtGAPC1, AT3G04120; AtGAPC2,
More information1. Introduction Drought stress and climate change Three strategies of plants in response to water stress 3
Contents 1. Introduction 1 1.1 Drought stress and climate change 3 1.2 Three strategies of plants in response to water stress 3 1.3 Three closely related species of Linderniaceae family are experimental
More informationSupplemental Materials
Supplemental Materials Supplemental Figure S. Phenotypic assessment of alb4 mutant plants under different stress conditions. (A) High-light stress and drought stress. Wild-type (WT) and alb4 mutant plants
More informationFig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and
Fig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and transgenic Arabidopsis TPL-HA lysates. Immunoblotting of input
More informationSupporting Information
Supporting Information Lu et al. 10.1073/pnas.1106801108 Fig. S1. Analysis of spatial localization of mrnas coding for 23 zebrafish Wnt genes by whole mount in situ hybridization to identify those present
More informationExperimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada
Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationSUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
More informationSupplemental Data. Borg et al. Plant Cell (2014) /tpc
Supplementary Figure 1 - Alignment of selected angiosperm DAZ1 and DAZ2 homologs Multiple sequence alignment of selected DAZ1 and DAZ2 homologs. A consensus sequence built using default parameters is shown
More informationSupplementary Materials
Supplementary Materials Table S1. Oligonucleotide sequences and PCR conditions used to amplify the indicated genes. TA = annealing temperature; gdna = genomic DNA; cdna = complementary DNA; c = concentration.
More informationABI3 Controls Embryo De-greening Through Mendel's I locus
Supporting Online Material for ABI3 Controls Embryo De-greening Through Mendel's I locus Frédéric Delmas a,b,c, Subramanian Sankaranarayanan d, Srijani Deb d, Ellen Widdup d, Céline Bournonville b,c,norbert
More informationSupplemental Data. Wang et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Time-Course Analysis of Storage Proteins during Endosperm Development of the Wild-type 9311 and the gpa4-1 Mutant. (A) SDS-PAGE analyses of seed storage proteins during wild-type
More informationSupplemental Data. Tang et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. Relative Pchlide Fluorescence of Various Mutants and Wild Type. Seedlings were grown in darkness for 5 d. Experiments were repeated 3 times with same results. Supplemental Figure
More informationSupplemental Data. Tilbrook et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of with. Identical aligned residues highlighted in black and similar and non-similar residues highlighted in grey and white, respectively. Position of Trp residues
More informationSupplemental Data. Huo et al. (2013). Plant Cell /tpc
Supplemental Data. Huo et al. (2013). Plant Cell 10.1105/tpc.112.108902 1 Supplemental Figure 1. Alignment of NCED4 Amino Acid Sequences from Different Lettuce Varieties. NCED4 amino acid sequences are
More informationSite directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha
Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations
More informationSupplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type,
Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type, phya-201, phyb-5, phya-201 phyb-5, eid3, phya-201 eid3, phyb-5
More informationSupplemental Data. Seo et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of ABD1 from other model organisms. The alignment was performed with H. sapiens DCAF8, M. musculus DCAF8 and O. sativa Os10g0544500. The WD40 domains are underlined.
More informationi-stop codon positions in the mcherry gene
Supplementary Figure 1 i-stop codon positions in the mcherry gene The grnas (green) that can potentially generate stop codons from Trp (63 th and 98 th aa, upper panel) and Gln (47 th and 114 th aa, bottom
More informationWiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.
A WiscDsLox8 ATG < > -9 +0 > ---------//----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and
More informationSupplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 )
Supplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 ) homologous recombination arm (left) and of the right (3 )
More informationConstruction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
More informationPIE1 ARP6 SWC6 KU70 ARP6 PIE1. HSA SNF2_N HELICc SANT. pie1-3 A1,A2 K1,K2 K1,K3 K3,LB2 A3, A4 A3,LB1 A1,A2 K1,K2 K1,K3. swc6-1 A3,A4.
A B N-terminal SWC2 H2A.Z SWC6 ARP6 PIE1 HSA SNF2_N HELICc SANT C pie1-3 D PIE1 ARP6 5 Kb A1 200 bp A3 A2 LB1 arp6-3 A4 E A1,A2 A3, A4 A3,LB1 K1,K2 K1,K3 K3,LB2 SWC6 swc6-1 A1,A2 A3,A4 K1,K2 K1,K3 100
More informationSupplemental Data. Wang et al. Plant Cell. (2013) /tpc
SNL1 SNL Supplemental Figure 1. The Expression Patterns of SNL1 and SNL in Different Tissues of Arabidopsis from Genevestigator Web Site (https://www.genevestigator.com/gv/index.jsp). 1 A 1. 1..8.6.4..
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09861 & &' -(' ()*+ ')(+,,(','-*+,&,,+ ',+' ' 23,45/0*6787*9:./09 ;78?4?@*+A786?B- &' )*+*(,-* -(' ()*+ ')(+,,(','-*+,&,,+ ',+'./)*+*(,-*..)*+*(,-*./)*+*(,-*.0)*+*(,-*..)*+*(,-*
More informationSupplemental Data. Wu and Xue (2010). Plant Cell /tpc
Supplemental Data. Wu and Xue (21). Plant Cell 1.115/tpc.11.75564 A P1-S P1-A P2-S P2-A P3-S P3-A P4-S P4-A B Relative expression Relative expression C 5. 4.5 4. 3.5 3. 2.5 2. 1.5 1..5 5. 4.5 4. 3.5 3.
More informationTwo classes of silencing RNAs move between Caenorhabditis elegans tissues.
Two classes of silencing RNAs move between Caenorhabditis elegans tissues. Antony M Jose, Giancarlo A Garcia, and Craig P Hunter. Supplementary Figures, Figure Legends, and Tables. Supplementary Figure
More informationSupplemental Figure S1. Nucleotide and deduced amino acid sequences of pepper CaHSP70a (Capsicum annuum heat shock protein 70a) cdna.
Supplemental Figure S1. Nucleotide and deduced amino acid sequences of pepper (Capsicum annuum heat shock protein 70a) cdna. Translation initiation codon is shown in bold typeface; termination codon is
More informationSupplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
More informationChinese Academy of Sciences, Datun Road, Chaoyang District, Beijing, 10101, China
SUPPLEMENTARY INFORMATION Title: Bi-directional processing of pri-mirnas with branched terminal loops by Arabidopsis Dicer-like1 Hongliang Zhu 1,2,3, Yuyi Zhou 1,2,4, Claudia Castillo-González 1,2, Amber
More informationAlternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
More informationResearch Advances in the Development of Transgenic and Gene Edited Products in Sri Lanka
Research Advances in the Development of Transgenic and Gene Edited Products in Sri Lanka Dr. Pradeepa C.G. Bandaranayake Director, Agricultural Biotechnology Centre Faculty of Agriculture University of
More informationErhard et al. (2013). Plant Cell /tpc
Supplemental Figure 1. c1-hbr allele structure. Diagram of the c1-hbr allele found in stocks segregating 1:1 for rpd1-1 and rpd1-2 homozygous mutants showing the presence of a 363 base pair (bp) Heartbreaker
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
More information- PDI5. - Actin A 300-UTR5. PDI5 lines WT. Arabidopsis Chromosome 1. PDI5 (At1g21750) SALK_ SALK_ SALK_015253
Supplemental Data. Ondzighi et al. (2008). Arabidopsis Protein Disulfide Isomerase-5 Inhibits ysteine Proteases During Trafficking to Vacuoles Prior to Programmed ell Death of the dothelium in Developing
More informationSupplementary Information
Supplementary Information MicroRNA-212/132 family is required for epithelial stromal interactions necessary for mouse mammary gland development Ahmet Ucar, Vida Vafaizadeh, Hubertus Jarry, Jan Fiedler,
More informationTo investigate the heredity of the WFP gene, we selected plants that were homozygous
Supplementary information Supplementary Note ST-12 WFP allele is semi-dominant To investigate the heredity of the WFP gene, we selected plants that were homozygous for chromosome 1 of Nipponbare and heterozygous
More informationAD-FIL AD-YAB2 -2 BD-JAZ3 AD-YAB3 AD-YAB5 AD-FIL -4 3AT BD-JAZ3 AD-YAB3
3 4 9 10 11 12 AD-FIL AD-YAB5 2 B AD-YAB3 1 BD-JAZ 5 6 7 8 AD-FIL A AD-YAB2 Supplemental Data. Boter et al. (2015). Plant Cell 10.1105/tpc.15.00220 BD AD-YAB2-2 -2 BD-JAZ3 AD-YAB3 BD AD-YAB5-4 AD-FIL -4
More informationTRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:
TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene
More informationA Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast. Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice Fei Chen 1,*, Guojun Dong 2,*, Limin Wu 1, Fang Wang 3, Xingzheng
More informationSupplementary Information. Isl2b regulates anterior second heart field development in zebrafish
Supplementary Information Isl2b regulates anterior second heart field development in zebrafish Hagen R. Witzel 1, Sirisha Cheedipudi 1, Rui Gao 1, Didier Y.R. Stainier 2 and Gergana D. Dobreva 1,3* 1 Origin
More informationAD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between
AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1
More informationSupplementary Figure 1. Comparison of nodules from Gifu and epr3-9 plants inoculated with M. loti MAFF and incubated at 21 C or 28 C.
Supplementary Figure 1. Comparison of nodules from Gifu and epr3-9 plants inoculated with M. loti MAFF303099 and incubated at 21 C or 28 C. (a to l) are at 21 C, and (m to å) are at 28 C. (a, e, i, m,
More informationIntegrated Omics Study Delineates the Dynamics of Lipid Droplets in Rhodococcus Opacus PD630
School of Natural Sciences and Mathematics 2013-10-22 Integrated Omics Study Delineates the Dynamics of Lipid Droplets in Rhodococcus Opacus PD630 UTD AUTHOR(S): Michael Qiwei Zhang 2013 The Authors This
More informationSupplemental Data. Jing et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Characterization of epp1 Mutants. (A) Cotyledon angles of 5-d-old Col wild-type (gray bars) and epp1-1 (black bars) seedlings under red (R), far-red (FR) and blue (BL) light conditions,
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationB. Transgenic plants with strong phenotype (%)
A. TCTAGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT AAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATATGG 2XP35S STTM165 5 GGGGGATGAAGctaCCTGGTCCGA3 3 CCCCCUACUUC---GGACCAGGCU5 mir165 HindIII mir165 96 nt GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationSupplementary information
Supplementary information Supplementary figures Figure S1 Level of mycdet1 protein in DET1 OE-1, OE-2 and OE-3 transgenic lines. Total protein extract from wild type Col0, det1-1 mutant and DET1 OE lines
More information