Proteomics and Cancer
|
|
|
- Darlene Sutton
- 6 years ago
- Views:
Transcription
1 Proteomics and Cancer Japan Society for the Promotion of Science (JSPS) Science Dialogue Program at Niitsu Senior High School Niitsu, Niigata September 4th 2006 Vladimir Valera, M.D, PhD JSPS Postdoctoral fellow First Department of Surgery Niigata University 1
2 Proteomics and Cancer What is Proteomics? Why to study the Proteome? Why Cancer? How do we study the proteome What do we see? How do we use the results? How translate the results to patients care? Proteomics and Cancer only?
3 Proteomics and Cancer What is Proteomics? The Proteome: the collection of proteins that are expressed by (or present in) a cell or tissue at a given moment
4
5 Proteomics and Cancer Why to study the Proteome? Genomics Genes (DNA) The Information Transcriptomics mrna The Message Proteomics Proteins The Actors
6 Why to study the Proteome? The function of a protein depends on its structure and interactions, neither of which can be predicted accurately based on sequence information alone Genomics and Transcriptomics are coarse tools for large-scale functional analysis. The abundance of a given transcript may not reflect the abundance of the corresponding protein. Protein diversity is generated posttranscriptionally. Protein activity often depends on posttranslational modifications, which are not predictable from the level of the corresponding transcript. The function of a protein often depends on its localization.
7 Proteomics and Cancer Why Cancer? Cancer is one of the main causes of death in the world Is a public health problem Proteomics will help to the identification of Genes and Proteins responsible for or implicated in the disease Potentially curable Proteomics will allow early detection It is cheaper to prevent than to treat the disease
8 How do we study the proteome? Electrophoresis Gel electrophoresis 2 Dimensional Electrophoresis (2DE) Capillary electrophoresis (CE) Liquid Chromatography (LC) Mass Spectrometry (MS) Combination: 2DE-MS, CE-MS, LC- MS Microarray Technology
9 Electrophoresis
10 Electrophoresis
11 Proteomics and Cancer 2 Dimensional Gel Electrophoresis (2DE) Polyacrylamide Gels 1 st dimension: pi (Isoelectric focusing) 2 nd dimension: MW (molecular weight)
12 Electrophoresis First Dimension: Isoelectric Focusing
13 Electrophoresis First Dimension: Isoelectric Focusing
14
15 2 Dimensional Gel Electrophoresis First Dimension Second Dimension
16
17 2 Dimensional Gel Electrophoresis
18
19 First Dimension S e c o n d D i m en s i o n
20 Differential Expression Proteomics
21 Differential Expression Proteomics
22 Proteomics and Cancer Capillary electrophoresis (CE)
23 Proteomics and Cancer Liquid Chromatography High Performance Liquid Chromatography (HPLC) Ion exchange chromatography (IE) Affinity chromatography (AC) 2-D Liquid Chromatography HPLC-IE, HPLC-AC etc.
24 Liquid Chromatography
25 Liquid Chromatography
26 Liquid Chromatography Size Charge Affinity
27 Proteomics and Cancer Mass Spectrometry (MS)
28 Mass Spectrometry
29 MALDI-TOF Mass Spectrometry
30 ESI Mass Spectrometry
31 ESI Mass Spectrometry
32 Peptide Sequence Mass Spectra Analysis by Bioinformatics Algorithms
33 Proteomics and Cancer Combination of techniques: 2DE-MS, CE-MS, LC-MS
34 Combination of Techniques Capillary IEF Mass pectrometry
35 Combination of Techniques 1-D or 2-D Liquid Chromatograpy/Mass Spectrometry 2D-LC-MS
36 Proteomics and Cancer Microarray Technology
37 Protein Microarrays
38 Proteomics and Cancer What do we see? What do we look for?
39 What do we see? Bands
40 What do we see? Spots
41 What do we see? Mass Spectra
42 What do we see? Peptide lists
43 What do we look for? Expression patterns
44 What do we look for? Expression patterns
45 What do we look for?
46 What do we look for? Expression patterns
47 How do we use the results?
48 Proteomics and Cancer How translate the results to patients care?
49 Proteomics and Cancer Proteomics and cancer biomarkers only? Plant genomics and proteomics Marine Biology
50
51 The Rice Proteome Callous 1 week after flowering
52 Proteomics and Marine Biology Zebrafish Medaka
53 Thank you for your attention! 53
Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
Proteomics. Proteomics is the study of all proteins within organism. Challenges
Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we
Exam MOL3007 Functional Genomics
Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting
Advances in analytical biochemistry and systems biology: Proteomics
Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current
Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)
Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make
MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications
![MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications](/thumbs/74/71368870.jpg "MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications")
MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein
Towards unbiased biomarker discovery
Towards unbiased biomarker discovery High-throughput molecular profiling technologies are routinely applied for biomarker discovery to make the drug discovery process more efficient and enable personalised
Lecture 8: Affinity Chromatography-III
Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The
Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis
Laboratory Water Quality Affects Protein Separation by 2D Gel Electrophoresis 2D gel electrophoresis remains a dominant technique in proteomics. Obtaining high quality gels requires careful and tedious
Proteomics: A Challenge for Technology and Information Science. What is proteomics?
Proteomics: A Challenge for Technology and Information Science CBCB Seminar, November 21, 2005 Tim Griffin Dept. Biochemistry, Molecular Biology and Biophysics tgriffin@umn.edu What is proteomics? Proteomics
Využití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS
Využití cílené proteomiky pro kontrolu falšování potravin: identifikace peptidových markerů v mase pomocí LC- Q Exactive MS/MS Michal Godula Ph.D. Thermo Fisher Scientific The world leader in serving science
Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry
Lecture 23: Clinical and Biomedical Applications of Proteomics; Proteomics Industry Clinical proteomics is the application of proteomic approach to the field of medicine. Proteome of an organism changes
Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
Metabolomics in Systems Biology
Metabolomics in Systems Biology Basil J. Nikolau W.M. Keck Metabolomics Research Laboratory Iowa State University February 7, 2008 Outline What is metabolomics? Why is metabolomics important? What are
2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM
2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM Nancy Kendrick, Jon Johansen & Matt Hoelter, Kendrick Labs Inc www.kendricklabs.com Talk Outline Significance Method description
Investigation of a Mammalian Cellular Model for Differential Protein Expression Analysis Using 1D PAGE and Cleavable ICAT Reagents
pplication Note 1D PGE and Cleavable ICT Reagents Investigation of a Mammalian Cellular Model for Differential Protein Expression nalysis Using 1D PGE and Cleavable ICT Reagents Overview The use of two-dimensional
ENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology
ENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission 06/15/2012 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: CDP (sc6327) Target: CDP Company/ Source: Santa Cruz Catalog
Protein Microarrays?
Protein Microarrays? Protein Chemistry/Proteomics Unit and the Neuroscience Program,Biomedicum Helsinki E-Mail: marc.baumann@helsinki.fi (http://research.med.helsinki.fi/corefacilities/proteinchem) What
Peptide biomarkers as a way to determine meat authenticity
Peptide biomarkers as a way to determine meat authenticity Miguel A. Sentandreu Laboratory of Meat Science IATA (CSIC), SPAIN The problem of meat authentication Clear and reliable information about food
Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
Advances in Nutrigenomics research: Novel and future analytical. approaches to investigate the biological activity of natural
Advances in Nutrigenomics research: Novel and future analytical approaches to investigate the biological activity of natural compounds and food functions V. García-Cañas, C. Simó, C. León, A. Cifuentes*
Expand Your Research with Metabolomics and Proteomics. Christine Miller Omics Market Manager ASMS 2017
Expand Your Research with Metabolomics and Proteomics Christine Miller Omics Market Manager ASMS 2017 New Additions to Agilent Omics Workflows Acquisition Ion Mobility Q-TOF IM All Ions MS/MS Find Features
Proteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples
Proteomics Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Antibody arrays Protein activity arrays 2-D gels ICAT technology SELDI Limitations: protein sources surfaces and
Antibody Analysis by ESI-TOF LC/MS
Application Note PROTEOMICS METABOLOMICS GENOMICS INFORMATICS GLYILEVALCYSGLUGLNALASERLEUASPARG CYSVALLYSPROLYSPHETYRTHRLEUHISLYS Antibody Analysis by ESI-TOF LC/MS Authors Lorenzo Chen, Merck & Company,
New Sample Fractionation Strategies for Proteomic Analyses by LC MS
16 Current Trends in Mass Spectrometry November 2006 New Sample Fractionation Strategies for Proteomic Analyses by LC MS Mass spectrometry has long been a preferred tool for protein identification and
MOSAIQUES DIAGNOSTICS
MOSAIQUES DIAGNOSTICS CLINICAL PROTEOMICS IN DRUG DEVELOPMENT INFORMATION Clinical Proteomics for early and differential diagnosis FDA Letter of Support Possibilities of a companion test in Drug Development
The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Catalog Addendum
The University of Texas MD Anderson Cancer Center UTHealth 2016-2018 Catalog Addendum GSBS 2016-18 Catalog Addendum Table of Contents School Name Change... 1 Areas of Research Concentration Changes...
Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD
Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints
ProtPlot A Tissue Molecular Anatomy Program Java-based Data Mining Tool: Screen Shots
ProtPlot A Tissue Molecular Anatomy Program Java-based Data Mining Tool: Screen Shots **** DRAFT - undergoing revision **** Peter F. Lemkin, Ph.D. (1), Djamel Medjahed Ph.D. (2) 1 NCI-Frederick; 2 SAIC-Frederick,
Proteomics. Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Limitations: Examples
Proteomics Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Antibody arrays Protein activity arrays 2-D gels ICAT technology SELDI Limitations: protein sources surfaces and
Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
Two aspects of the regulation of gene expression : transcription and mrna polyadenylation
Two aspects of the regulation of gene expression : transcription and mrna polyadenylation Laboratoire de Génétique moléculaire de la Neurotransmission, Paris Director : Pr. Mallet Division of Molecular
The Institute of Microbiology of the Czech Academy of Sciences is looking for. four POSTDOCTORAL FELLOW positions in the fields of:
4 Postdoctoral Fellow positions in microbiology, molecular biology and ecology The Institute of Microbiology of the Czech Academy of Sciences, Prague, Czech Republic The Institute of Microbiology of the
NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?
The Five Key Elements of a Successful Metabolomics Study
The Five Key Elements of a Successful Metabolomics Study Metabolomics: Completing the Biological Picture Metabolomics is offering new insights into systems biology, empowering biomarker discovery, and
What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?
Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression
Do engineered ips and ES cells have similar molecular signatures?
Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series
Introduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
Center for Mass Spectrometry and Proteomics Phone (612) (612)
Outline Database search types Peptide Mass Fingerprint (PMF) Precursor mass-based Sequence tag Results comparison across programs Manual inspection of results Terminology Mass tolerance MS/MS search FASTA
Supplementary Data. Santiago Grijalvo and Ramón Eritja *
Supplementary Data Synthesis and in vitro Inhibition Properties of Oligonucleotide Conjugates Carrying Amphipathic Proline-rich Peptide Derivatives of the Sweet Arrow Peptide (SAP) Santiago Grijalvo and
Annex to the Accreditation Certificate D PL according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D PL 13372 01 00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 22.05.2014 to 25.03.2017
Blot: a spot or stain, especially of ink on paper.
Blotting technique Blot: a spot or stain, especially of ink on paper. 2/27 In molecular biology and genetics, a blot is a method of transferring proteins, DNA or RNA, onto a carrier (for example, a nitrocellulose,pvdf
Goals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
Biomarker Discovery: Proteome Fractionation and
Page 1 of 20 Articles in PresS. Physiol Genomics (December 27, 2007). doi:10.1152/physiolgenomics.00282.2007 Invited review Biomarker Discovery: Proteome Fractionation and Separation in Biological Samples
DISCOVERY AND VALIDATION OF TARGETS AND BIOMARKERS BY MASS SPECTROMETRY-BASED PROTEOMICS. September, 2011
DISCOVERY AND VALIDATION OF TARGETS AND BIOMARKERS BY MASS SPECTROMETRY-BASED PROTEOMICS September, 2011 1 CAPRION PROTEOMICS Leading proteomics-based service provider - Biomarker and target discovery
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
Molecular Biologist s Guide to Proteomics
MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, Mar. 2002, p. 39 63 Vol. 66, No. 1 1092-2172/02/$04.00 0 DOI: 10.1128/MMBR.66.1.39 63.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.
Genomics and Bioinformatics GMS6231 (3 credits)
Genomics and Bioinformatics GMS6231 (3 credits) COURSE DESCRIPTION: Principles of genomic characterization and bioinformatic analysis of eukaryotes, including an overview of analytical platforms, computational
3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-06 PROTEIN PURIFICATION AND PEPTIDE ISOLATION USING CHROMATOGRAPHY TRANSCRIPT Welcome to the proteomics course. Today, we will talk about protein purification and peptide isolation using chromatography
The Integrated Biomedical Sciences Graduate Program
The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to
TAMU: PROTEOMICS SPECTRA 1 What Are Proteomics Spectra? DNA makes RNA makes Protein
The Analysis of Proteomics Spectra from Serum Samples Jeffrey S. Morris Department of Biostatistics MD Anderson Cancer Center TAMU: PROTEOMICS SPECTRA 1 What Are Proteomics Spectra? DNA makes RNA makes
Biology 252 Nucleic Acid Methods
Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.
MOLECULAR BIOLOGY OF EUKARYOTES 2016 SYLLABUS
03-442 Lectures: MWF 9:30-10:20 a.m. Doherty Hall 2105 03-742 Advanced Discussion Section: Time and place to be announced Probably Mon 4-6 p.m. or 6-8p.m.? Once we establish who is taking the advanced
Year III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
Genome Biology and Biotechnology
Genome Biology and Biotechnology 10. The proteome Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course
2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
CSE Separation of Cancer Cell Lysate
Application Note: CSE Separation of Cancer Cell Lysate No. 9.200411 Rev. A 2004 Target Discovery, Inc. Target Discovery, Inc. 4015 Fabian Way Palo Alto, CA 94303 Tel: 650-812-8100 www.targetdiscovery.com/eotrol
ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide
ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide Protein name and full primary structure, by providing a NCBI (or UniProt) accession
Serial Analysis of Gene Expression
Serial Analysis of Gene Expression Cloning of Tissue-Specific Genes Using SAGE and a Novel Computational Substraction Approach. Genomic (2001) Hung-Jui Shih Outline of Presentation SAGE EST Article TPE
A modified Coomassie Brilliant Blue staining method at nanogram sensitivity compatible with proteomic analysis
Biotechnol Lett (2007) 29:1599 1603 DOI 10.1007/s10529-007-9425-3 ORIGINAL RESEARCH PAPER A modified Coomassie Brilliant Blue staining method at nanogram sensitivity compatible with proteomic analysis
Separating Proteins by pi-values Can 2D LC
Separating Proteins by pi-values Can D LC Replace D GE? Tyge Greibrokk, 1 Milaim Pepaj, 1 Elsa Lundanes, 1 Thomas Andersen and Katerina Novotna 1Department of Chemistry, University of Oslo, Norway, G&T
Chem Lecture 1 Introduction to Biochemistry Part 3
Chem 452 - Lecture 1 Introduction to Biochemistry Part 3 Question of the Day: This (last) week, big news was made in the field of genomic. It was not only reported in the journals Nature and Science, but
Application Note # ET-20 BioPharma Compass: A fully Automated Solution for Characterization and QC of Intact and Digested Proteins
Application Note # ET-20 BioPharma Compass: A fully Automated Solution for Characterization and QC of Intact and Digested Proteins BioPharma Compass TM is a fully automated solution for the rapid characterization
Gil Alterovitz Harvard-MIT Division of Health Science & Technology
Modern Biology in Two Lectures (Part II) Gil Alterovitz Course Administration andouts Open Courseware form- please turn in before leaving class Matlab form- for free copy of Matlab for students in class
Introduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
Bioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
Understanding life WITH NEXT GENERATION PROTEOMICS SOLUTIONS
Innovative services and products for highly multiplexed protein discovery and quantification to help you understand the biological processes that shape life. Understanding life WITH NEXT GENERATION PROTEOMICS
Fundamentals of Bioinformatics: computation, biology, computational biology
Fundamentals of Bioinformatics: computation, biology, computational biology Vasilis J. Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus A short self-introduction
Top-Down, Bottom-Up. The Merging of Two High-Performance Technologies
As featured in BioRadiations 129 Top-Down, Bottom-Up The Merging of Two High-Performance Technologies Authors: Enrique Dalmasso, Dominic Caseñas, and Shawn Miller Bio-Rad Laboratories, Inc. introduced
WakoPureChemical. No WakoPURE system Quick-CBB PLUS Silver Stain MS Kit Negative Gel Stain MS Kit Matrix for MALDI-TOFMS BAMBANKER
WakoPureChemical W P roduct U pdate Protein Research Cell Culture Silver Stain MS Kit Negative Gel Stain MS Kit Matrix for MALDI-TOFMS BAMBANKER No.0 004 Index Protein Research. in vitro Protein-Synthesizing
China National Grid --- BioNode. Jun Wang Beijing Genomics Institute
China National Grid --- BioNode Jun Wang Beijing Genomics Institute Core of life science and bio-tech: Getting, Mining, Applying the basic life information Old China meets New China? Sequencing, sequencing,
Proteomic analysis of biological fluids
Proteomic analysis of biological fluids Anne Gonzalez, CNRS-IPBS, Toulouse Équipe «Analyse Protéomique et Spectrométrie de Masse des Biomolécules» Odile Schiltz-Bernard Monsarrat Workshop «Protéomique
GENOMICS AND PROTEOMICS ANALYSES
GENOMICS AND PROTEOMICS ANALYSES Dr Joshua Boateng 21 /11 / 2011 Biotech and pharmaceutical companies spent $10 billion on hardware, software, and services in 2002. Source: Gartner The biotechnology/it
Proteomics Technology Note
Targeted Proteomics for the Identification of Nucleic Acid Binding Proteins in E. coli: Finding more low abundant proteins using the QSTAR LC/MS/MS System, Multi- Dimensional Liquid Chromatography, Pro
Monoclonal Antibody Characterization on Q Exactive and Oribtrap Elite. Yi Zhang, Ph.D Senior Proteomic Marketing Specialist Oct.
Monoclonal Antibody Characterization on Q Exactive and Oribtrap Elite Yi Zhang, Ph.D Senior Proteomic Marketing Specialist Oct. 12, 211 Outline Orbitrap Mass Spectrometer in mab Characterization Intact
Current and emerging services in proteomics and metabolomics through the Center for Mass Spectrometry and Proteomics
Current and emerging services in proteomics and metabolomics through the Center for Mass Spectrometry and Proteomics Pratik Jagtap, PhD Managing Director, CMSP z.umn.edu/cmsppresents Who are we? Center
rapiflex Innovation with Integrity Designed for Molecules that Matter. MALDI TOF/TOF
rapiflex Designed for Molecules that Matter. Innovation with Integrity MALDI TOF/TOF rapiflex TM The first MALDI-TOF/TOF that adapts to your needs. The rapiflex is the most advanced MALDI TOF/TOF system
Purification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open!
Lecture 11 Protein and Peptide Chemistry Margaret A. Daugherty Fall 2003 Purification: Step 1 Cells: Break them open! Crude Extract Total contents of cell Big Problem: Crude extract is not the natural
Purification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract
Purification: Step 1 Lecture 11 Protein and Peptide Chemistry Cells: Break them open! Crude Extract Total contents of cell Margaret A. Daugherty Fall 2003 Big Problem: Crude extract is not the natural
BIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology
BIOTECHNOLOGY Subject Code: BT Course Structure Sections/Units Section A Section B Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6 Unit 7 Section C Section D Section E Topics Engineering Mathematics General
Sequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
Recent Advancements in Analytical Methods of Drug Detection
Recent Advancements in Analytical Methods of Drug Detection Mario Thevis Gene and Cell Doping Symposium Beijing, June 5/6, 2013 www.wada-ama.org Challenges at the time accepted by anti-doping authorities
Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
Electro refers to electron flow or current. Thus Electrophoresis is movement under electric current.
ELECTROPHORESIS Electrophoresis Electro refers to electron flow or current. Phoresis refers to movement. Thus Electrophoresis is movement under electric current. This technique therefore can separate molecules
Types of chromatography
Chromatography Physical separation method based on the differential migration of analytes in a mobile phase as they move along a stationary phase. Mechanisms of Separation: Partitioning Adsorption Exclusion
Proteomics software at MSI. Pratik Jagtap Minnesota Supercomputing institute
Proteomics software at MSI. Pratik Jagtap Minnesota Supercomputing institute http://www.mass.msi.umn.edu/ Proteomics software at MSI. proteomics : emerging technology proteomics workflow search algorithms
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
Protein Techniques 1 APPENDIX TO CHAPTER 5
Protein Techniques 1 APPENDIX T CHAPTER 5 Dialysis and Ultrafiltration If a solution of protein is separated from a bathing solution by a semipermeable membrane, small molecules and ions can pass through
Determination of Isoelectric Point (pi) By Whole-Column Detection cief
Determination of Isoelectric Point (pi) By Whole-Column Detection cief Tiemin Huang and Jiaqi Wu CONVERGENT BIOSCIENCE Determination of Isoelectric Point (pi) by Whole Column Detection cief Definition
Proteomics and Mass Spectrometry Course plan
Proteomics and Mass Spectrometry 2013 The team Stephen Barnes, PhD Matt Renfrow, PhD Helen Kim, PhD 4-7117, MCLM 452 6-4681, MCLM 570 4-3880, MCLM 460A sbarnes@uab.edu Renfrow@uab.edu helenkim@uab.edu
Applied Blue Biotechnology Master
Applied Blue Biotechnology Master 1/8 Applied Blue Biotechnology Master Field : Sciences, Technologies, Santé Initial training Continuing training Block/release program 60 ECTS credits 2 semesters Course
Make the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
Vir B. Singh, PhD
, PhD Vir.Singh@roswellpark.org vir777@gmail.com Current Position Postdoctoral Research Associate at Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, NY, USA since
2D gels and other high-resolution separations and analysis of intact proteins in biological i l samples
February 2, 2010 2D gels and other high-resolution separations and analysis of intact proteins in biological i l samples Helen Kim 934-3880 helenkim@uab.edu Dept of Pharmacology and Toxicology McCallum
Precise Characterization of Intact Monoclonal Antibodies by the Agilent 6545XT AdvanceBio LC/Q-TOF
Precise Characterization of Intact Monoclonal Antibodies by the Agilent 6545XT AdvanceBio LC/Q-TOF Application Note Author David L. Wong Agilent Technologies, Inc. Santa Clara, CA, USA Introduction Monoclonal
Terminology for personalized medicine
Terminology for personalized medicine Sarah Ali-Khan 1 PhD, Stephanie Kowal 2, Westerly Luth 2, Richard Gold 1 SJD, and Tania Bubela 2 PhD JD 1. Centre for Intellectual Property Policy (CIPP), Faculty