DATA FORMATS AND QUALITY CONTROL
|
|
- Godfrey Clark
- 6 years ago
- Views:
Transcription
1 HTS Summer School 12-16th September 2016 DATA FORMATS AND QUALITY CONTROL Romina Petersen, University of Cambridge Luigi Grassi, University of Cambridge
2 HTS analysis workflow 2 Biological Sample Prepare library, sequence FASTQ Align short reads to genome VCF, BED, Downstream analysis SAM/BAM Call variants, differential expression,
3 From the sequencer to you 3 Sequencing is usually done by core facilities Each sequencing run will generate millions of short (~100 bp) reads + read quality score for each base They often perform initial processing Adaptor trimming Basic quality control Demultiplexing You will (usually) receive a FASTQ file
4 FASTQ Files 4 FASTQ = FASTA + Quality So what is FASTA?
5 FASTA Format (.fa,.fasta) 5 >CHROMOSOME_1 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTC AACTCACAGTTTGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATT >CHROMOSOME_2 TCACAGTTTGGTTCAAAGCAGTATCGATCATATCGATCAAATAGTAAA Format for raw DNA/protein sequences For each sequence: 1. > NAME 2. Nucleotides, with line breaks every ~60 bp
6 FASTQ format (.fq,.fastq) 6 Format for DNA sequencing reads For each read: Read ID 2. Nucleotide sequence of the read Quality score for each nucleotide of the read
7 7 Illumina sequence identifiers
8 Quality Scores 8 p = probability that the base call is wrong p = 0.1 à Q = 10 p = 0.01 à Q = 20 P = à Q = 30 Encoding: The Sanger Phred format can encode a quality score from 0 to 93 using ASCII 33 to 126:
9 Quality Score Encoding 9 ASCII Code Quality Score!"#$%&'()*+,-./ :;<=>?@ABCDEFGHI Each character has an associated ASCII Code Quality Score = ASCII Code Offset Normal Sanger Encoding is Phred + 33 Lowest:! = ASCII 33 = Quality 0 Highest: I = ASCII 73 = Quality 40
10 Quality Encoding Example
11 Different Quality Encodings 11 Beware of different versions! (especially for old data)
12 Paired-end reads 12 Sequence both the 5' and 3' end of a fragment Will result in two FASTQ files for a single run file1 n file2 n
13 single-end vs paired-end reads 13 AAGGAAGTGCTTGTCTGGCTAACACAGCNAGNCACGTGAC + avfbe`^^^_tttssdffffdfffabbzbbfebafbbbbb SE NAAATTTCGAATTTCTGTGAAGTAAGCATCTTCTTTGTCAT + BJJGGKIINN^^^^^QQNTUQOOTTTRTOTY^^Y^\\^^^\ my_sequence_2.fastq PE (from the Illumina AACCCACACAGGAGAGCAGCCTTACAGATGCAAATACTGTG + ]K fffffggghgeggggggdgggggfgggggegggghh
14 Sample barcoding and de-multiplexing 14 Barcoding De-multiplexing Barcode 1 Barcode 2 Barcode 3 + Sample 1 Sample 2 Sample 3 # Read 1 ATTAGACCTAAGCA # Read 2 GAGCAACGACTAC # Read 3 ATTAGGCCATACAT # Read 4 CCATAGGCTGACTA...
15 Common sequence artefacts in HTS data 15 q Read errors q Base calling errors q Small insertions and deletions q Poor quality reads q Primer / adapter contamination
16 16 Features across available QC tools
17 17 FastqScreen: contamination
18 FastQC: Per base sequence quality 18 FastQC:
19 19 Quality trimming
20 Removal of adapter sequences 20 q Necessary when the read length > molecule sequenced e.g. small RNAs q Different scenarios requiring adapter removal q q q Trim the 3 end Trim/discard the reads based on the residual minimum read length. Trim the adapter region but retain reads only with a minimum read-length. q Tools for adapter trimming q fastx_clipper (FastX-Toolkit), PRINSEQ
21 How to filter? 21 Fastx: PRINSEQ: Tally and Reaper: ShortRead (R): ShortRead.html
22 FASTQ Processing FASTX Toolkit 22 Many tools for common operations on FASTQ files: Conversion Trimming (remove barcodes) Clipping (remove adapters) Quality trimmer (trim off low-quality bases) Quality filter (remove low-quality reads)
23 Filtering example 23 Before After
24 24 Filtering comes at a price
25 Important: PE files 25 NAAATTTCGAATTTCTGTGAAGTAAGCATCTTCTTTGTCAT + BJJGGKIINN^^^^^QQNTUQOOTTTRTOTY^^Y^\\^^^\ AACCCACACAGGAGAGCAGCCTTACAGATGCAAATACTGTG + ]K fffffggghgeggggggdgggggfgggggegggghh filtering filtering mapping
26 Important: PE files 26 NAAATTTCGAATTTCTGTGAAGTAAGCATCTTCTTTGTCAT + BJJGGKIINN^^^^^QQNTUQOOTTTRTOTY^^Y^\\^^^\ AACCCACACAGGAGAGCAGCCTTACAGATGCAAATACTGTG + ]K fffffggghgeggggggdgggggfgggggegggghh filtering filtering mapping How? Trim Galore! (
27 Conclusions 27 Quality control of sequencing data is essential for downstream analysis. A range of QC tools are available to remove noise. Decide on which data can be corrected and discard the rest.
Quality assessment and control of sequence data. Naiara Rodríguez-Ezpeleta
Quality assessment and control of sequence data Naiara Rodríguez-Ezpeleta Workshop on Genomics 2014 Quality control is important Some of the artefacts/problems that can be detected with QC Sequencing Sequence
More informationQuality assessment and control of sequence data
Quality assessment and control of sequence data Naiara Rodríguez-Ezpeleta Workshop on Genomics 2015 Cesky Krumlov fastq format fasta Most basic file format to represent nucleotide or amino-acid sequences
More informationNGS sequence preprocessing. José Carbonell Caballero
NGS sequence preprocessing José Carbonell Caballero jcarbonell@cipf.es Contents Data Format Quality Control Sequence capture Fasta and fastq formats Sequence quality encoding Evaluation of sequence quality
More informationRead Quality Assessment & Improvement. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
Read Quality Assessment & Improvement UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 QA&I should be interactive Error modes Each technology has unique error modes, depending on the physico-chemical
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationEcole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationGenomic DNA ASSEMBLY BY REMAPPING. Course overview
ASSEMBLY BY REMAPPING Laurent Falquet, The Bioinformatics Unravelling Group, UNIFR & SIB MA/MER @ UniFr Group Leader @ SIB Course overview Genomic DNA PacBio Illumina methylation de novo remapping Annotation
More informationIllumina Read QC. UCD Genome Center Bioinformatics Core Monday 29 August 2016
Illumina Read QC UCD Genome Center Bioinformatics Core Monday 29 August 2016 QC should be interactive Error modes Each technology has unique error modes, depending on the physico-chemical processes involved
More informationGenomics AGRY Michael Gribskov Hock 331
Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationReference genomes and common file formats
Reference genomes and common file formats Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationBioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
More informationIntroduction to RNA sequencing
Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence
More informationLong and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012
Introduction to transcriptome analysis using High Throughput Sequencing technologies D. Puthier 2012 A typical RNA-Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationIntroduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationBST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data
BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%
More informationCNV and variant detection for human genome resequencing data - for biomedical researchers (II)
CNV and variant detection for human genome resequencing data - for biomedical researchers (II) Chuan-Kun Liu 劉傳崑 Senior Maneger National Center for Genome Medican bioit@ncgm.sinica.edu.tw Abstract Common
More informationaxe Documentation Release g6d4d1b6-dirty Kevin Murray
axe Documentation Release 0.3.2-5-g6d4d1b6-dirty Kevin Murray Jul 17, 2017 Contents 1 Axe Usage 3 1.1 Inputs and Outputs..................................... 4 1.2 The barcode file......................................
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationDifferential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 1: Introduction into high-throughput
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationNext-Generation Sequencing Services à la carte
Next-Generation Sequencing Services à la carte www.seqme.eu ngs@seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationRead Mapping and Variant Calling. Johannes Starlinger
Read Mapping and Variant Calling Johannes Starlinger Application Scenario: Personalized Cancer Therapy Different mutations require different therapy Collins, Meredith A., and Marina Pasca di Magliano.
More informationA step-by-step guide to ChIP-seq data analysis
A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D. EMBL-European Bioinformatics Institute Wellcome Trust Sanger Institute Target audience Wet-lab biologists with no experience
More informationRNA-seq Data Analysis
Lecture 3. Clustering; Function/Pathway Enrichment analysis RNA-seq Data Analysis Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Lecture 1. Map RNA-seq read to genome Lecture
More informationData Analysis with CASAVA v1.8 and the MiSeq Reporter
Data Analysis with CASAVA v1.8 and the MiSeq Reporter Eric Smith, PhD Bioinformatics Scientist September 15 th, 2011 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense
More informationPost- sequencing quality evalua2on. or what to do when you get your reads from the sequencer
Post- sequencing quality evalua2on or what to do when you get your reads from the sequencer The fastq file contains informa2on about sequence and quality Read Iden(fier Sequence Quality Sources of Library
More informationChang Xu Mohammad R Nezami Ranjbar Zhong Wu John DiCarlo Yexun Wang
Supplementary Materials for: Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John
More informationNext Generation Sequencing: An Overview
Next Generation Sequencing: An Overview Cavan Reilly November 13, 2017 Table of contents Next generation sequencing NGS and microarrays Study design Quality assessment Burrows Wheeler transform Next generation
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationRNAseq Differential Gene Expression Analysis Report
RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample
More informationEuropean Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
Guideline for the submission of DNA sequences derived from genetically modified organisms and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 European
More informationRNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
More informationIntroduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference
More informationscgem Workflow Experimental Design Single cell DNA methylation primer design
scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease
More informationFrom reads to results. Dr Torsten Seemann
From reads to results Dr Torsten Seemann AGRF/EMBL Introduction to Bioinformatics - Monash University - Wed 1 Aug 2012 What I will cover * NGS Applications Sequences Sequence quality Read file formats
More informationBase Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries
TECHNICAL NOTE Base Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries INTRODUCTION The Chromium Single Cell 3 v2 Protocol (CG00052) produces Single Cell 3 libraries, ready for Illumina
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationChIP-seq analysis. adapted from J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant
ChIP-seq analysis adapted from J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant http://biow.sb-roscoff.fr/ecole_bioinfo/training_material/chip-seq/documents/presentation_chipseq.pdf A model
More informationL3: Short Read Alignment to a Reference Genome
L3: Short Read Alignment to a Reference Genome Shamith Samarajiwa CRUK Autumn School in Bioinformatics Cambridge, September 2017 Where to get help! http://seqanswers.com http://www.biostars.org http://www.bioconductor.org/help/mailing-list
More informationNGS technologies approaches, applications and challenges!
www.supagro.fr NGS technologies approaches, applications and challenges! Jean-François Martin Centre de Biologie pour la Gestion des Populations Centre international d études supérieures en sciences agronomiques
More informationRNA Seq: Methods and Applica6ons. Prat Thiru
RNA Seq: Methods and Applica6ons Prat Thiru 1 Outline Intro to RNA Seq Biological Ques6ons Comparison with Other Methods RNA Seq Protocol RNA Seq Applica6ons Annota6on Quan6fica6on Other Applica6ons Expression
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationImplementation of Automated Sample Quality Control in Whole Exome Sequencing
Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor
More informationSequencing techniques and applications
I519 Introduction to Bioinformatics Sequencing techniques and applications Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Sequencing techniques Sanger sequencing Next generation
More informationTargeted Sequencing in the NBS Laboratory
Targeted Sequencing in the NBS Laboratory Christopher Greene, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Gene Sequencing in Public Health Newborn Screening February
More informationRNA- seq data analysis tutorial. Andrea Sboner
RNA- seq data analysis tutorial Andrea Sboner 2015-05- 21 NGS Experiment Data management: Mapping the reads CreaCng summaries Downstream analysis: the interes)ng stuff DifferenCal expression, chimeric
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
More informationHLA and Next Generation Sequencing it s all about the Data
HLA and Next Generation Sequencing it s all about the Data John Ord, NHSBT Colindale and University of Cambridge BSHI Annual Conference Manchester September 2014 Introduction In 2003 the first full public
More informationAutomated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep
Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION &
More informationTECH NOTE SMARTer T-cell receptor profiling in single cells
TECH NOTE SMARTer T-cell receptor profiling in single cells Flexible workflow: Illumina-ready libraries from FACS or manually sorted single cells Ease of use: Optimized indexing allows for pooling 96 cells
More informationAnalysis of barcode sequencing
Analysis of barcode sequencing Department of Functional Genomics, UST Jihyeob Mun 2016.12.07 Pooled library screen analysis experience knowledge gene A is a target? High-throughput Simplicity Fail Pooled
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationAlignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationNext Generation Sequencing Technologies. Some slides are modified from Robi Mitra s lecture notes
Next Generation Sequencing Technologies Some slides are modified from Robi Mitra s lecture notes What will you do to understand a disease? What will you do to understand a disease? Genotype Phenotype Hypothesis
More informationLecture 2: Biology Basics Continued
Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and
More informationSequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute
Sequencing Theory Brett E. Pickett, Ph.D. J. Craig Venter Institute Applications of Genomics and Bioinformatics to Infectious Diseases GABRIEL Network Agenda Sequencing Instruments Sanger Illumina Ion
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationFundamentals of Next-Generation Sequencing: Technologies and Applications
Fundamentals of Next-Generation Sequencing: Technologies and Applications Society for Hematopathology European Association for Haematopathology 2017 Workshop Eric Duncavage, MD Washington University in
More informationNext Generation Sequencing. Dylan Young Biomedical Engineering
Next Generation Sequencing Dylan Young Biomedical Engineering What is DNA? Molecule composed of Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Paired as either AT or CG Provides genetic instructions
More informationGreen Center Computational Core ChIP- Seq Pipeline, Just a Click Away
Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away Venkat Malladi Computational Biologist Computational Core Cecil H. and Ida Green Center for Reproductive Biology Science Introduc
More informationwith drmid Dx for Illumina NGS systems
Performance Characteristics BRCA MASTR Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Revision date: July 27, 2017 Page 1 of 8 Table of Contents
More informationWorkflow of de novo assembly
Workflow of de novo assembly Experimental Design Clean sequencing data (trim adapter and low quality sequences) Run assembly software for contiging and scaffolding Evaluation of assembly Several iterations:
More informationIntroduction to taxonomic analysis of metagenomic amplicon and shotgun data with QIIME. Peter Sterk EBI Metagenomics Course 2014
Introduction to taxonomic analysis of metagenomic amplicon and shotgun data with QIIME Peter Sterk EBI Metagenomics Course 2014 1 Taxonomic analysis using next-generation sequencing Objective we want to
More informationMEEPTOOLS: A maximum expected error based FASTQ read filtering and trimming toolkit
MEEPTOOLS: A maximum expected error based FASTQ read filtering and trimming toolkit Vishal N. Koparde 1* (vnkoparde@vcu.edu) Hardik I. Parikh 2 (parikhhi@vcu.edu) Steven P. Bradley 2 (bradleysp@vcu.edu)
More informationRNA-seq data analysis with Chipster. Eija Korpelainen CSC IT Center for Science, Finland
RNA-seq data analysis with Chipster Eija Korpelainen CSC IT Center for Science, Finland chipster@csc.fi What will I learn? 1. What you can do with Chipster and how to operate it 2. What RNA-seq can be
More informationHow much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
More informationA Roadmap to the De-novo Assembly of the Banana Slug Genome
A Roadmap to the De-novo Assembly of the Banana Slug Genome Stefan Prost 1 1 Department of Integrative Biology, University of California, Berkeley, United States of America April 6th-10th, 2015 Outline
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationSOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow
More informationPerformance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer
Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Technical Note 10 Measured conc. [ng/µl] 1 Y intercept = 0.09 r 2 = 0.993 0.1 0.1 1 10 Reference concentration
More informationGenome Reagent Kits v2 Quick Reference Cards
Chromium Genome Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Genome Library Kit & Gel Bead Kit v2, 16 rxns PN-120258 Chromium Genome Chip Kit v2, 48 rxns PN-120257 Chromium i7 Multiplex
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationDigital DNA/RNA sequencing enables highly accurate and sensitive biomarker detection and quantification
Digital DNA/RNA sequencing enables highly accurate and sensitive biomarker detection and quantification Erwin Chen ( 陳立德 ) Technical Product Specialist QIAGEN Taiwan Precision medicine: Right drug, right
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationDNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA
DNA Replication DNA vs. RNA DNA: deoxyribonucleic acid (double stranded) RNA: ribonucleic acid (single stranded) Both found in most bacterial and eukaryotic cells RNA molecule can assume different structures
More informationTargeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales
Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationMHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells
DNA based HLA typing methods By: Yadollah Shakiba, MD, PhD MHC Region MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells Nomenclature of HLA Alleles Assigned
More informationIndex. E Electrophoretic Mobility Shift Assay (EMSA), 262 ENCODE project, 223, 224 European Nucleotide Archive (ENA), 34
A Alternative splicing computational analysis, 114 data processing, 106 experimental design, 114 isoform quantification AltAnalyze, 109 CuffDiff, 110 DEXSeq, 108 DiffSplice, 109 exon/transcript isoform,
More informationAxygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand
Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the
More informationIntroduction to NGS Analysis Tools
National Center for Emerging and Zoonotic Infectious Diseases Introduction to NGS Analysis Tools Heather Carleton, PhD, MPH Team Lead, Enteric Diseases Bioinformatics, Enteric Diseases Laboratory Branch,
More informationtherascreen BRCA1/2 NGS FFPE gdna Kit Handbook Part 2: Analysis
February 2017 therascreen BRCA1/2 NGS FFPE gdna Kit Handbook Part 2: Analysis Version 1 For the identification of variants in BRCA1 and BRCA2 For in vitro diagnostic use For use with Illumina MiSeqDx platform
More informationDe novo metatranscriptome assembly and coral gene expression profile of Montipora capitata with growth anomaly
Additional File 1 De novo metatranscriptome assembly and coral gene expression profile of Montipora capitata with growth anomaly Monika Frazier, Martin Helmkampf, M. Renee Bellinger, Scott Geib, Misaki
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationAlignment methods. Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics
Alignment methods Martijn Vermaat Department of Human Genetics Center for Human and Clinical Genetics Alignment methods Sequence alignment Assembly vs alignment Alignment methods Common issues Platform
More informationFinishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome
Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome Ruth Howe Bio 434W 27 February 2010 Abstract The fourth or dot chromosome of Drosophila species is composed primarily of highly condensed,
More informationGenomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
More informationBENG 183 Trey Ideker. Genome Assembly and Physical Mapping
BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More information