Introduction to Sequencher. Tom Randall Center for Bioinformatics
|
|
- Domenic Carson
- 6 years ago
- Views:
Transcription
1 Introduction to Sequencher Tom Randall Center for Bioinformatics
2 Introduction Importing, viewing and manipulating chromatographs Trimming chromatographs Assembly into contigs Editing and exporting contigs
3 pdfs of above are on your computer if Sequencher is installed: C > Program Files > Gene Codes > Sequencher 4.x > Tutorials
4 Licensed to UNC CH only, need an onyen 14 concurrent PC licenses, 12 concurrent Mac licenses For off-campus use VPN Client needs to be installed
5 Sequencher vs ContigExpress Different algorithms, assembly options End trimming and vector trimming very similar Sequencher vector trimming more reliable Both use quality scores UNC Sequencing facility does not give quality scores (problems with ABI basecalling algorithm) Integration of ContigExpress into Vector NTI is very convenient, graphics better No need to learn both Most think Sequencher is superior to ContigExpress Sequencher licensed for UNC-CH only, ContigExpress is free to academic/govt users
6 Sequencher Features Open, view and save chromatogram data into fasta format text file Automatic trimming for quality and for vector/primer Create assemblies for shotgun or EST sequencing project Editing contigs while viewing all relevant trace data Assembling multiple sequences to a user-defined Reference Sequence Detecting and annotating polymorphisms in variance table Displaying restriction maps, ORF maps, protein translation Aligning cdnas to their genomic sequence using the Large Gap algorithm
7 Manipulating individual chromatographs Cut Map displays RE sites (Select Enzymes to choose) Ruler change sequence display, show translations Sequence > Edit Features in drop down menu adding features to your sequence Sequence > Revert to Experimental change editing of a selected sequence(s) View dropdown menu, change look of sequence
8 Vector Trimming procedure See handout for adding a vector to the VecBase.txt file ( me also) Vector has to be in VecBase.txt file (C > Program Files > Gene Codes > Sequencher 4.x > VecBase.txt Contains 140 vectors, last updated 1987
9 Vector Trimming, cont. Select sequences to trim Go to Sequence > Trim Vector Select Choose Insertion Site Now Choose Vector and Select Choose Insertion Site Close Insertion Site Window Go to Sequence > Trim Vector to finish If you want to do a different screen you need to close the application and repeat the process
10 UniVec Database Statistics UniVec build #4.0 (Feb. 20, 2007) Number of sequences represented 1096 (4,332,307 bases)
11 Assembly options Assemble Automatically no manual decisions except setting parameters Assemble Interactively Assemble one by one based on current parameters Assemble to Reference for resequencing projects, SNP or mutation identification Mindlessly Join assemble irregardless of similiarity Assembly parameters overlap and % identity are most important Assemble with gaps for assembly of cdna and genomic, alternative splicing Consensus view Inclusively uses IUPAC ambiguities, less informative Plurality majority rule ASSEMBLY WITH REALIGNER Realigner is an optional step that can augment the standard assembly algorithm. The ReAligner function evaluates the placement of gaps within a contig and optimizes their placement. ReAligner facilitates editing in the consensus sequence and more clearly displays the effect of insertions and deletions.
12 SNP Discovery Variance Table for SNP Discovery Example project: C > Program Files > Gene Codes > Sequencher 4.x > Sample Data > SNP Hunting use Assemble to Reference option and Sequence > Compare Bases To > Reference Sequence
ELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationGenomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
More informationFinishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome
Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome Ruth Howe Bio 434W 27 February 2010 Abstract The fourth or dot chromosome of Drosophila species is composed primarily of highly condensed,
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationBENG 183 Trey Ideker. Genome Assembly and Physical Mapping
BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationInterpretation of sequence results
Interpretation of sequence results An overview on DNA sequencing: DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It use a modified PCR reaction where both
More informationBCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationTUTORIAL: PCR ANALYSIS AND PRIMER DESIGN
C HAPTER 8 TUTORIAL: PCR ANALYSIS AND PRIMER DESIGN Introduction This chapter introduces you to tools for designing and analyzing PCR primers and procedures. At the end of this tutorial session, you will
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationAgilent Genomic Workbench 7.0
Agilent Genomic Workbench 7.0 Product Overview Guide Agilent Technologies Notices Agilent Technologies, Inc. 2012, 2015 No part of this manual may be reproduced in any form or by any means (including electronic
More informationAxiom mydesign Custom Array design guide for human genotyping applications
TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required
More informationGenome Sequencing-- Strategies
Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that
More informationOutline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationBioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
More informationBioinformatics Support of Genome Sequencing Projects. Seminar in biology
Bioinformatics Support of Genome Sequencing Projects Seminar in biology Introduction The Big Picture Biology reminder Enzyme for DNA manipulation DNA cloning DNA mapping Sequencing genomes Alignment of
More informationGap Filling for a Human MHC Haplotype Sequence
American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human
More informationUCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
More informationSVMerge Output File Format Specification Sheet
SVMerge Output File Format Specification Sheet Document Number: 30165 Document Revision: C For Research Use Only. Not for use in diagnostic procedures. Copyright 2017 Bionano Genomics, Inc. All Rights
More informationProtein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationGenome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
More informationTypically, to be biologically related means to share a common ancestor. In biology, we call this homologous
Typically, to be biologically related means to share a common ancestor. In biology, we call this homologous. Two proteins sharing a common ancestor are said to be homologs. Homologyoften implies structural
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationA General Sequence Processing and Analysis Program for Protein Engineering
pubs.acs.org/jcim Terms of Use A General Sequence Processing and Analysis Program for Protein Engineering Ryan L. Stafford,* Erik S. Zimmerman, Trevor J. Hallam, and Aaron K. Sato Protein Engineering,
More informationMGC premier cdnas. MGC premier The best value for ready-to-express cdna clones. Highest quality, comprehensive coverage, cost effective = Best Value
Highest quality, comprehensive coverage, cost effective = Best Value Enabling Discovery Across the Genome MGC premier The best value for ready-to-express cdna clones MGC premier cdnas www.transomic.com
More informationSerial Analysis of Gene Expression
Serial Analysis of Gene Expression Cloning of Tissue-Specific Genes Using SAGE and a Novel Computational Substraction Approach. Genomic (2001) Hung-Jui Shih Outline of Presentation SAGE EST Article TPE
More informationDesigning TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0
Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0 Overview This tutorial details how a TaqMan MGB Probe can be designed over a specific region of
More informationGeriMedProfiles. Consultant Pharmacist Software
GeriMedProfiles Consultant Pharmacist Software Features GerimedProfiles TM is a comprehensive medical database for clinical pharmacists Utilizes Microsoft Access as the core database allowing the end-user
More informationFinishing Drosophila Ananassae Fosmid 2728G16
Finishing Drosophila Ananassae Fosmid 2728G16 Kyle Jung March 8, 2013 Bio434W Professor Elgin Page 1 Abstract For my finishing project, I chose to finish fosmid 2728G16. This fosmid carries a segment of
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
More informationTraining materials.
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
More informationSequence Variations. Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms. NCBI SNP Primer:
Sequence Variations Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms NCBI SNP Primer: http://www.ncbi.nlm.nih.gov/about/primer/snps.html Overview Mutation and Alleles Linkage Genetic variation
More informationTraceTools: a new DNA basecaller
Full Length Paper TraceTools: a new DNA basecaller Mohamad T. Musavi *1, Cristian Domnisoru 2, Padma Natarajan 1, Rency Varghese 1, Mike Toothaker 1, Jehad Dawood 1, Habtom Ressom 1, Rebecca Van Beneden
More informationCustom TaqMan Assays DESIGN AND ORDERING GUIDE. For SNP Genotyping and Gene Expression Assays. Publication Number Revision G
Custom TaqMan Assays DESIGN AND ORDERING GUIDE For SNP Genotyping and Gene Expression Assays Publication Number 4367671 Revision G For Research Use Only. Not for use in diagnostic procedures. Manufacturer:
More informationChapter 1 Analysis of ChIP-Seq Data with Partek Genomics Suite 6.6
Chapter 1 Analysis of ChIP-Seq Data with Partek Genomics Suite 6.6 Overview ChIP-Sequencing technology (ChIP-Seq) uses high-throughput DNA sequencing to map protein-dna interactions across the entire genome.
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationApplication for Automating Database Storage of EST to Blast Results. Vikas Sharma Shrividya Shivkumar Nathan Helmick
Application for Automating Database Storage of EST to Blast Results Vikas Sharma Shrividya Shivkumar Nathan Helmick Outline Biology Primer Vikas Sharma System Overview Nathan Helmick Creating ESTs Nathan
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationFiles for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationAnalyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek
Analyzing Affymetrix GeneChip SNP 6 Copy Number Data in Partek This example data set consists of 20 selected HapMap samples, representing 10 females and 10 males, drawn from a mixed ethnic population of
More informationSequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
More informationPRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5
Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate
More informationAnswer: Sequence overlap is required to align the sequenced segments relative to each other.
14 Genomes and Genomics WORKING WITH THE FIGURES 1. Based on Figure 14-2, why must the DNA fragments sequenced overlap in order to obtain a genome sequence? Answer: Sequence overlap is required to align
More informationEngagement Portal. Employee Engagement User Guide Press Ganey Associates, Inc.
Engagement Portal Employee Engagement User Guide 2015 Press Ganey Associates, Inc. Contents Logging In... 3 Summary Dashboard... 4 Results For... 5 Filters... 6 Summary Page Engagement Tile... 7 Summary
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
More informationPEAKS 8 User Manual. PEAKS Team
PEAKS 8 User Manual PEAKS Team PEAKS 8 User Manual PEAKS Team Publication date 2016 Table of Contents 1. Overview... 1 1. How to Use This Manual... 1 2. What Is PEAKS?... 1 3. What Is New in PEAKS 8?...
More informationEnsembl Tools. EBI is an Outstation of the European Molecular Biology Laboratory.
Ensembl Tools EBI is an Outstation of the European Molecular Biology Laboratory. Questions? We ve muted all the mics Ask questions in the Chat box in the webinar interface I will check the Chat box periodically
More informationRNASEQ WITHOUT A REFERENCE
RNASEQ WITHOUT A REFERENCE Experimental Design Assembly in Non-Model Organisms And other (hopefully useful) Stuff Meg Staton mstaton1@utk.edu University of Tennessee Knoxville, TN I. Project Design Things
More informationBioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview
Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, 2007 @ EnviroHealth Connections Bioinformatics and
More informationFINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1)
FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1) 1.1 Finding a gene using text search. Note: For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium.
More informationBioinformatic tools for metagenomic data analysis
Bioinformatic tools for metagenomic data analysis MEGAN - blast-based tool for exploring taxonomic content MG-RAST (SEED, FIG) - rapid annotation of metagenomic data, phylogenetic classification and metabolic
More informationBIOINFORMATICS Introduction
BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea
More informationIntroduction to RNA sequencing
Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence
More informationTutorial. In Silico Cloning. Sample to Insight. March 31, 2016
In Silico Cloning March 31, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com In Silico Cloning
More informationData Analysis with CASAVA v1.8 and the MiSeq Reporter
Data Analysis with CASAVA v1.8 and the MiSeq Reporter Eric Smith, PhD Bioinformatics Scientist September 15 th, 2011 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense
More informationDNA sequencing. Course Info
DNA sequencing EECS 458 CWRU Fall 2004 Readings: Pevzner Ch1-4 Adams, Fields & Venter (ISBN:0127170103) Serafim Batzoglou s slides Course Info Instructor: Jing Li 509 Olin Bldg Phone: X0356 Email: jingli@eecs.cwru.edu
More informationComparative Bioinformatics. BSCI348S Fall 2003 Midterm 1
BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to
More informationSENIOR BIOLOGY. Blueprint of life and Genetics: the Code Broken? INTRODUCTORY NOTES NAME SCHOOL / ORGANISATION DATE. Bay 12, 1417.
SENIOR BIOLOGY Blueprint of life and Genetics: the Code Broken? NAME SCHOOL / ORGANISATION DATE Bay 12, 1417 Bay number Specimen number INTRODUCTORY NOTES Blueprint of Life In this part of the workshop
More informationUsing the Association Workflow in Partek Genomics Suite
Using the Association Workflow in Partek Genomics Suite This user guide will illustrate the use of the Association workflow in Partek Genomics Suite (PGS) and discuss the basic functions available within
More informationBST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data
BST227 Introduction to Statistical Genetics Lecture 8: Variant calling from high-throughput sequencing data 1 PC recap typical genome Differs from the reference genome at 4-5 million sites ~85% SNPs ~15%
More informationBionano Access 1.1 Software User Guide
Bionano Access 1.1 Software User Guide Document Number: 30142 Document Revision: B For Research Use Only. Not for use in diagnostic procedures. Copyright 2017 Bionano Genomics, Inc. All Rights Reserved.
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationLawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory
Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Title SNP-VISTA: An Interactive SNPs Visualization Tool Permalink https://escholarship.org/uc/item/74z965bg Authors Shah, Nameeta
More informationSelect2Perform InterView User s Guide
Select2Perform InterView User s Guide Table of Contents INTRODUCTION 1 Licensing 1 Competencies and Custom Questions 1 Interview Guides 1 MANAGING COMPETENCIES 2 Adding a Competency 2 Viewing a Competency
More informationPost-assembly Data Analysis
Assembled transcriptome Post-assembly Data Analysis Quantification: the expression level of each gene in each sample DE genes: genes differentially expressed between samples Clustering/network analysis
More informationHow to view Results with Scaffold. Proteomics Shared Resource
How to view Results with Scaffold Proteomics Shared Resource Starting out Download Scaffold from http://www.proteomes oftware.com/proteom e_software_prod_sca ffold_download.html Follow installation instructions
More informationSection 1 : About the Resource Database
Section 1 : About the Resource Database The Resource Database brings together community-identified resources in a shared, searchable database which is integrated with the Client Registry. Since this single
More informationLast Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by T. Cordonnier, C. Shaffer, W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Recommended Background
More informationA shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter
A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing
More informationIdentification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources
Identification of Single Nucleotide Polymorphisms and associated Disease Genes using NCBI resources Navreet Kaur M.Tech Student Department of Computer Engineering. University College of Engineering, Punjabi
More informationLecture 2: Biology Basics Continued
Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and
More informationThe String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.
Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif
More informationImproving the Accuracy of Base Calls and Error Predictions for GS 20 DNA Sequence Data
Improving the Accuracy of Base Calls and Error Predictions for GS 20 DNA Sequence Data Justin S. Hogg Department of Computational Biology University of Pittsburgh Pittsburgh, PA 15213 jsh32@pitt.edu Abstract
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationBiotechnology Explorer
Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual
More informationVariation detection based on second generation sequencing data. Xin LIU Department of Science and Technology, BGI
Variation detection based on second generation sequencing data Xin LIU Department of Science and Technology, BGI liuxin@genomics.org.cn 2013.11.21 Outline Summary of sequencing techniques Data quality
More informationUC Davis UC Davis Previously Published Works
UC Davis UC Davis Previously Published Works Title Annotation-based genome-wide SNP discovery in the large and complex Aegilops tauschii genome using next-generation sequencing without a reference genome
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationRestriction Site Mapping:
Restriction Site Mapping: In making genomic library the DNA is cut with rare cutting enzymes and large fragments of the size of 100,000 to 1000, 000bp. They are ligated to vectors such as Pacmid or YAC
More informationSeqStudio Genetic Analyzer
SeqStudio Genetic Analyzer Optimized for Sanger sequencing and fragment analysis Easy to use for all levels of experience From a leader in genetic analysis instrumentation, introducing the new Applied
More informationMapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationBIOLOGY 2250 LABORATORY Genetic Resources on the Web and Analysis of Interspecific Variation in DNA Sequences
BIOLOGY 2250 LABORATORY 1 2011 Genetic Resources on the Web and Analysis of Interspecific Variation in DNA Sequences Determination of the sequences of macromolecules (proteins and nucleic acids) is a powerful
More informationHow MacroView Enables ECM Solutions on SharePoint & Office 365
Document Management You are looking to create an Enterprise Content Management solution for your organization. The budget is tight and of course you want user adoption to be high. You are also well aware
More informationDiagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support
Diagnosis Sanger Interpreting and Troubleshooting Chromatograms GENEWIZ Technical Support DNAseq@genewiz.com Troubleshooting This troubleshooting guide is based on common issues seen from samples within
More informationAP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants
What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics
More informationB I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
More informationFACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE
FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More information