Friday, June 12, 15. Biotechnology Tools
|
|
- Georgina Higgins
- 6 years ago
- Views:
Transcription
1 Biotechnology Tools
2 Biotechnology: Tools and Techniques Science of biotechnology is based on recombining DNA of different organisms of another organism. Gene from one organism spliced into genome of another organism Biotechnology relies on three (3) naturally occuring classes of molecules that cut and splice genes 1. Restriction Endonucleases 2. Methylases 3. DNA ligase
3 Biotechnology: Tools and Techniques 1. Restriction Endonucleases Also known as restriction enzymes, these are molecular scissors that can cut double stranded DNA at specific base-pair sequences Each restriction enzyme recognizes a specific sequence of nucleotides known as a recognition site Most recognition sites are 4-8 nucleotides in length and are usually complimentary palindromic sequences What is a palindrome? radar radar kayak kayak madam madam
4 Table 1. List of Restriction Enzymes and Respective Recognition Sites Microorganism of Origin Escherichia coli Serratia marcescens Arthobacter luteus Streptomyces albus Haemophilus parainfluenae Sticky ends Enzyme Recognition Site After Restriction Enzyme Digestion EcoRI 5 -GAATTC CTTAAG G AATTC CTTAA G- 5 SmaI 5 -GGGCCC CCCGGG GGG 3 -CCC AluI 5 -AGCT TCGA AG 3 -TC SalI 5 -GTCGAC CAGCTG G TCGAC CAGCT G- 5 HindIII 5 -AAGCTT TTCGAA A AGCTT TTCGA A- 5 short single stranded overhangs can be easily rejoined (annealled) Blunt ends CCC- 3 GGG- 5 CT- 3 GA- 5 no single stranded overhangs make segments difficult to anneal
5 Biotechnology: Tools and Techniques 2. Methylases One of roles of restriction enzymes in bacteria is to protect them from infection by viruses Bacteriophage (virus) viral DNA E. coli bacterium Virus injects its own DNA into bacterium in order to reproduce restriction enzyme EcoRI Bacterial DNA
6 Biotechnology: Tools and Techniques 2. Methylases One of roles of restriction enzymes in bacteria is to protect them from infection by viruses viral DNA fragments Bacteriophage lacking DNA E. coli bacterium Restriction enzyme is able to cut up viral DNA before it infects bacterial DNA
7 Biotechnology: Tools and Techniques 2. Methylases One of roles of restriction enzymes in bacteria is to protect them from infection by viruses Enzymes are able to add a methyl side group (-CH3) to specific recognition sites Site changes shape - blocking action of restriction enzyme Group of enzymes called methylases are able to protect bacterial DNA
8 Biotechnology: Tools and Techniques 3. DNA ligase DNA ligase is used to rejoin phosphodiester bonds that were broken by restriction enzyme They can take a gene which has been cut-out of one organism and splice it into DNA of another DNA ligase works best when sticky ends are available
9 Bacteria have a large circular chromosome as well as many smaller circular structures called plasmids Plasmids are an important tool in gene splicing 1 µm
10 Human cell Gene Splicing to Produce Insulin Restriction enzyme must be specially chosen to cut on either side of insulin gene Insulin gene DNA 1. Human DNA cut into fragments using restriction enzyme Many fragments made, but one will have insulin gene
11 Gene Splicing to Produce Insulin complimentary ends Using same restriction enzyme means that plasmids and fragments have complimentary ends Antibiotic resistance gene is important for a later process Antibiotic resistance gene 1. Human DNA cut into fragments using restriction enzyme Many fragments made, but one will have insulin gene 2. Plasmids are cut with same restriction enzyme as in step1 Plasmids also contain antibiotic resistance gene
12 Some recombinant plasmids will contain insulin gene, and some will not 3. Mix DNA fragments, cut plasmids and DNA ligase, to produce recombinant DNA plasmids
13 Gene Splicing to Produce Insulin 4. Through transformation, recombinant plasmids enter bacterial cells As bacteria divide, billions of copies of recombinant plasmids are made Some of these bacteria will make insulin
14 Gene Splicing to Produce Insulin Hybridization requires colonies to be antibiotic resistant 5. Process called hybridization is used to identify bacterial colonies that produce insulin These colonies will be isolated and given optimal conditions needed for producing large quantities of insulin
Biotechnology: Tools and Techniques
Biotechnology Tools The science of biotechnology is based on recombining the DNA of different organisms. That is, a gene from one organism is spliced into the genome of another organism. Biotechnology
More informationBiology Teach Yourself Series Topic 12: Molecular Biology (Unit 4)
TSSM 2017 Page 1 of 7 Biology Teach Yourself Series Topic 12: Molecular Biology (Unit 4) A: Level 14, 474 Flinders Street Melbourne VIC 3000 T: 1300 134 518 W: tssm.com.au E: info@tssm.com.au TSSM 2017
More informationRestriction Endonucleases, (Cutting DNA) (Ligation) Ligase & Phosphatase
Restriction Endonucleases, (Cutting DNA) (Ligation) Ligase & Phosphatase Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine
More informationAmira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Restriction Endonucleases, (cutting dna) (ligation)
More informationGene Splicing and Restriction Maps
Gene Splicing and Restriction Maps Bacteria have a large circular chromosome as well as many smaller circular structures called plasmids. These plasmids are an important tool in gene splicing. 1 µm Bacteria
More informationBiotechnology (Chapter 20) Objectives
Biotechnology (Chapter 20) Objectives Understand the background science behind the technology applications Understand the tools and details of the technology Develop familiarity with performing the select
More informationMolecular Biology (2)
Molecular Biology (2) Restriction endonucleases, RFLP, and gene cloning Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp 120-124 Endonucleases Enzymes that degrade DNA within
More informationRestric(on enzymes IMBB 2013
Restric(on enzymes IMBB 2013 This presenta(on was adapted from h6p://ppge.ucdavis.edu/ h6p://web.fuhsd.org/pamela_chow/apbio/unit %20resources/unit_2_2012.html Restric(on Enzymes: Molecular Scissors Restric(on
More informationMCB 150: The Molecular and Cellular Basis of Life
MCB 150 The Molecular and Cellular Basis of Life Plasmids and Genetic Engineering I Today s Learning Catalytics Session ID is: 20000966 1 Announcements: Check gradebook for discrepancies by Wednesday at
More informationExploring DNA. Copying DNA in a laboratory the polymerase chain reaction
Exploring DNA Scientists can not explore and manipulate DNA Copying DNA in a laboratory the polymerase chain reaction Use DNA to reveal its owner s identity DNA profiling and mapping DNA by finding where
More informationOverview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
More informationLesson 1 Introduction to Restriction Analysis
Lesson 1 Introduction to Restriction Analysis Consideration 1. How Does DNA Become Fragmented Into Pieces? DNA consists of a series of nitrogenous base molecules held together by weak hydrogen bonds. These
More informationAP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants
What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics
More informationMolecular Cloning. Restriction Enzymes and Ligases
Tools in Genetic engineering The science of using living systems to benefit humankind is called biotechnology. Technically speaking, the domestication of plants and animals through farming and breeding
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationCHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,
More informationHow Can Pieces of DNA Solve a Puzzle?
Introduction How Can Pieces of DNA Solve a Puzzle? One of the basic tools of modern biotechnology is DNA splicing: cutting DNA and linking it to other DNA molecules. The basic concept behind DNA splicing
More information4. Analysing genes II Isolate mutants*
.. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual
More informationNOTES - CH 15 (and 14.3): DNA Technology ( Biotech )
NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationRecombinant DNA, Biotechnology, and Microbes. Microbiology 221
Recombinant DNA, Biotechnology, and Microbes Microbiology 221 Overview Putting microbes to Work Molecular Cloning Recombinant DNA technology utilizes the power of microbiological selection and screening
More informationLAB : CLONING PAPER PLASMID AAATCGTTTGC. GGATCGAAAGC. Ms Foglia AP Biology
LAB : CLONING PAPER PLASMID In this exercise you will use paper to simulate the cloning of a gene from one organism into a bacterial plasmid using a restriction enzyme digest. The plasmid (puc18 plasmid)
More informationMolecular Scissors: Lambda Digest Student Materials
Molecular Scissors: Lambda Digest Student Materials Introduction 2 Pre-Lab Questions. 5 Lab Protocol 6 Data Collection Worksheet. 9 Post-Lab Questions and Analysis.. 10 Plasmid Maps. 13 Last updated: August
More informationBiotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 1 The BIG Questions! How can we use our knowledge of DNA to: " diagnose disease or defect? " cure disease or defect? " change/improve organisms?!
More informationBIOTECHNOLOGY OLD BIOTECHNOLOGY (TRADITIONAL BIOTECHNOLOGY) MODERN BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY.
BIOTECHNOLOGY Biotechnology can be defined as the use of micro-organisms, plant or animal cells or their components or enzymes from organisms to produce products and processes (services) useful to human
More information_ DNA absorbs light at 260 wave length and it s a UV range so we cant see DNA, we can see DNA only by staining it.
* GEL ELECTROPHORESIS : its a technique aim to separate DNA in agel based on size, in this technique we add a sample of DNA in a wells in the gel, then we turn on the electricity, the DNA will travel in
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationChapter 13: Biotechnology
Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,
More informationBiotechnology:Principles and Processes
Biotechnology:Principles and Processes Very Short Answers Questions: 1. Define biotechnology? A: The integration of natural science and organisms, cells, parts thereof, and molecular analogues for products
More informationBIOTECHNOLOGY : PRINCIPLES AND PROCESSES
CHAPTER 11 BIOTECHNOLOGY : PRINCIPLES AND PROCESSES POINTS TO REMEMBER Bacteriophage : A virus that infects bacteria. Bioreactor : A large vessel in which raw materials are biologically converted into
More informationResearchers use genetic engineering to manipulate DNA.
Section 2: Researchers use genetic engineering to manipulate DNA. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the different tools and processes used in genetic
More informationGroup Members: Lab Station: BIOTECHNOLOGY: Gel Electrophoresis
BIOTECHNOLOGY: Gel Electrophoresis Group Members: Lab Station: Restriction Enzyme Analysis Standard: AP Big Idea #3, SB2 How can we use genetic information to identify and profile individuals? Lab Specific
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationLecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.
Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary
More informationPlasmids. BIL 333 Lecture I. Plasmids. Useful Plasmids. Useful Plasmids. Useful Plasmids. ( Transfection ) v Small, circular, double-stranded DNA
BIL 333 Lecture I Plasmids v Small, circular, double-stranded DNA v Exogenous to genome! v Origin of Replication v Marker Gene v ( Reporter Gene ) Plasmids v Marker Gene Changes Phenotype Of Host v (Antibiotic
More informationBiotechnology and DNA Technology
11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare
More informationLecture 22: Molecular techniques DNA cloning and DNA libraries
Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived
More informationBIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
More informationChapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears
Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and
More informationPage 70 Monday December 8, 2014
replication and Monday December 8, 0 Notebook check 8: Page 69, DNA Technology Introduction Worksheet. The process by which a foreign gene is replicated by insertion into a bacterium is called genetic
More informationRFLP: Restriction Fragment Length Polymorphism
RFLP: Restriction Fragment Length Polymorphism RFLP (Restriction Fragment Length Polymorphism) In molecular biology, the term restriction fragment length polymorphism, or RFLP, (commonly pronounced rif-lip
More informationGenomics and Biotechnology
Genomics and Biotechnology Expansion of the Central Dogma DNA-Directed-DNA-Polymerase RNA-Directed- DNA-Polymerase DNA-Directed-RNA-Polymerase RNA-Directed-RNA-Polymerase RETROVIRUSES Cell Free Protein
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationIPLE OF RECOMBINANT DNA TECHNOLOGY
PRINCIP IPLE OF RECOMBINANT DNA TECHNOLOGY DEBBIE S. RETNONINGRUM SCHOOL OF PHARMACY INSTITUT TEKNOLOGI BANDUNG Recombinant DNA Technology 1 REFERENCES 1. Glick, BR and JJ Pasternak, 2003, Molecular Biotechnology:
More informationBasic lab techniques
Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationMolecular Biology: Gene cloning
Molecular Biology: Gene cloning Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. CLONING VECTORS The central component of a gene cloning experiment is the vector or
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationSELECTED TECHNIQUES AND APPLICATIONS IN MOLECULAR GENETICS
SELECTED TECHNIQUES APPLICATIONS IN MOLECULAR GENETICS Restriction Enzymes 15.1.1 The Discovery of Restriction Endonucleases p. 420 2 2, 3, 4, 6, 7, 8 Assigned Reading in Snustad 6th ed. 14.1.1 The Discovery
More informationRecombinant DNA recombinant DNA DNA cloning gene cloning
DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More information1. What is the structure and function of DNA? Describe in words or a drawing the structure of a DNA molecule. Be as detailed as possible.
INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment, insulin. You also learned that the best way to
More informationOverview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
More informationRFLP: Restriction Fragment Length Polymorphism
RFLP: Restriction Fragment Length Polymorphism Various endonucleases: 6 cutters and 4 cutters Enzyme Source Recognition Sequence Cut EcoRI Escherichia coli 5'GAATTC 5'---G/AATTC---3' EcoRII Escherichia
More informationNB536: Bioinformatics
NB536: Bioinformatics Instructor Prof. Jong Kyoung Kim Department of New Biology Office: E4-613 E-mail: jkkim@dgist.ac.kr Homepage: https://scg.dgist.ac.kr Course website https://scg.dgist.ac.kr/index.php/courses
More informationNCERT. 2. An enzyme catalysing the removal of nucleotides from the ends of DNA is: a. endonuclease b. exonuclease c. DNA ligase d.
BIOTECHNOLOGY PRINCIPLES AND PROCESSES 75 CHAPTER 11 BIOTECHNOLOGY: PRINCIPLES AND PROCESSES 1. Rising of dough is due to: MULTIPLE-CHOICE QUESTIONS a. Multiplication of yeast b. Production of CO 2 c.
More informationOrigins of Biotechnology
What Is Biotechnology? Origins of Biotechnology the use of living organisms to develop or make useful products improve plants or animals to develop microorganisms for specific uses Although it seems like
More informationRestriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner.
Enzymes Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner. Generally recognize an inverted repeat sequence 4, 6, or 8 base pairs
More informationChapter 10 (Part I) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part I) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. From which types of organisms were most restriction
More informationA Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology
A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology How Are Large DNA Molecules Analyzed? Naturally occurring enzymes that cleave and repair DNA are used in the laboratory to manipulate
More informationIn other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0.
In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. There are a number of shorthand abbreviations a linear polymer of deoxyribonucleotides. One
More informationFun with DNA polymerase
Fun with DNA polymerase Why would we want to be able to make copies of DNA? Can you think of a situation where you have only a small amount and would like more? Enzymatic DNA synthesis To use DNA polymerase
More informationChapter 9. Biotechnology and DNA Technology
Chapter 9 Biotechnology and DNA Technology SLOs Compare and contrast biotechnology, recombinant DNA technology, and genetic engineering. Identify the roles of a clone and a vector in making recombined
More information-Is the process of manipulating genes and genomes
Genetic Engineering -Is the process of manipulating genes and genomes Biotechnology -Is the process of manipulating organisms or their components for the purpose of making useful products Restriction Enzymes
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationAmplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :
Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and
More informationBiotechnology DNA technology
Biotechnology Biotechnology is the manipulation of organisms or their components to make useful products The applications of DNA technology affect everything from agriculture, to criminal law, to medical
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationBCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA.
Lab#2 BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA. Outlines: 1-Insertion of foreign gene to the plasmid. 2-Competent cell. 3-Transformation of bacterial cell.
More informationBiology Warm Up. 1. Complete the entrance ticket you received at the door.
Biology Warm Up Monday, February 8 1. Complete the entrance ticket you received at the door. NOTE: This is not a grade. I want to see what you know/remember. Once you finish, place in front blue basket.
More informationAgenda (Monday-Wednesday)
Agenda (Monday-Wednesday) Chapter 12 Recombinant DNA Technology Recombinant DNA Techniques DNA Fingerprinting and Forensic Science DNA Fingerprinting Techniques Pre-lab 8 activities Tomorrow: Day One of
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More information2/2/16. Insulin and sugar metabolism. A Molecular Genetics Toolbox I: Tools to clone, amplify, analyze and sequence DNA
1. Cold Spring Harbor Labs Learning Centre A Molecular Genetics Toolbox I: Tools to clone, amplify, analyze and sequence DNA 2 Molecular Biology of the Gene (Watson et al.l 6 th (International) Edition
More informationRestriction Enzymes (endonucleases)
In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate
More informationManipulation of Purified DNA
Manipulation of Purified DNA To produce the recombinant DNA molecule, the vector, as well as the DNA to be cloned, must be cut at specific points and then joined together in a controlled manner by DNA
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationBiotechnology. Cloning. Transformation 2/4/ glue DNA
Biotechnology Cloning The production of multiple copies of a single gene (gene cloning) For basic research on genes and their protein products To make a protein product (insulin, human growth hormone)
More informationSynthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
More informationAnnouncements. Chapter 6: Week 2 Restric;on Digest of Plasmid DNA. Restric9on Enzymes. Type II: Restric9on Enzymes
Announcements Lab Exam 12/9 12/11 during discussion ~20 mul9ple choice ques9ons Will require a calculator All Chapter 6 Labs Due by 12 noon on Wed. 12/12 Chapter 6ab Discussion Dates Lab Dates Lab Due
More informationGenetics and Biotechnology 13.2 DNA Technology
Biotechnology Genetic Engineering Technology that involves manipulating the DNA of one organism in order to insert the DNA of another organism An electric current is used to separate DNA fragments according
More informationMolecular Biology Techniques Supporting IBBE
Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning
More informationKey components of DNA-based Biotechnology
Lecture 12 DNA Recombinant Technology DNA enzymology: restriction enzymes, methylases, ligases, polynucleotide kinase, reverse transcriptases Hybridization: complementarity of DNA and RNA The DNA Carriers:
More informationChapter 4 PRINCIPLES AND PROCESSES IN BIOTECHNOLOGY
Chapter 4 PRINCIPLES AND PROCESSES IN BIOTECHNOLOGY Principles and processes in Biotechnology Biotechnology has been defined in various ways e.g., An integrated application of knowledge and techniques
More informationLAB 1: AN INTRODUCTION TO MICROVOLUMETRICS AND PIPETTING
Name: Book # Per. Name: Name: Book # Book # LAB 1: AN INTRODUCTION TO MICROVOLUMETRICS AND PIPETTING PRELAB: 1. Approximately 28 drops of liquid, from a medicine dropper or disposable pipette, equals 1
More informationChapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
More informationConcept 13.1 Recombinant DNA Can Be Made in the Laboratory
13 Biotechnology Concept 13.1 Recombinant DNA Can Be Made in the Laboratory It is possible to modify organisms with genes from other, distantly related organisms. Recombinant DNA is a DNA molecule made
More informationAt the end of this lesson you should be able to
At the end of this lesson you should be able to 1. Define Genetic Engineering 2. Outline the process of genetic engineering involving some or all of the following: isolation, cutting, transformation, introduction
More informationGel Electrophoresis: Quantitative length and mass measurements of DNA
BIO440 Genetics Lab Humboldt State University Gel Electrophoresis: Quantitative length and mass measurements of DNA Electrophoresis, and in particular agarose gel electrophoresis, is an integral analysis
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationA cross between dissimilar individuals to bring together their best characteristics is called
Ch 13 Game review A cross between dissimilar individuals to bring together their best characteristics is called A Genetic engineering B Inbreeding C Hybridization D Sequencing Ans: C Used to insert new
More information10. Monoclonal antibody technology. 8. DNA microarray technology 9. Human Genome Project. 12. RNA interference (RNAi) 11. Antisense technology
Topics 1. Recombinant DNA technology 2. DNA cloning 3. DNA library 4. Southern blotting 5. RFLP 6. DNA amplification: PCR 7. DNA sequencing 8. DNA microarray technology 9. Human Genome Project 10. Monoclonal
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationBiotechnology. AP Biology
Biotechnology 2007-2008 A Brave New World TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC human genome GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA
More informationGene cloning. DNA cloning is a technique for reproducing DNA fragments. It can be achieved by two different approaches:
Introduction, Basic techniques: Restriction enzymes and restriction digestion, other enzymes used for DNA manipulation: synthesis, joining and modification,, gelelectrophoresis: Principal, types, process
More informationBiotechnolog y and DNA Technology
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 9 Biotechnolog y and DNA Technology Introduction to Biotechnology Biotechnology: the use of microorganisms,
More informationAppendix B. Fig. 1. The Structure of DNA
Appendix B Prelab Activity 1 A Review of Restriction Enzymes DNA consists of a series of nitrogen base molecules held together by weak hydrogen bonds. These base pairs are in turn bonded to a sugar and
More informationRestriction Enzymes Dna Scissors Answer Key
RESTRICTION ENZYMES DNA SCISSORS ANSWER KEY PDF - Are you looking for restriction enzymes dna scissors answer key Books? Now, you will be happy that at this time restriction enzymes dna scissors answer
More information