NUCLEIC ACID. Subtitle

Transcription

1 NUCLEIC ACID Subtitle

2 NUCLEIC ACID Building blocks of living organisms One of the four important biomolecule 1 st isolated from the nuclei of white blood cells by Friedrich Miescher (1860) Came from the word nuclein = describe a weak acidic substance found in the cell nuclei Composed of the elements: CARBON, HYDROGEN, OXYGEN, NITROGEN and PHOSPHORUS Responsible for encoding, transmitting, and expressing genetic information Serve as the BLUEPRINT of life Formed from POLYMERIZATION of nucleotides

3 NUCLEOTIDE Building blocks of nucleic acid Three components: a) a PHOSPHORIC acid molecule phosphate (PO 3-4 ) b) a five carbon sugar molecule, PENTOSE c) a molecule of NITROGENcontaining base

4 NUCLEOTIDE Formed from a series of condensation reactions having the following characteristics: a) Condensation occurs between sugar & base, & between sugar & phosphate b) The base is always attached at the carbon-1 (C-1 ) position of the sugar. For purine bases, attachment happens through nitrogen-9 (N-9); for pyrimidine bases through N-1 c) The phosphate group is connected to the C-5 position of the sugar

5 DEOXYRIBONUCLEIC ACID (DNA) IS THE FIRST TYPE OF NUCLEIC ACID. Different from RNA due to the SUGAR molecule Prefix deoxy indicates a removal of oxygen atom (oxygen atom is removed fro a carbon atom of the sugar ribose)

6 DEOXYRIBONUCLEIC ACID (DNA) Prominent feature is its DOUBLE-HELIX structure (two chains that are coiled together; the bases are in the interior of the coils) Held together by H bonds between the bases

7 DEOXYRIBONUCLEIC ACID (DNA) Nitrogen-containing bases: PURINE & PYRIMIDINE 2 Purine bases: Adenine (A) and Guanine (G) 2 Pyrimidine bases: Thymine (T) and Cytosine (C)

8 DEOXYRIBONUCLEIC ACID (DNA) The double-helix comes apart when a cell divides Each chain contains the same genetic information and becomes a template for the production of a new complementary chain (GENETIC REPLICATION)

9 RIBONUCLEIC ACID (RNA) Single-stranded Essential in the process of building proteins from DNA 3 types of RNA a) TRANSFER RNA (trna) b) MESSENGER RNA (mrna) c) RIBOSOMAL RNA (rrna)

10 RIBONUCLEIC ACID (RNA) IS THE SECOND TYPE OF NUCLEIC ACID. Employs the same base pairing except for thymine: Cytosine- Guanine; Adenine-Uracil GENETIC TRANSCRIPTION is the process by which a DNA sequence is copied to produce a complementary strand of RNA by way of mrna. The 3 bases of code are known as CODON and their complementary in the trna are called ANTICODON

11 LINEAR PROGRESSION OF INFORMATION FROM DNA TO RNA TO PROTEIN

12 RIBONUCLEIC ACID (RNA) The 3 bases of code are known as CODON and their complementary in the trna are called ANTICODON

13 THE GENETIC CODE IN M-RNA

14 THERE ARE TWO TYPES OF NUCLEIC ACIDS. DNA Deoxyribonucleic Acid RNA Ribonucleic acid DEFINITION A nucleic acid that contains the genetic instructions used in the development and functioning of all modern living organisms (scientists believe that RNA may have been the main genetic material in primitive forms) A single-stranded chain of alternating phosphate and ribose units with the bases ADENINE, GUANINE, CYTOSINE, and URACIL bonded to the ribose. RNA molecules are involved in protein synthesis and sometimes in the transmission of genetic information.

15 THERE ARE TWO TYPES OF NUCLEIC ACIDS. DNA Deoxyribonucleic Acid RNA Ribonucleic acid JOB/ROLE Medium of long-term storage and transmission of genetic information Transfers the genetic code needed for the creation of proteins from the nucleus to the ribosome. UNIQUE FEATURES Helix geometry B-form Completely protected by the body, the body destroys enzymes that cleave DNA Can be damaged by exposure to ultra violet rays Helix geometry A-form Strands are continually made, broken down, and reused More resistant to damage by ultra violet rays

16 THERE ARE TWO TYPES OF NUCLEIC ACIDS. DNA Deoxyribonucleic Acid RNA Ribonucleic acid PREDOMINANT STRUCTURE Double-stranded molecule with long chain of nucleotides A single-stranded molecule in most of its biological roles and has a shorter chain of nucloetides BASES AND SUGARS Deoxyribose sugar Phosphate backbone Four bases: Adenine, Guanine, Cytosine, Thymine Ribose sugar Phosphate backbone Four bases: Adenine, Guanine, Cytosine, Uracil

17 THERE ARE TWO TYPES OF NUCLEIC ACIDS. PAIRING OF BASES STABILITY DNA Deoxyribonucleic Acid A-T (Adenine-Thymine) G-C (Guanine-Cytosine) Deoxyribose sugar is less reactive because of C-H bonds Stable in alkaline conditions Has smaller grooves which makes it harder for enzymes to attack DNA RNA Ribonucleic acid A-U (Adenine-Uracil) G-C (Guanine-Cytosine) Ribose sugar is more reactive because of the C-OH (hydroxyl) bonds Has larger grooves, which makes it easier to be attacked by enzymes PROPAGATION Self-replicating Synthesized from DNA when needed

18 DNA BASE PAIRING Write the complementary DNA strand for each given strand of DNA: C G T A A G C G C T A A T T A T C T T A A A T G A T C G A T

19 DNA BASE PAIRING Write the mrna strand for each given strand of DNA: C G T A A G C G C T A A T T A T C T T A A A T G A T C G A T

20 A. Fill in the complementary mrna strand: AGGUCAUGCAUGGGCAUGCAU AGAGAUUCAGCUAGCACGAUA B. Use the codon chart and translate the amino acid sequence for the given mrna strands above. Draw a line between the codons & below each codon write the 3-letter abbreviation.

21 A. Convert the following amino acid sequence to RNA and then to DNA. Is there more than one possible solution? The three-letter amino acid code is provided. D (Asp) A (Ala) N (Asn) C (Cys) E (Glu)

22