Big picture and history

Size: px
Start display at page:

Download "Big picture and history"

Transcription

1 Big picture and history (and Computational Biology) CS-5700 / BIO-5323

2 Outline

3 Outline

4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the of representatives of several of the more common protein families such as cytochromes from a variety of organisms. Margaret Dayhoff (1972, 1978) and her collaborators at the National Biomedical Research Foundation (NBRF), Washington, DC, were the first to assemble of these into a protein sequence atlas in the 1960s, and their collection center eventually became known as the Information Resource (PIR, formerly Identification Resource Dayhoff and her coworkers organized the proteins into families and superfamilies based on the degree of sequence similarity.

5 First to be databased were proteins

6 Outline

7 were first assembled at Los Alamos National Laboratory (LANL), New Mexico, by Walter Goad and colleagues in the GenBank database and at the European Molecular Biology Laboratory (EMBL) in Heidelberg, Germany. Initially, a sequence entry included a computer filename and DNA or protein sequence files. These were eventually expanded to include much more information about the sequence, such as function, mutations, encoded proteins, regulatory sites, and references. This information was then placed along with the sequence into a database format that could be readily searched for many types of information.

8 Outline

9 from public An important step in providing sequence database access was the development of Web pages that allow queries to be made of the major sequence (GenBank, EMBL, etc.). An early example of this technology at NCBI was a menu-driven program called GEN-INFO developed by D. Benson, D. Lipman, and colleagues. This program searched rapidly through previously indexed sequence for entries that matched a biologist s query. Subsequently, a derivative program called ENTREZ with a simple window-based interface, and eventually a Web-based interface, was developed at NCBI. The idea behind these programs was to provide an easy-to-use interface with a flexible search procedure to the sequence.

10 Outline

11 Because DNA involves ordering a set of peaks (A, G, C, or T) on a gel, the process can be quite error-prone, depending on the quality of the data. As more s became available in the late 1970s, interest also increased in developing computer programs to analyze these in various ways. In 1982 and 1984, Nucleic Acids Research published two special issues devoted to the application of computers for sequence analysis, including programs for large mainframe computers down to the then-new microcomputers.

12 Outline

13 for comparing In 1970, A.J. Gibbs and G.A. McIntyre (1970) described a new for comparing two amino acid and nucleotide in which a graph was drawn with one sequence writ- ten across the page and the other down the left-hand side. Whenever the same letter appeared in both, a dot was placed at the intersection of the corresponding sequence positions on the graph

14 Outline

15 , global, local, and multiple Various s for aligning entire matching segments, small matching adjacent segments, and multiple variable-length segments.

16 Outline

17 Prediction of RNA secondary Methods for predicting RNA secondary on computers were also developed at an early time. For example, if the complement of a sequence on an RNA molecule is repeated down the sequence in the opposite chemical direction, the regions may base-pair and form a hairpin

18 Prediction of protein and RNA There are a large number of proteins whose are known, but very few whose s have been solved. Solving protein s involves the time-consuming and highly specialized procedures of X-ray crystallography and nuclear magnetic resonance (NMR). Consequently, there is much interest in trying to predict the of a protein, given its sequence. Early attempts were made at predicting protein from sequence.

19 Outline

20 , DNA, and RNA Variations within a family of related nucleic acid or protein provide an invaluable source of information for evolutionary biology, enabling the discovery of between species in an objectively quantifiable manner.

21 Outline

22 The first genome database The first genome database, was called ACEDB (a C. elegans database), and the s to access this database were developed by Mike Cherry and colleagues (Cherry and Cartinhour 1993). This database was accessible through the internet and allowed of, information about genes and mutants, investigator addresses, and references. Similar were subsequently developed using the same s for A. thaliana and S. cerevisiae.

23 Outline

24 And then the field of bioinformatics exploded from 1982 to the present, the number of bases in GenBank has doubled approximately every 18 months. As of 15 August 2017, GenBank release has 203,180,606 loci, 240,343,378,258 bases, from 203,180,606 reported.

25 Outline

26 Outline

27 Nexus of many fields

28 Nexus of many fields

29 Contrasted to data science Same job, way worse pay...

30 Slightly more detail

31 Even more detail

32 A different perspective

33 AI s in

34 Outline

35 and computational biology prediction

36 Outline

37 Ontology In computer science and information science, an is a formal naming and definition of the types, properties, and inter of the entities that really exist in a particular domain of discourse. An upper (or foundation ) is a model of the common objects that are generally applicable across a wide range of domain ontologies. It usually employs a core glossary that contains the terms and associated object descriptions as they are used in various relevant domain sets, for example, the Basic Formal Ontology (BFO) Domain : Open Biomedical (abbreviated OBO; formerly Open Biological ) is an effort to create controlled vocabularies for shared use across different biological and medical domains. As of 2006, OBO forms part of the resources of the U.S. National Center for Biomedical Ontology where it will form a central element of the NCBO s BioPortal.

38 The Ontology (SO) at is a collaborative project for the definition of sequence features used in biological sequence annotation. For example, an X element combinatorial repeat is a repeat region located between the X element and the telomere or adjacent Y element.

39 The Gene Ontology (GO) is a controlled vocabulary that connects each gene to one or more functions. The is intended to categorize gene products rather than the genes themselves. Different products of the same gene may play very different roles, and labelling and treating all of these functions under the same gene name may (and often does) lead to confusion.

40 Outline

41 Databases More to come later

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

FUNCTIONAL BIOINFORMATICS

FUNCTIONAL BIOINFORMATICS Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.

More information

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.

More information

Computational methods in bioinformatics: Lecture 1

Computational methods in bioinformatics: Lecture 1 Computational methods in bioinformatics: Lecture 1 Graham J.L. Kemp 2 November 2015 What is biology? Ecosystem Rain forest, desert, fresh water lake, digestive tract of an animal Community All species

More information

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),

More information

The University of California, Santa Cruz (UCSC) Genome Browser

The University of California, Santa Cruz (UCSC) Genome Browser The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

Tutorial for Stop codon reassignment in the wild

Tutorial for Stop codon reassignment in the wild Tutorial for Stop codon reassignment in the wild Learning Objectives This tutorial has two learning objectives: 1. Finding evidence of stop codon reassignment on DNA fragments. 2. Detecting and confirming

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists Rickard Sandberg Karolinska Institutet 13-17 May 2013 OUTLINE INTRODUCTION Introduce yourselves HISTORY MODERN What is bioinformatics today? COURSE ONLINE LEARNING OPPORTUNITIES

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1

More information

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence

More information

What I hope you ll learn. Introduction to NCBI & Ensembl tools including BLAST and database searching!

What I hope you ll learn. Introduction to NCBI & Ensembl tools including BLAST and database searching! What I hope you ll learn Introduction to NCBI & Ensembl tools including BLAST and database searching What do we learn from database searching and sequence alignments What tools are available at NCBI What

More information

Protein Bioinformatics Part I: Access to information

Protein Bioinformatics Part I: Access to information Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 1 Intro to Molecular Biology Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/14 Announcements Homework 1 due next Tuesday

More information

Textbook Reading Guidelines

Textbook Reading Guidelines Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena

More information

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will

More information

Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview

Bioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, 2007 @ EnviroHealth Connections Bioinformatics and

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology

More information

Course Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses

Course Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses Course Information Introduction to Algorithms in Computational Biology Lecture 1 Meetings: Lecture, by Dan Geiger: Mondays 16:30 18:30, Taub 4. Tutorial, by Ydo Wexler: Tuesdays 10:30 11:30, Taub 2. Grade:

More information

Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part

Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part of the nucleotide sequence of the DNA into RNA. RNA

More information

Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized

Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized 1 2 3 Imaging informatics computer assisted mammogram reading Clinical aka medical informatics CDSS combining bioinformatics for diagnosis, personalized medicine, risk assessment etc Public Health Bio

More information

Bioinformatics, in general, deals with the following important biological data:

Bioinformatics, in general, deals with the following important biological data: Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,

More information

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11 Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the

More information

Sequencing the Human Genome

Sequencing the Human Genome The Biotechnology 339 EDVO-Kit # Sequencing the Human Genome Experiment Objective: In this experiment, DNA sequences obtained from automated sequencers will be submitted to Data bank searches using the

More information

CSE/Beng/BIMM 182: Biological Data Analysis. Instructor: Vineet Bafna TA: Nitin Udpa

CSE/Beng/BIMM 182: Biological Data Analysis. Instructor: Vineet Bafna TA: Nitin Udpa CSE/Beng/BIMM 182: Biological Data Analysis Instructor: Vineet Bafna TA: Nitin Udpa Today We will explore the syllabus through a series of questions? Please ASK All logistical information will be given

More information

SAMPLE LITERATURE Please refer to included weblink for correct version.

SAMPLE LITERATURE Please refer to included weblink for correct version. Edvo-Kit #340 DNA Informatics Experiment Objective: In this experiment, students will explore the popular bioninformatics tool BLAST. First they will read sequences from autoradiographs of automated gel

More information

Introduction to Algorithms in Computational Biology Lecture 1

Introduction to Algorithms in Computational Biology Lecture 1 Introduction to Algorithms in Computational Biology Lecture 1 Background Readings: The first three chapters (pages 1-31) in Genetics in Medicine, Nussbaum et al., 2001. This class has been edited from

More information

What is Bioinformatics?

What is Bioinformatics? What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is

More information

Retrieval of gene information at NCBI

Retrieval of gene information at NCBI Retrieval of gene information at NCBI Some notes 1. http://www.cs.ucf.edu/~xiaoman/fall/ 2. Slides are for presenting the main paper, should minimize the copy and paste from the paper, should write in

More information

Discover the Microbes Within: The Wolbachia Project. Bioinformatics Lab

Discover the Microbes Within: The Wolbachia Project. Bioinformatics Lab Bioinformatics Lab ACTIVITY AT A GLANCE "Understanding nature's mute but elegant language of living cells is the quest of modern molecular biology. From an alphabet of only four letters representing the

More information

Assembling Protein Molecules

Assembling Protein Molecules How Does Dna Provide Instructions For Assembling Protein Molecules What does the information in DNA molecules provide instructions for? A. Assembling B. Assembling protein molecules into amino acids. C.

More information

Information Extraction from Biomedical Text

Information Extraction from Biomedical Text Information Extraction from Biomedical Text BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2009 The Information Extraction Task: Named Entity Recognition Analysis of

More information

BIO 101 : The genetic code and the central dogma

BIO 101 : The genetic code and the central dogma BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not

More information

Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station

Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Library preparation Sequencing Hypothesis testing Bioinformatics 2 Why annotate?

More information

CS313 Exercise 1 Cover Page Fall 2017

CS313 Exercise 1 Cover Page Fall 2017 CS313 Exercise 1 Cover Page Fall 2017 Due by the start of class on Monday, September 18, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try

More information

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact

More information

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical

More information

I nternet Resources for Bioinformatics Data and Tools

I nternet Resources for Bioinformatics Data and Tools ~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Download the Lectin sequence output from

Download the Lectin sequence output from Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).

More information

Bioinformation by Biomedical Informatics Publishing Group

Bioinformation by Biomedical Informatics Publishing Group Algorithm to find distant repeats in a single protein sequence Nirjhar Banerjee 1, Rangarajan Sarani 1, Chellamuthu Vasuki Ranjani 1, Govindaraj Sowmiya 1, Daliah Michael 1, Narayanasamy Balakrishnan 2,

More information

CSE : Computational Issues in Molecular Biology. Lecture 19. Spring 2004

CSE : Computational Issues in Molecular Biology. Lecture 19. Spring 2004 CSE 397-497: Computational Issues in Molecular Biology Lecture 19 Spring 2004-1- Protein structure Primary structure of protein is determined by number and order of amino acids within polypeptide chain.

More information

BIMM 143: Introduction to Bioinformatics (Winter 2018)

BIMM 143: Introduction to Bioinformatics (Winter 2018) BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST

More information

Practical Bioinformatics for Biologists (BIOS 441/641)

Practical Bioinformatics for Biologists (BIOS 441/641) Practical Bioinformatics for Biologists (BIOS 441/641) - Course overview Yanbin Yin MO444 1 Room and computer access Room entry code: 2159 Computer access: user poduser 2 Compared to BIOS 443/643 and 646

More information

The Integrated Biomedical Sciences Graduate Program

The Integrated Biomedical Sciences Graduate Program The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to

More information

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5 Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate

More information

NOTES Gene Expression ACP Biology, NNHS

NOTES Gene Expression ACP Biology, NNHS Name Date Block NOTES Gene Expression ACP Biology, NNHS Model 1: Transcription the process of genes in DNA being copied into a messenger RNA 1. Where in the cell is DNA found? 2. Where in the cell does

More information

Sequence Based Function Annotation

Sequence Based Function Annotation Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological

More information

Bioinformatics Course AA 2017/2018 Tutorial 2

Bioinformatics Course AA 2017/2018 Tutorial 2 UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it

More information

Databases/Resources on the web

Databases/Resources on the web Databases/Resources on the web Jon K. Lærdahl jonkl@medisin.uio.no A lot of biological databases available on the web... MetaBase, the database of biological databases (1801 entries) - h p://metadatabase.org

More information

Introduc)on to Databases and Resources Biological Databases and Resources

Introduc)on to Databases and Resources Biological Databases and Resources Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs

More information

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing

More information

Introduction. CS482/682 Computational Techniques in Biological Sequence Analysis

Introduction. CS482/682 Computational Techniques in Biological Sequence Analysis Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)

More information

B I O I N F O R M A T I C S

B I O I N F O R M A T I C S B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What

More information

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database

More information

A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING

A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING D. Martucci a, F. Pinciroli a,b, M. Masseroli a a Dipartimento di Bioingegneria, Politecnico di Milano, Milano,

More information

Molecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo

Molecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo Molecular Biology IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Francesca Stomeo Molecular biology is the study of biology at a molecular level, especially DNA and RNA - replication, transcription, translation,

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Which Process Is The First Step In Making A Protein From Dna Instructions >>>CLICK HERE<<<

Which Process Is The First Step In Making A Protein From Dna Instructions >>>CLICK HERE<<< Which Process Is The First Step In Making A Protein From Dna Instructions How do the instructions in DNA reach the ribosomes in the cytoplasm? RNA is needed for Then it helps build the protein. RNA is

More information

Why Use BLAST? David Form - August 15,

Why Use BLAST? David Form - August 15, Wolbachia Workshop 2017 Bioinformatics BLAST Basic Local Alignment Search Tool Finding Model Organisms for Study of Disease Can yeast be used as a model organism to study cystic fibrosis? BLAST Why Use

More information

Textbook Reading Guidelines

Textbook Reading Guidelines Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: January 16, 2013 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science

More information

Computers in Biology and Bioinformatics

Computers in Biology and Bioinformatics Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come

More information

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality

More information

Genomics and Proteomics *

Genomics and Proteomics * OpenStax-CNX module: m44558 1 Genomics and Proteomics * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will

More information

Written by: Prof. Brian White

Written by: Prof. Brian White Molecular Biology II: DNA Transcription Written by: Prof. Brian White Learning Goals: To work with a physical model of DNA and RNA in order to help you to understand: o rules for both DNA & RNA structure

More information

Introduction on Several Popular Nucleic Acids Databases

Introduction on Several Popular Nucleic Acids Databases Introduction on Several Popular Nucleic Acids Databases Changmin Liao Library, China West Normal University, Nanchong City, P. R. liaochangminlxh@yahoo.com.cn Abstract-Nucleic acids are major biological

More information

Who, When, and Where. Section Days & Times

Who, When, and Where. Section Days & Times 1 GENERAL INFORMATION Who, When, and Where Section 01 02 Days & Times Professors Teaching Assistants Laboratory Coordinator M 12:20 4:25 pm W 1:25 4:25 pm Sam Hazen Assistant Professor, Biology 409A Morrill

More information

Annotation. (Chapter 8)

Annotation. (Chapter 8) Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store

More information

Bioinformatics Translation Exercise

Bioinformatics Translation Exercise Bioinformatics Translation Exercise Purpose: The following activity is an introduction to the Biology Workbench, a site that allows users to make use of the growing number of tools for bioinformatics analysis.

More information

Outline. Computational Genomics and Molecular Biology. Genes Encode Proteins. DNA forms a double stranded helix. DNA replication T C A G

Outline. Computational Genomics and Molecular Biology. Genes Encode Proteins. DNA forms a double stranded helix. DNA replication T C A G Computational Genomics and Molecular Biology Dannie Durand Fall 2004 Lecture 1 Genes Encode Proteins DNA forms a double stranded helix GTGCACCTGACTCCTGAG A gene is a DNA sequence V H L T P E A protein

More information

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual

More information

Practical Bioinformatics for Biologists (BIOS493/700)

Practical Bioinformatics for Biologists (BIOS493/700) Practical Bioinformatics for Biologists (BIOS493/700) - Course overview Yanbin Yin Spring 2013 MO444 1 BIOS 643 and 646 Minimum theoretical intro A LOT of practical applications Goal: enhance the use of

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned

More information

ENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics

ENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics A very coarse introduction to bioinformatics In this exercise, you will get a quick primer on how DNA is used to manufacture proteins. You will learn a little bit about how the building blocks of these

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

TIGR THE INSTITUTE FOR GENOMIC RESEARCH Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,

More information