COMPUTER RESOURCES II:

Size: px
Start display at page:

Download "COMPUTER RESOURCES II:"

Transcription

1 COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer lab, we discussed how using the computer is important to modern-day cell biologists. In this lab, we will use the computer to analyze a DNA sequence that will be provided to you. You will examine this DNA sequence for a protein coding region (often referred to as an open reading frame or ORF s). Once you determine the protein most likely coded for by this piece of DNA, you will take the translated protein sequence and access an online database to figure out what protein it encodes. Finally, you will use an organism-specific database to learn more about your protein. Before you begin the computer work, your TA will be giving you a short double-stranded DNA sequence and will ask you to translate, using the codon tables below (see next page), this DNA sequence into the six possible reading frames. Please complete this assignment first, hand it in to the TA, and then proceed to the next part of the lab. To begin the computer-assisted translation, get your DNA sequence from your TA. Note that this DNA sequence contains the entire Open Reading Frame (ORF) for a yeast (Saccharomyces cerevisiae) gene. There are a few important details to note: The protein encoded by the DNA sequence is greater than 80 amino acids long. The DNA sequence your TA has given you does not contain any introns. (Only 5% of S. cerevisiae genes contain introns, unlike human genes where essentially all protein-coding genes contain introns. It is simpler to do the bioinformatics of protein prediction using DNA without introns.) This sequence is a single strand of DNA. By convention, the first nucleotide is at the 5 end and the last nucleotide is at the 3 end. The reverse complement of this strand can be easily inferred from the sequence you have. Step 1: Figure out the protein sequence that your DNA sequence encodes Since we have told you the DNA sequence you have encodes a protein, you should be able to figure out what protein it encodes. You should recall from class that the DNA code is translated into protein by the use of trnas that recognize DNA as triplets.

2 The genetic code is provided below (from Figure 7-24 of Essential Cell Biology, ed. 3): Here is an alternative layout of the genetic code: You should also recall how the ribosome translates an mrna molecule (see Figures 7-33, 7-34, and 7-37 in Essential Cell Biology, ed. 3 for review). One way to translate your DNA sequence is to compare the sequence to the genetic code by hand and determine the proteins that could potentially be encoded by the DNA. There are also computer programs that can do this same thing. However, you should understand conceptually

3 how to translate DNA into protein, just like you should know how to add even though you own a calculator. A particularly good program to translate DNA into protein is JavaScript DNA Translator 1.1. This program can be found at: To use this program: Copy the sequence that your TA gave you and paste it in the box labeled Sequence: DNA Only or FASTA format. Using the menus, you can choose to receive the output in either a 3-letter Amino Acid representation or a 1-letter Amino Acid representation. Choose 1-letter. Be sure to choose 6 reading frames for the Reading Frame. The Line Length choice determines how long the lines of your output file is; the default of 60 is fine. When you are setting up your translations, UNCHECK the box that says Display Translations of ORFs of at least The bottom selections of your computer screen should look like: Now, hit the button that says Translate and you will get the output on another window in your browser. (Be patient, it can take a few seconds!) Examine the output file. At the top, you will see the six-frame translation of your DNA sequence. At the bottom of the window, you will see the six translations listed separately.

4 1. Scroll to the bottom of the output window. You will see the six translations in six reading frames, highlighted in yellow. From these translations, determine which is the most likely ORF that encodes your protein. Hint: look for the longest possible ORF, starting with methionine and ending with a stop codon, which is indicated with an asterisk (*). Note the number of the frame that encodes this ORF. Copy this ORF, from methionine to the last amino acid, and paste it into the Word file with your gene, below the gene sequence. 2. Now look at the printout of your output, and find the DNA codon that encodes the first methionine in your ORF (methionine is encoded by AUG in the RNA which corresponds to ATG in the DNA). In the output window, amino acid letters are positioned above the first nucleotide in each codon. Circle this ATG in your printout. Now return to your Word file with your gene sequence, find that codon in the sequence, and highlight it using BOLD face and 16 point font. Note that if your gene is encoded by reading frames 4, 5, or 6 (on the bottom strand of your DNA), then you have to be looking closer to the end of your gene s sequence, and looking for the codon which is complementary to ATG. (The reason for this is that in the Word file, only one strand is provided as your gene sequence, which the translator program understands as the top strand by default.) 3. Look at your printout again, and find the DNA codon which corresponds to the translation stop signal. These codons are TAA, TAG, or TGA, and will correspond to the asterisk at the end of your ORF. Circle the stop codon in your printout, and return to the Word file with your gene. Find the stop codon there and highlight it by using underline and 16 point font. Again, remember that if your gene is in frame 4, 5, or 6, you have to be looking somewhere in the beginning of your sequence, and searching for a codon which is complementary to TAA, TAG, or TGA. Again, this is because only the top strand is given as the sequence for your gene in the Word file. 4. Print your amended sequence file. Step 2: Find out the name of the protein that your DNA encodes. Now that you have the protein sequence that your DNA encodes, we can use the databases to figure out what the name of that protein is. As you are probably aware, concerted efforts to determine the full DNA sequences of many different organisms have been undertaken (also referred to as genome projects, since these efforts are to determine the composition of a genome of a particular species). The Saccharomyces cerevisiae genome was first completed in 1996 and was the first complete eukaryotic genome to be sequenced. Since then, many other genomes have been completed (including the first draft of the human genome, completed in 2001). The DNA sequences obtained from these genome projects are available in public databases, and many programs exist that can assist you in searching these databases. Additionally, the predicted proteins encoded by these DNA sequences can be determined as well, in a similar manner as you did in Step 1 above; these predicted protein sequences have also been deposited into publicly available databases.

5 One of the more commonly used programs to search the DNA databases is BLAST (Basic Local Alignment Search Tool), developed by the National Center for Biotechnology Information (NCBI). BLAST can be used in different ways: to compare a DNA sequence to DNA sequences in the databases (blastn). to compare an amino acid sequence to protein sequences in the databases (blastp). to compare a DNA sequence translated in all six reading frames to all protein sequences in the databases (blastx). You can access BLAST searches against ALL publicly available databases at: However, since we know that you have a yeast protein, we are instead going to use a portal specifically designed for analyzing genomic information related to S. cerevisiae. This way when you search for your protein sequence, you will not get all theoretical matches, but only those matches that are in the S. cerevisiae genome. You will also be able to more easily obtain other information about your gene. Point your browser to: bin/blast sgd.pl Paste in your translated protein sequence into the box that says Type or Paste a Query Sequence. At the first drop down menu, choose blastp as the appropriate BLAST program. In the second box with options, choose Open Reading Frames (DNA or Protein). Leave everything as the default, and push the button to Run WU- BLAST. A new page will come up giving you your BLAST search results. At the top of the page will be a graphical interface depicting the highest significant matches from the S. cerevisiae protein database. For a beginner, a conceptually more simple output can be found at the middle of the page, with results that look like:

6 These results above are for a blastp search using a protein sequence of 388 amino acids against the database containing the translation of all standard S. cerevisiae ORFs. You can see a list of many sequences that produce high-scoring segment pairs with your protein query sequence. What this list details is, for the first high-scoring segment above: the official ORF name in bold (YPR043W) the gene name (SMK1; this is also the name of the protein) the database ID (SGDID:S ) a brief description (Chr XVI from ) the BLAST score, in arbitrary units (2053; note a larger number indicates a more significant match compared to a smaller number) the probability that your match was random (3.8e-214; the smaller the less likely it was random) You can see that the results are sorted, with the highest-scoring match being presented first. If you now click on the probability (also called E value) above in blue (today it may be pink), you skip to the area on that page which aligns the amino acid sequence matches between your query sequence and the one obtained by BLAST. Since you know that your DNA encodes a S. cerevisiae protein, your query should be an exact match with the protein identified by blastp. The other proteins on the list are proteins that have some similarity to your query, but should not be an exact match. For the query above, the best match was the SMK1 gene, encoded by ORF number YPR043w. The alignment looks like this:

7 4. You should write down the ORF name and gene name of the best match with the protein sequence that you queried. Put this information on a new line BELOW where you pasted the protein sequence. Step 3: Learn something about the protein you are researching. Now that you know the name of the protein, use the yeast database to learn something about its characteristics. There are many ways to go about doing this. The simplest method is as follows: Point your browser to: This is the home page of the Saccharomyces Genome Database (SGD), and contains a great deal of information about research involving Saccharomyces research. For example, if you were to click on the Virtual Library link on the left (under External Links ), you would pull up a page that includes other links to information about yeasts, including Yeast information for the nonspecialist. If you were to click on the BLAST link on the left (under Analysis and Tools ), you would arrive at the page you used previously to determine what the name of the gene that encoded your protein. At the top of the page is a Quick Search Box. Enter either the ORF number or the gene name and hit Submit. You should arrive at a summary page that has a lot of information about your gene. The top of the page will look something like this:

8 Spend some time scrolling around and clicking on the various links, including the tabs at the top of the page (i.e., Locus History, Literature, Phenotype, etc.) and the pull-down menus on the left hand side. To complete this laboratory exercise, figure out the following information about your protein using SGD, and put this information in the file you ve been working on. 5. What chromosome is this gene on? 6. Provide the reference for a scientific paper that includes information about this gene. 7. What is the predicted molecular weight (MW) in Daltons (Da) for your protein? For extra credit: 8. Does this gene have human homologs, and if so, give the name of one of the human homologs? Print out your file with the sequence you were given and the answers to questions 1-7 (or 1-8, if you did the extra credit), and give it to your TA before you leave the lab.

Hands-On Four Investigating Inherited Diseases

Hands-On Four Investigating Inherited Diseases Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise

More information

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?

MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome

More information

BLAST. Subject: The result from another organism that your query was matched to.

BLAST. Subject: The result from another organism that your query was matched to. BLAST (Basic Local Alignment Search Tool) Note: This is a complete transcript to the powerpoint. It is good to read through this once to understand everything. If you ever need help and just need a quick

More information

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5 Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate

More information

DNA is normally found in pairs, held together by hydrogen bonds between the bases

DNA is normally found in pairs, held together by hydrogen bonds between the bases Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,

More information

Protein Synthesis. Lab Exercise 12. Introduction. Contents. Objectives

Protein Synthesis. Lab Exercise 12. Introduction. Contents. Objectives Lab Exercise Protein Synthesis Contents Objectives 1 Introduction 1 Activity.1 Overview of Process 2 Activity.2 Transcription 2 Activity.3 Translation 3 Resutls Section 4 Introduction Having information

More information

Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does

More information

Written by: Prof. Brian White

Written by: Prof. Brian White Molecular Biology II: DNA Transcription Written by: Prof. Brian White Learning Goals: To work with a physical model of DNA and RNA in order to help you to understand: o rules for both DNA & RNA structure

More information

SAMPLE LITERATURE Please refer to included weblink for correct version.

SAMPLE LITERATURE Please refer to included weblink for correct version. Edvo-Kit #340 DNA Informatics Experiment Objective: In this experiment, students will explore the popular bioninformatics tool BLAST. First they will read sequences from autoradiographs of automated gel

More information

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

Transcription and Translation

Transcription and Translation Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism

More information

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz] BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

BIO 101 : The genetic code and the central dogma

BIO 101 : The genetic code and the central dogma BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

Why Use BLAST? David Form - August 15,

Why Use BLAST? David Form - August 15, Wolbachia Workshop 2017 Bioinformatics BLAST Basic Local Alignment Search Tool Finding Model Organisms for Study of Disease Can yeast be used as a model organism to study cystic fibrosis? BLAST Why Use

More information

FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1)

FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) 1.1 Finding a gene using text search. Note: For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium.

More information

The Chemistry of Genes

The Chemistry of Genes The Chemistry of Genes Adapted from Success in Science: Basic Biology Key Words Codon: Group of three bases on a strand of DNA Gene: Portion of DNA that contains the information needed to make a specific

More information

Evolutionary Genetics. LV Lecture with exercises 6KP

Evolutionary Genetics. LV Lecture with exercises 6KP Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP HS2017 >What_is_it? AATGATACGGCGACCACCGAGATCTACACNNNTC GTCGGCAGCGTC 2 NCBI MegaBlast search (09/14) 3 NCBI MegaBlast search (09/14) 4 Submitted

More information

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

More information

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Gene Identification in silico

Gene Identification in silico Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

More information

Sequence Analysis Lab Protocol

Sequence Analysis Lab Protocol Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136

More information

Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13

Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino

More information

Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST

Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by T. Cordonnier, C. Shaffer, W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Recommended Background

More information

Protein Synthesis. OpenStax College

Protein Synthesis. OpenStax College OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will

More information

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

Ch 10.4 Protein Synthesis

Ch 10.4 Protein Synthesis Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains

More information

Computational gene finding. Devika Subramanian Comp 470

Computational gene finding. Devika Subramanian Comp 470 Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) The biological context Lec 1 Lec 2 Lec 3 Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Genome and DNA Sequence Databases. BME 110: CompBio Tools Todd Lowe April 5, 2007

Genome and DNA Sequence Databases. BME 110: CompBio Tools Todd Lowe April 5, 2007 Genome and DNA Sequence Databases BME 110: CompBio Tools Todd Lowe April 5, 2007 Admin Reading: Chapters 2 & 3 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring07/bme110-calendar.html

More information

Activity A: Build a DNA molecule

Activity A: Build a DNA molecule Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

Solutions to Quiz II

Solutions to Quiz II MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1

More information

From AP investigative Laboratory Manual 1

From AP investigative Laboratory Manual 1 Comparing DNA Sequences to Understand Evolutionary Relationships. How can bioinformatics be used as a tool to determine evolutionary relationships and to better understand genetic diseases? BACKGROUND

More information

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the

More information

Genomics and Gene Recognition Genes and Blue Genes

Genomics and Gene Recognition Genes and Blue Genes Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum

More information

O C. 5 th C. 3 rd C. the national health museum

O C. 5 th C. 3 rd C. the national health museum Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016 Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints

More information

Pre-Lab: Molecular Biology

Pre-Lab: Molecular Biology Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

Chapter 14 Active Reading Guide From Gene to Protein

Chapter 14 Active Reading Guide From Gene to Protein Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single

More information

Chimp Sequence Annotation: Region 2_3

Chimp Sequence Annotation: Region 2_3 Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

AP BIOLOGY. Investigation #3 Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST. Slide 1 / 32. Slide 2 / 32.

AP BIOLOGY. Investigation #3 Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST. Slide 1 / 32. Slide 2 / 32. New Jersey Center for Teaching and Learning Slide 1 / 32 Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and

More information

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

More information

Gene Expression. Student:

Gene Expression. Student: Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

If Dna Has The Instructions For Building Proteins Why Is Mrna Needed

If Dna Has The Instructions For Building Proteins Why Is Mrna Needed If Dna Has The Instructions For Building Proteins Why Is Mrna Needed if a strand of DNA has the sequence CGGTATATC, then the complementary each strand of DNA contains the info needed to produce the complementary

More information

Unit #5 - Instructions for Life: DNA. Background Image

Unit #5 - Instructions for Life: DNA. Background Image Unit #5 - Instructions for Life: DNA Introduction On the following slides, the blue sections are the most important. Underline words = vocabulary! All cells carry instructions for life DNA. In this unit,

More information

Sequencing the Human Genome

Sequencing the Human Genome Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data

More information

BIOB111 - Tutorial activity for Session 13

BIOB111 - Tutorial activity for Session 13 BIOB111 - Tutorial activity for Session 13 General topics for week 7 Session 13: Types of nucleic acids, DNA replication Useful links: 1. Visit this website and use its menu to locate information and practice

More information

NOTES Gene Expression ACP Biology, NNHS

NOTES Gene Expression ACP Biology, NNHS Name Date Block NOTES Gene Expression ACP Biology, NNHS Model 1: Transcription the process of genes in DNA being copied into a messenger RNA 1. Where in the cell is DNA found? 2. Where in the cell does

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

Interpretation of sequence results

Interpretation of sequence results Interpretation of sequence results An overview on DNA sequencing: DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It use a modified PCR reaction where both

More information

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing

More information

Chapter 5. explain how information is submitted to and processed by biological databases.

Chapter 5. explain how information is submitted to and processed by biological databases. Introduction to Databases The computer belongs on the benchtop in the modern biology lab, along with other essential equipment. A network of online databases provides researchers with quick access to information

More information

SSA Signal Search Analysis II

SSA Signal Search Analysis II SSA Signal Search Analysis II SSA other applications - translation In contrast to translation initiation in bacteria, translation initiation in eukaryotes is not guided by a Shine-Dalgarno like motif.

More information

user s guide Question 3

user s guide Question 3 Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.

More information

BIOLOGY 2250 LABORATORY Genetic Resources on the Web and Analysis of Interspecific Variation in DNA Sequences

BIOLOGY 2250 LABORATORY Genetic Resources on the Web and Analysis of Interspecific Variation in DNA Sequences BIOLOGY 2250 LABORATORY 1 2011 Genetic Resources on the Web and Analysis of Interspecific Variation in DNA Sequences Determination of the sequences of macromolecules (proteins and nucleic acids) is a powerful

More information

Genes and gene finding

Genes and gene finding Genes and gene finding Ben Langmead Department of Computer Science You are free to use these slides. If you do, please sign the guestbook (www.langmead-lab.org/teaching-materials), or email me (ben.langmead@gmail.com)

More information

Annotating Fosmid 14p24 of D. Virilis chromosome 4

Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome

More information

Chapter 14: Gene Expression: From Gene to Protein

Chapter 14: Gene Expression: From Gene to Protein Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect

More information

Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence

Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

More information

Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0

Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0 Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0 Overview This tutorial details how a TaqMan MGB Probe can be designed over a specific region of

More information

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION

CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

Green Genes: a DNA Curriculum

Green Genes: a DNA Curriculum Green Genes: a DNA Curriculum Massachusetts 4-H Program Activity #2: Build Your Own DNA Model from Paper Parts Time: 45-60 minutes Introduction to Group: Ask the group what DNA is. Make sure the key concept

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

DNA Structure & the Genome. Bio160 General Biology

DNA Structure & the Genome. Bio160 General Biology DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:

More information

Eukaryotic Gene Structure

Eukaryotic Gene Structure Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and

More information

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417.

SENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417. SENIOR BIOLOGY Blueprint of life and Genetics: the Code Broken? NAME SCHOOL / ORGANISATION DATE Bay 12, 1417 Bay number Specimen number INTRODUCTORY NOTES Blueprint of Life In this part of the workshop

More information

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

More information

Protein Synthesis Transcription And Translation Lab Answers

Protein Synthesis Transcription And Translation Lab Answers Lab Answers Free PDF ebook Download: Lab Answers Download or Read Online ebook protein synthesis transcription and translation lab answers in PDF Format From The Best User Guide Database 1.. Anatomy and

More information

2. From the first paragraph in this section, find three ways in which RNA differs from DNA.

2. From the first paragraph in this section, find three ways in which RNA differs from DNA. Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours

More information

Lecture 2: Biology Basics Continued

Lecture 2: Biology Basics Continued Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information