Hitting the target in phenotypic drug discovery: Advances in receptor deconvolution
|
|
- Erik Collins
- 6 years ago
- Views:
Transcription
1 Hitting the target in phenotypic drug discovery: Advances in receptor deconvolution Jim Freeth, Retrogenix, UK ELRIG Research and Innovation Meeting March 11th 2014
2 The right drug targets are critical for success Target selection may be one of the most important determinants of attrition and overall R&D productivity (analysis by Paul et al, Nat Rev Drug Disc, 2010) All linked to target selection (From Kola, Nat Rev Drug Disc, 3, 711, 2004)
3 Phenotype-led vs. Target-led Terstappen, Nat Rev Drug Disc, 2007 Target-led drug discovery Phenotype-led drug discovery
4 Percentage (number) Number of First-in-class NMEs A phenotype-led approach is very successful Phenotypic screening Target-based screening Modified natural substances Phenotypic screening Target-based screening 40 56% (28) % (17) % (5) 10 5 No apparent lag 0 First in First-in-class small molecule drug Year First-in-Class NMEs approved between 1999 and 2008, categorised by drug discovery approach (adapted from Swinney, Nat Rev Drug Disc, 2011)
5 Hypothesis-free target and lead discovery Library source Disease-relevant Phenotypic screen(s) PHENOTYPIC or FUNCTIONAL MOLECULES Target deconvolution NOVEL TARGETS & LEADS Target identity required for: Compound optimisation Understand safety/tox implications Novel IP Help regulatory package
6 Target deconvolution approaches Affinity-based 3D structures + PTMs maintained Molecule needs to be tethered Hard for low abundance targets Hard for low affinity interactions Lengthy Not ideal for membrane targets Expression cloning TARGET DECONVOLUTION Suppressionbased e.g. Y3H, M3H, Phage display Low abundance targets artificially increased Proteins may not be full-length Molecule needs to be tethered Not ideal for membrane targets Protein Arrays e.g. Suppression with cdna or biochemical fractions No chemical mods required Good for low affinity Hit may not be the actual target Biochemical approach poor for membrane targets All proteins screened equally Possible steric hindrance No cellular context Not ideal for membrane targets
7 Solving the membrane target deconvolution bottleneck: Cell Microarray technology Full-length human plasma membrane proteins expressed in natural human cell environment
8 Retrogenix has developed a unique, vast human plasma membrane (PM) protein screening set >3500 full-length, un-fused human plasma membrane proteins expressed 2600 unique PM genes 60% of total possible Largest set available Retrogenix s PM protein set by major classes Percentage of total possible by key sub-classes Unclassified 24% Transporters 21% Enzymes 7% Misc 12% Receptors 36% 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0%
9 Development of a robust technology Reverse transfection of human HEK293 cells with arrayed GFP vector Optimised transfection/expression conditions Optimised spot density and size Tight, spatially-separated transfected cell clusters Intra- and inter-experimental variability (CVs) <10%
10 Specific interaction between 3 H-naloxone and its primary target, m-opioid receptor Plasma membrane proteins 1 to 384 Plasma membrane proteins 385 to 768 Duplicate 1 Duplicate 2 Duplicate 1 Duplicate 2 Fluorescence** Phosphorescence m-opioid receptor [NB:**Variation in fluorescence expected as ZsGreen1 follows 1 st gene-ires sequence]
11 Retrogenix s target deconvolution process INPUT: Test molecules Workup detection system if required Confirm low background binding of test molecule(s) to humanhek293 cells Pre-screen Full screen Screen test molecule (or pool of molecules) at single dose against 3500 expressed membrane proteins Vectors sequenced to double-check their identity All protein hits are rearrayed and probed with each test molecule and negative controls Confirmation screen OUTPUT: Confirmed, specific interactors delivered in formal data package
12 384 of 2500 expressed PM proteins Uncovering an Unknown Target: A case study Test antibody vs human PM proteins (Primary screen) 7 hits are sequenced, re-expressed and and re-probed (Confirmation screen) Test antibody Negative control Ab ZsGreen1 ZsGreen1 Antibody detection Antibody detection 1 of 7 duplicate hits A confirmed, specific antibody target is uncovered Antibody name Format Rep. Av TE hit 1 hit 2 hit 3 hit 4 hit 5 hit 6 hit 7 EGFR -ve FCGR1A undisclosed FCGR2A undisclosed undisclosed undisclosed undisclosed Sequence verified (Y/N)--> Y Y Y Y Y Y Y Y Test sample murine IgG Fc fusion strong strong strong weak Test sample murine IgG Fc fusion strong strong strong weak Negative control murine IgG Fc fusion weak weak weak weak Negative control murine IgG Fc fusion weak weak weak
13 Case Study BioInvent s FIRST TM platform Conversion to full IgGs n-decoder TM phage library Differential biopanning using patient vs normal cells Functional testing In patient cells Target Id and target confirmation In vivo Testing Patient CLL cells versus normal PBMCs PCD and ADCC in patient materials i.e. combines antibody biology and target biology Targets/epitopes upregulated in disease Target and antibody biology combined from start Novel targets
14 High-throughput target deconvolution Primary screen: Pool of 20 mabs versus 2500 human PM proteins Hit 1 Confirmation/Matching Screen: Each mab profiled individually against all hits Spotting pattern (ZsGreen1) Protein set 1 of 7 Hit 2 Hit 3 (FCGR1A) Protein set 2 of 7 Hit 4 Hit 1 FCGR1A mab1 mab2 mab3....etc. Hit 7 FCGR1A FCGR1A Hit 5 Hit 7 Protein set 3 of 7, etc Hit 6 (FCGR2A) Hit 7 Hit 5 IGHG3 IGHG3 IGHG3 Novel, specific, cell surface target identified for each antibody
15 BioInvent Targets identified
16 Cell microarray is a powerful technology for deconvoluting receptor targets 60% hit rate for identification of targets for phenotypic antibodies High success rate due to human cell context Sensitive technology: Can identify um interactions Scalable
17 Scope of activities. ANTIBODIES Ab FRAGMENTS Fc-FUSION PROTEINS (Turner et al., June 2013) PROTEIN/PEPTIDE LIGANDS His-tagged V5-tagged Flag-tagged Biotinylated Directly fluorescently conjugated Protein-specific secondaries Polyclonal antisera (under review) Primary and/or secondary target Id PLASMA MEMBRANE TARGET Primary and/or secondary target Id LIVE VIRUSES SMALL MOLECULES ( 3 H-labelled)
18 Retrogenix technology identified the receptor associated with severe childhood malaria: Nature, June 2013
19 Summary Phenotypic drug discovery is a powerful approach to identify novel, disease-relevant targets Antibody-based PDD is gaining pace High throughput disease-relevant screens now possible Target deconvolution has traditionally been a bottleneck Cell microarray technology now provides a powerful solution for deconvolution of cell surface targets
ProteoGenix. Life Sciences Services and Products. From gene to biotherapeutics Target Validation to Lead optimisation
ProteoGenix Life Sciences Services and Products From gene to biotherapeutics Target Validation to Lead optimisation ProteoGenix Philippe FUNFROCK, founder and CEO French company located in Strasbourg,
More informationFRAUNHOFER IME SCREENINGPORT
FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationApplications of HTRF and Tag-lite Assays for HTP Antibody Screening
Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Brigitte Devaux, PhD Bristol Myers Squibb, Redwood City CA HTRF Symposium April 25, 2013 1 Introduction Generate human therapeutic antibodies
More informationRevised Immunogenicity Guideline: Assays and methods- Presentation of the draft guideline and introduction of the topics for discussion
Revised Immunogenicity Guideline: Assays and methods- Presentation of the draft guideline and introduction of the topics for discussion Robin Thorpe & Meenu Wadhwa Revised Guideline: Differences from original
More informationKinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)
Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationIntroduction to Assay Development
Introduction to Assay Development A poorly designed assay can derail a drug discovery program before it gets off the ground. While traditional bench-top assays are suitable for basic research and target
More informationProteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125
Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher
More informationAntibody Structure. Antibodies
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationAntibody Structure supports Function
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationThe Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More informationRecombinant Antibody Production in Therapeutic Antibody Projects. Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016
Recombinant Antibody Production in Therapeutic Antibody Projects Keshav Vasanthavada Senior Marketing Specialist, GenScript April 7, 2016 Presentation Outline 1 2 3 4 5 Introduction Recombinant Ab Production
More informationApplication Note AN001
Testing hybridoma supernatants with the Spots On Dots Antibody Screening Kit Application Note AN1 Table of Contents Overview... 2 Figure 1. Screening of hybridomas raised against peptide antigens... 3
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationGenome Biology and Biotechnology
Genome Biology and Biotechnology 10. The proteome Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course
More informationProteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples
Proteomics Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Antibody arrays Protein activity arrays 2-D gels ICAT technology SELDI Limitations: protein sources surfaces and
More informationAntibody Services from GenScript
Services from GenScript www.genscript.com GenScript USA Inc. 860 Centennial Ave., Piscataway, NJ 08854 USA Toll-Free: 1-877-436-7274 Fax: 1-732-210-0262 1-732-855-5878 Academic Services Pharmaceutical
More informationPeptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST
Peptide libraries: applications, design options and considerations Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Overview 1 2 3 4 5 Introduction Peptide library basics Peptide library design considerations
More informationUniversity of Pennsylvania Perelman School of Medicine High Throughput Screening Core
University of Pennsylvania Perelman School of Medicine High Throughput Screening Core Sara Cherry, Ph. D. David C. Schultz, Ph. D. dschultz@mail.med.upenn.edu (215) 573 9641 67 John Morgan Building Mission
More informationSPHERO TM Coated Particles
SPHERO TM Coated Particles Manufactured by either passive adsorption or covalent coupling depending upon the intended application Stable for several years under proper storage condition Available in a
More informationGala s Gene Product Expression (GPEx ) Platform
Gala Biotech A Company with Gene Insertion and Manufacturing Technologies for the Next Generation of Gene Expression and Biologics Production Gala s Gene Product Expression (GPEx ) Platform Rapid creation
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationTracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology. Chad Zimprich January 2015
Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology Chad Zimprich January 2015 Presentation verview HaloTag Fusion Technology Design Functionality
More informationProteomics. Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Limitations: Examples
Proteomics Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Antibody arrays Protein activity arrays 2-D gels ICAT technology SELDI Limitations: protein sources surfaces and
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationIntroduction to Protein Purification
Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography
More informationAssessing and Controlling Potency of Vector and Drug Product for Chimeric Antigen Receptor T Cells
Assessing and Controlling Potency of Vector and Drug Product for Chimeric Antigen Receptor T Cells David M, Hambly, Ph.D. Director, Analytical Development April 4th, 2016 Forward Looking Statements/Safe
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationDesign and Validation of a Non Cell-based Receptor Binding Assay for the Detection of Neutralizing Antibodies to a Biological Therapeutic
Design and Validation of a Non Cell-based Receptor Binding Assay for the Detection of Neutralizing Antibodies to a Biological Therapeutic Shalini Gupta Associate Director Amgen, Thousand Oaks, CA shalinig@amgen.com
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationPD-1 Pathway Recombinant Protein Collection
Pathway Recombinant Protein Collection www.acrobiosystems.com Content I. Introduction II. Biotinylated Pathway Proteins IIa. ELISA IIb. FAC Sorting IIc. Biopanning III. HPLC-verified Proteins IV. Full-length
More informationDrug Discovery Research Clinical Screening. Comparison of ELISA and AlphaScreen Assay Technologies for Measurement of Protein Expression Levels
Drug Discovery Research Clinical Screening FLAG Expression Measurement Application Note Comparison of ELISA and AlphaScreen Assay Technologies for Measurement of Protein Expression Levels ALPHASCREEN APPLICATION
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationAntibodies and Antigens in the Blood Bank 9/7/2015 NAHLA BAKHAMIS 1
Antibodies and Antigens in the Blood Bank NAHLA BAKHAMIS 9/7/2015 NAHLA BAKHAMIS 1 Outline Antibodies structure, classes and functions Most important Abs in the blood bank effective roles of Abs Zeta potential
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationChapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology
Chapter 17: Immunization & Immune Testing 1. Immunization 2. Diagnostic Immunology 1. Immunization Chapter Reading pp. 505-511 What is Immunization? A method of inducing artificial immunity by exposing
More informationImmunoglobulins. Harper s biochemistry Chapter 49
Immunoglobulins Harper s biochemistry Chapter 49 Immune system Detects and inactivates foreign molecules, viruses, bacteria and microorganisms Two components with 2 strategies B Lymphocytes (humoral immune
More informationSmall-Molecule Drug Target Identification/Deconvolution Technologies
Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily
More informationDevelopment of an Immunoprecipitation and LC-MS/MS based Method for Quantifying the 105 kda Recombinant Protein SXN in Plasma.
Development of an Immunoprecipitation and LC-MS/MS based Method for Quantifying the 105 kda Recombinant Protein SXN101959 in Plasma. Richard Kay Principal Scientist, Bioanalytical Sciences, Quotient Bioresearch
More informationMake Your Immunology Research Easy. Kun YIN Associate Director of Marketing Division, GenScript
Make Your Immunology Research Easy Kun YIN Associate Director of Marketing Division, GenScript GenScript Overview Branch Office Amsterdam, Netherlands Branch Office Tokyo, Japan Headquarter, New Jersey,
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationMagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study
MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions
More informationNewsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions
www.iba-biotagnology.com Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions Strep-tag and One-STrEP-tag PPI Analysis with the co-precipitation/ mass spectrometry approach 3 Background
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationProteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
More informationIdentification of Critical Product Quality Attributes: Impact of Product Variants on Safety and Efficacy
Identification of Critical Product Quality Attributes: Impact of Product Variants on Safety and Efficacy Ziping Wei, Ph.D. Analytical Biochemistry MedImmune January 25, 2010 Outline Why do we need to identify
More informationQualifying SPR immunogenicity assays Dr. Christian Kühne
Qualifying SPR immunogenicity assays Dr. Christian Kühne Bioagilytix / IPM Biotech global CRO for large molecule bioanalysis supporting pre-clinical & clinical studies Biomarker, Pharmacokinetics, Immunogenicity
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationAntibody Analysis by ESI-TOF LC/MS
Application Note PROTEOMICS METABOLOMICS GENOMICS INFORMATICS GLYILEVALCYSGLUGLNALASERLEUASPARG CYSVALLYSPROLYSPHETYRTHRLEUHISLYS Antibody Analysis by ESI-TOF LC/MS Authors Lorenzo Chen, Merck & Company,
More informationDharmacon TM solutions for studying gene function
GE Healthcare Capabilities Overview Dharmacon TM solutions for studying gene function RNAi Gene Expression Gene Editing RNA Interference Our RNAi products encompass the most complete portfolio of innovative
More informationMake High Quality Affordable
Protein Antibody Gene Kit Cell Lysate Fc receptor Antibody Cancer antigen ed NK-Cell le as Cancer-Cell Perfo r i n a n d G r a n zy r me e Make Quality Affordable Fc receptor Function and s Function:,
More informationStructural variation. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona
Structural variation Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Genetic variation How much genetic variation is there between individuals? What type of variants
More informationReal-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent
Nicola Bevan, Tim Dale, Del Trezise Essen BioScience Welwyn Garden City, Hertfordshire, UK Introduction Monoclonal antibodies are now widely used as anti-cancer, antiinflammatory and anti-viral therapeutic
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationAPPROACHES TO IMPROVING THE PERFORMANCE OF MAMMALIAN CELL CULTURES FOR PROTEIN PRODUCTION
BioLOGIC USA BOSTON, 20 th OCTOBER 2004 APPROACHES TO IMPROVING THE PERFORMANCE OF MAMMALIAN CELL CULTURES FOR PROTEIN PRODUCTION Dr Robert Gay Lonza Biologics 2004 The Challenge of the MAb Market Global
More informationHighly Confident Peptide Mapping of Protein Digests Using Agilent LC/Q TOFs
Technical Overview Highly Confident Peptide Mapping of Protein Digests Using Agilent LC/Q TOFs Authors Stephen Madden, Crystal Cody, and Jungkap Park Agilent Technologies, Inc. Santa Clara, California,
More informationBasic Antibody Structure. Multiple myeloma = cancerous plasma cells Monomer = 150,000. Chapter 4. Immunoglobulin Structure and Function
Chapter 4. Immunoglobulin Structure and Function. Functional Regions. Types of chains. Constant & Variable regions 4. Glycoprotein * * * Heavy chain= 446 aa Light chain= 4aa Each heavy and light chain
More informationMSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.
MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput
More informationADCC Reporter Bioassay: A Novel, Bioluminescent Cell-Based Assay for Quantifying Fc Effector Function of Antibodies
ADCC Reporter Bioassay: A Novel, Bioluminescent Cell-Based Assay for Quantifying Fc Effector Function of Antibodies Richard Somberg, Ph.D. October 2012 Outline Introduction to ADCC Problem with classic
More informationB-cell Epitope Prediction and Cloning monoclonal ADAs
B-cell Epitope Prediction and Cloning monoclonal ADAs Stefan Ryser, CEO, Trellis Bioscience 3 rd International Symposium on Higher Order Structure of Protein Therapeutics Arlington, Virginia, February
More informationAntibodies and Antigens In the blood bank
Antibodies and Antigens In the blood bank 1 Nice game!! http://nobelprize.org/ 2 Karl Landsteiner discovered blood groups in 1901. Awarded Nobel Prize for Physiology or Medicine in 1930 3 Why we study
More informationAccelerate mab Characterization Using Automated Sample Prep
Accelerate mab Characterization Using Automated Sample Prep David Knorr, Ph.D. Automation Solutions Ning Tang, Ph.D. LC/MS 15 February 2012 Page 1 Protein Sample Processing Workflows Glycan Profiling Biological
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationDigitally Programmed Cells
Digitally Programmed Cells Ron Weiss PI: Tom Knight MIT Artificial Intelligence Laboratory Goal Process-Control Cellular Computers -- Microbial Robotics Unique features: small, self-replicating, energy-efficient
More informationQImaging Camera Application Notes Multicolor Immunofluorescence Imaging
QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody
More informationUse of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity
A p p l i c a t i o n N o t e Use of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity Brad Larson and Peter Banks, Applications Department, BioTek Instruments, Inc.,
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationCriteria For Choosing a Virus-Like Display Platform
Criteria For Choosing a Virus-Like Display Platform Immunogenicity Potential Antigen Display Potential Production Potential Intellectual Property Issues Immunogenicity Potential Particulate - uptake by
More information3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors
3. Results 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors To investigate the dimerisation of the endothelin receptor subtypes HEK293 cells were stably transfected with plasmids
More informationBiomarker Discovery using Surface Plasmon Resonance Imaging
F e a t u r e A r t i c l e Feature Article Biomarker Discovery using Surface Plasmon Resonance Imaging Elodie LY-MORIN, Sophie BELLON, Géraldine MÉLIZZI, Chiraz FRYDMAN Surface Plasmon Resonance (SPR)
More informationTowards New Medicines? The Importance of Biological Target Validation in Drug Discovery
Towards New Medicines? The Importance of Biological Target Validation in Drug Discovery David Haigh Professor in Medicinal Chemistry & Head of Drug Discovery Centre for Cancer Research & Cell Biology Queen
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationUnique PK-PD properties of biotechnology-based therapeutics [mabs] and First In Human dose considerations. [mabs -monoclonal antibodies ] Peter Lloyd
Unique PK-PD properties of biotechnology-based therapeutics [mabs] and First In Human dose considerations [mabs -monoclonal antibodies ] Peter Lloyd Head of Pharmacokinetics-Pharmacodynamics Novartis Biologics
More informationMBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications
MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein
More informationDevelopment of antibody colocalization microarrays: A new chip format for large scale, high throughput protein profiling
Micro & Nanobioengineering Lab Biomedical Engineering Department McGill University Development of antibody colocalization microarrays: A new chip format for large scale, high throughput protein profiling
More informationImmunogenicity Assay Considerations
Immunogenicity Assay Considerations Jochem Gokemeijer Jochem.gokemeijer@bms.com Bioassays and Bioanalytics Method Development, Berkley CA October 8 th 2013 Multi Tiered Immunogenicity Assay Approach Screening
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationCase Study: A Phase-Driven Approach to the Development and Lifecycle Management of Potency Assays. Spring in New England!!!
Case Study: A Phase-Driven Approach to the Development and Lifecycle Management of Potency Assays CASSS Bioassays 2016: Scientific Approaches & Regulatory Strategies Session Potency Assays: Cell-based
More informationFlow CAST : Testing Potency and Efficacy of Inhibitors of PI3K δ, PI3Kγ, BTK and SYK Activity
Flow CAST : Testing Potency and Efficacy of Inhibitors of PI3K δ, PI3Kγ, BTK and SYK Activity Michele Romano, PhD Product Manager Flow CAST is for Research Use Only. Not for use in diagnostic procedures.
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationBCH 462. Single Radial Immunodiffusion and Immuno-electrophoresis
BCH 462 Single Radial Immunodiffusion and Immuno-electrophoresis Immunoassays tests include: 1. Precipitation. 2. Agglutination. 3. Immunofluorescence. 4. Radioimmunoassay (RIA). 5. Enzyme-Linked Immuno
More informationNovel T cell antigen discovery technology providing new momentum on a malaria vaccine
Novel T cell antigen discovery technology providing new momentum on a malaria vaccine World Vaccine Congress 2012 Best Vaccine Startup 2008 Jessica Baker Flechtner, PhD Vice President, Research Genocea
More informationA PROTEIN INTERACTION NETWORK OF THE MALARIA PARASITE PLASMODIUM FALCIPARUM
A PROTEIN INTERACTION NETWORK OF THE MALARIA PARASITE PLASMODIUM FALCIPARUM DOUGLAS J. LACOUNT, MARISSA VIGNALI, RAKESH CHETTIER, AMIT PHANSALKAR, RUSSELL BELL, JAY R. HESSELBERTH, LORI W. SCHOENFELD,
More informationPV92 PCR Bio Informatics
Purpose of PCR Chromosome 16 PV92 PV92 PCR Bio Informatics Alu insert, PV92 locus, chromosome 16 Introduce the polymerase chain reaction (PCR) technique Apply PCR to population genetics Directly measure
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationStrategies for Assessment of Immunotoxicology in Preclinical Drug Development
Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects
More informationmcherry Polyclonal Antibody Catalog Number PA Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Polyclonal Antibody Catalog Number PA5-34974 Product data sheet Details Size
More informationPurification of alpha-1 antitrypsin using an antibody based affinity chromatography medium
Purification of alpha-1 antitrypsin using an antibody based affinity chromatography medium Ulrika Meyer a, Hanna Wlad a, Sven Blokland b, Frank J.M. Detmers b and Henrik Ihre a a GE Healthcare Bio-Sciences
More informationStrategy for Selecting NAb Assay Format
Strategy for Selecting NAb Assay Format European Bioanalysis Forum 27Sept2016 Jim McNally, Ph.D. Associate Director, Global Early Development Head of Clinical Bioanalytics Merck KGaA AAPS Working Group
More informationCyTOF 2. Mass Cytometry System
CyTOF 2 Mass Cytometry System Discover more. Imagine more. CyTOF Applications Mass Cytometry. The Future of Cytometry Today. Mass cytometry resolves multiple metal probes per cell with minimal signal overlap,
More informationBiacore X100. GE Healthcare Life Sciences. Biacore X100 Plus Package. Biacore X100 delivers:
GE Healthcare Life Sciences Data file 28-9592-29 AB Biacore label-free interaction analysis Biacore X100 Biacore X100 (Fig 1) is an automated and versatile system for comprehensive, label-free analysis
More informationMaximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y. Report Price Publication date
F o r a c l e a r e r m a r k e t p e r s p e c t i v e Early Stage Drug Safety Strategies & Risk Management Maximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y Report
More informationYour Antibody Source. prosci-inc.com. Extensive Antibody Services Broad Antibody Catalog
Your Source prosci-inc.com Extensive Services Broad Catalog Company Overview Established in 1998, ProSci Incorporated is a leading provider of high performance antibodies and custom antibody services.
More informationHeme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive
Supplemental Data Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive gene-2 Caiyong Chen 1, Tamika K. Samuel 1, Michael Krause 2, Harry A. Dailey 3, and Iqbal
More information