Lecture 2: Biology Basics Continued

Transcription

1 Lecture 2: Biology Basics Continued

2 Central Dogma

3 DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and C-G on complimentary strands.

4 DNA: The Code of Life DNA has a double helix structure which composed of sugar molecule phosphate group and a base (A,C,G,T) DNA always reads from 5 end to 3 end for transcription replication

5 DNA can replicate by splitting, and rebuilding each strand. Note that the rebuilding of each strand uses slightly different mechanisms due to the 5 3 asymmetry, but each daughter strand is an exact replica of the original strand. DNA Replication

6 Inverse Complement of DNA What is the inverse complement sequence of TATAGCCCG?

7 Inverse Complement of DNA What is the inverse complement sequence of TATAGCCCG? CGGGCTATA

8 Genotype/Phenotype To prevent confusion between genes (which are inherited) and developmental outcomes (which are not), geneticists make a distinction between the genotype and the phenotype of an organism Genotype: complete set of genes inherited by an individual Phenotype: all aspects of the individual s physiology, behavior, and ecological relationships

9 DNA the Genetics Makeup Genes are inherited and are expressed genotype (genetic makeup) phenotype (physical expression) On the left, is the eye s phenotypes of green and black eye genes.

10 Two organisms whose genes differ at one locus are said to have different genotypes. A locus (loci for plural) is the specific location of a gene of a DNA sequence on a chromosome. A variant of the DNA sequence at a given location is called a allele. The ordered list of loci known for a particular genome is called a genetic map.

11

12 Diploid and polyploid cells whose chromosomes have the same allele of a given gene at some locus are called homozygous, with respect to that gene (otherwise, it is heterzygous). The chromosomal locus of a gene might be written "6p21.3 6: chromosome number p: position on the chromosome s short arm ( p ) or long arm ( q ) 21.3: the position on the arm: region 2, band 1, subband 3. The bands are visible under a microscope when the chromosome is stained.

13

14 Genotype/Phenotype Blue eyes Phenotype: Brown eyes Recessive: bb Genotype: Dominant: Bb or BB

15 Pleiotropy: when one gene affects many different traits. Polygenic traits: when one trait is governed by multiple genes, which maybe on the same chromosome or on different chromosomes. The additive effects of numerous genes on a single phenotype create a continuum of possible outcomes. Polygenic traits are also most susceptible to environmental influences.

16 Pleiotropy in humans: Phenylketonuria A disorder that is caused by a deficiency of the enzyme phenylalanine hydroxylase, which is necessary to convert the essential amino acid phenylalanine to tyrosine. A defect in the single gene that codes for this enzyme therefore results in the multiple phenotypes associated with PKU, including mental retardation, eczema, and pigment defects that make affected individuals lighter skinned

17 Polygenic Inheritance in Humans Height is controlled by polygenes for skeleton height, but their effect may be affected by malnutrition, injury, and disease. Weight, skin color, and intelligence. Birth defects like clubfoot, cleft palate, or neural tube defects are also the result of multiple gene interactions. Complex diseases and traits have a tendency to have low heritability (tendency to be inherited) compared to single gene disorders (i.e. sickle-cell anemia, cystic fibrosis, PKU, Hemophelia, many extremely rare genetic disorders).

18 Selection Some genes may be subject to selection, where individuals with advantages or adaptive traits tend to be more successful than their peers reproductively When these traits have a genetic basis, selection can increase the prevalence of those traits, because the offspring will inherit those traits. This may correlate with the organism's ability to survive in its environment. Several different genotypes (and possibly phenotypes) may then coexist in a population. In this case, their genetic differences are called polymorphisms.

19 Genetic Mutation The simplest is the point mutation or substitution; here, a single nucleotide in the genome is changed (single nucleotide polymorphisms (SNPs)) Other types of mutations include the following: Insertion. A piece of DNA is inserted into the genome at a certain position Deletion. A piece of DNA is cut from the genome at a certain position Inversion. A piece of DNA is cut, flipped around and then reinserted, thereby converting it into its complement Translocation. A piece of DNA is moved to a different position. Duplication. A copy of a piece of DNA is inserted into the genome

20 Mutations and Selection While mutations can be detrimental to the affected individual, they can also in rare cases be beneficial; more frequently, neutral. Often mutations have no or a negligible impact on survival and reproduction. Thereby mutations can increase the genetic diversity of a population, that is, the number of present polymorphisms. In combination with selection, this allow a species to adapt to changing environmental conditions and to survive in the long term.

21 Raw Sequence Data 4 bases: A, C, G, T + other (i.e. N = any, R = G or A (purine), Y = T or (pyrimidine)) kb (= kbp) = kilo base pairs = 1,000 bp Mb = mega base pairs = 1,000,000 bp Gb = giga base pairs = 1,000,000,000 bp. Size: E. Coli 4.6Mbp (4,600,000) Fish 130 Gbp (130,000,000,000) Paris japonica (Plant) 150 Gbp Human 3.2Gbp

22 Fasta File A sequence in FASTA format begins with a single-line description, followed by lines of sequence data (file extension is.fa). It is recommended that all lines of text be shorter than 80 characters in length.

23 Typically contain 4 lines: Fastq File Line 1 begins with a '@' character and is followed by a sequence identifier and an optional description. Line 2 is the sequence. Line 3 is the delimiter +, with an optional description. Line 4 is the quality score. file extension GATTTGGGGTTCAAAGCTTCAAAGCTTCAAAGC +!''*((((***+))%%% !!!++***

24 Genes and Proteins One gene encodes one protein and begins with start codon (e.g. ATG), then each three code one amino acid. Then a stop codon (e.g. TGA) signifies end of the gene. In the middle of a (eukaryotic) gene, there are segments that are spliced out during transcription. Introns: segments that are spliced out Exons: segments that are kept. Detecting the introns and exons is a task for gene finding.

25

26 Genomics: - Assembly - Detection of variation - GWAS RNA: - Gene expression - Transcriptome assembly - Pathway analysis Protein: - Mass spectrometry - Structure prediction - Protein-Protein interaction